research 1 more to unlock duplication

Ethics Policy
Ownership Policy
Corrections Policy

How to research and duplicate items in Terraria

Update 1.4 for Terraria has released adding a ton of new items and game mechanics along with the usual bug fixes and updated graphics. One of the most anticipated additions brought with this update is the new Journey mode. Journey mode is a new game mode that gives players a lot of new powers and settings that aren’t available in the other game modes. These powers include the ability to research and duplicate items you collect during gameplay.

Researching items is relatively easy. The research option is available from the power menu. Just hit Esc, click on the power menu icon just below your inventory to access the available powers.

Sony Working On PS4 Cross Platform Support With Xbox And Nintendo

From this menu, click on the gear icon to access the research power. You will notice than when you hover over items in the inventory now, there is some new red text at the bottom of the description. This text will tell you how many times you need to research and item to duplicate it later. If you want to duplicate something like bombs, you will need to research 99 before the option to duplicate them becomes available. In early playthroughs of the latest update, you only need to research rare and more useful items, like chests and tools, one time to duplicate them. On the other hand, you will need to research around 100 of the more common items, like torches and wood, to be able to duplicate them.

Death Stranding Is Like A Math Problem - Kojima

When the research menu is open, just drop an item into the empty box and hit “Research.” The item will be consumed during the process, but if you have researched enough, it will become immediately available for duplication.

Be very careful when choosing an item to duplicate. The item will be consumed in the process, and any duplicates will not have the same modifier. For example, if you research a godly wooden boomerang, you will only be able to duplicate an unmodified wooden boomerang.

To duplicate an item, click on the icon with the three colored blocks above the research power menu. This will give you access to an inventory menu with all of the items you can duplicate. This menu also features a search bar to make things easier once you have filled the menu in the late game. Just click and drag any item from the duplication menu into your inventory. There is no cost to duplicate an item, and you will get the maximum number that can be placed in a single inventory slot.

Coin Master free spins and coins daily working links

Home > Game Guides

Game Guides

How to Research and Duplicate Items in Terraria 1.4 Journey Mode

by enricofairme · Published May 16, 2020 11:34 AM · Updated May 16, 2020 3:04 PM

Featured image on Terraria 1.4 Journey Mode How to Research and Duplicate Items guide

The new Terraria 1.4 update brings a number of new additions to the title including a new mode called Journey . In the Journey mode players are able to control a number of gameplay mechanics including things like research and duplication of items. To help you do this for yourself use our how to research and duplicate items guide below.

Important : Be sure you have Terraria 1.4 downloaded to gain access to Journey mode .

How do You Research and Duplicate Items

Image showing how to Research in Terraria 1.4 Journey mode.

The process of research and duplication is fairly straightforward in Terraria . To duplicate items in Journey mode you must first gather enough of the item you wish to duplicate so you can complete its research. Both of these options can be found under the Power Menu on the inventory screen. To make the process clearer here’s an example for you:

Find/Build 100 Torches.
Place Torches in Research (requires 100).
Research Torches.
Once fully Researched can be duplicated via Duplication.
When duplicated you receive full stack of items.

The above process requires collecting the items you wish to duplicate so you can fully research them. This means finding items, harvesting items, etc. When you do research you will lose the stack you submit so be warned. Ideally wait until you have a full stack to submit.

MORE TERRARIA

How to get the Zoologist guide .
How to Get the Golfer guide.

Thoughts on our how to Research and Duplicate items in Terraria 1.4 Journey Mode guide? Drop them in The Pit below.

Tags: Terraria

enricofairme

A lifelong gamer who has devoted the last six years to the creation and development of "Hold To Reset," a website tailored by gamers for gamers. Yell your hot takes at him on X .

6 responses

Pingbacks 0

Journey mode is not new. Journey mode has been around since the Journey’s End update over a year ago. The menu is in the bunny icon below the inventory.

gnbefhvfjbgsdxgsjalhGXDGSIHAO;JDGHAJsxgf

How did you get to that menu I can’t find it?

No ones going to help you. I feeel sorry for you.

The research tab is in the inventory menu, specifically, the crafting menu on the bottom left. Left of the crafting menu, there are 3 options. You should find it there!

Terraria Wiki

Discussions are now available on the Terraria Wiki.
Miss the old Hydra Skin? Try out our Hydralize gadget! Visit the preferences page while logged in and turn on the gadget.

Journey Mode/Research list

This page lists all individual required numbers of items needed to research for duplication.

ID	Item	Research
1		1
2		100
3		100
4		1
5		30
6		1
7		1
8		100
9		100
10		1
11		100
12		100
13		100
14		100
15		1
16		1
17		1
18		1
19		25
20		25
21		25
22		25
23		99
24		1
25		1
26		400
27		50
28		30
29		10
30		400
31		25
32		1
33		1
34		1
35		1
36		1
37		1
38		25
39		1
40		99
41		99
42		99
43		3
44		1
45		1
46		1
47		99
48		1
49		1
50		1
51		99
52		1
53		1
54		1
55		1
56		100
57		25
58		n/a
59		25
60		25
61		100
62		25
63		5
64		1
65		1
66		99
67		99
68		25
69		25
70		3
71		100
72		100
73		100
74		100
75		50
76		1
77		1
78		1
79		1
80		1
81		1
82		1
83		1
84		1
85		100
86		25
87		1
88		1
89		1
90		1
91		1
92		1
93		400
94		200
95		1
96		1
97		99
98		1
99		1
100		1
101		1
102		1
103		1
104		1
105		1
106		1
107		1
108		1
109		10
110		30
111		1
112		1
113		1
114		1
115		1
116		100
117		25
118		1
119		1
120		1
121		1
122		1
123		1
124		1
125		1
126		30
127		1
128		1
129		100
130		400
131		100
132		400
133		100
134		100
135		400
136		1
137		100
138		400
139		100
140		400
141		100
142		400
143		100
144		400
145		100
146		400
147		100
148		1
149		25
150		50
151		1
152		1
153		1
154		99
155		1
156		1
157		1
158		1
159		1
160		1
161		99
162		1
163		1
164		1
165		1
166		99
167		99
168		99
169		100
170		100
171		1
172		100
173		100
174		100
175		25
176		100
177		15
178		15
179		15
180		15
181		15
182		15
183		100
184		n/a
185		1
186		1
187		1
188		30
189		30
190		1
191		1
192		100
193		1
194		25
195		25
196		1
197		1
198		1
199		1
200		1
201		1
202		1
203		1
204		1
205		1
206		1
207		1
208		1
209		25
210		5
211		1
212		1
213		1
214		100
215		1
216		1
217		1
218		1
219		1
220		1
221		1
222		1
223		1
224		1
225		25
226		30
227		30
228		1
229		1
230		1
231		1
232		1
233		1
234		99
235		99
236		1
237		1
238		1
239		1
240		1
241		1
242		1
243		1
244		1
245		1
246		1
247		1
248		1
249		1
250		1
251		1
252		1
253		1
254		5
255		5
256		1
257		1
258		1
259		5
260		1
261		5
262		1
263		1
264		1
265		99
266		1
267		1
268		1
269		1
270		1
271		1
272		1
273		1
274		1
275		25
276		100
277		1
278		99
279		99
280		1
281		1
282		100
283		99
284		1
285		1
286		100
287		99
288		20
289		20
290		20
291		20
292		20
293		20
294		20
295		20
296		20
297		20
298		20
299		20
300		20
301		20
302		20
303		20
304		20
305		20
306		1
307		25
308		25
309		25
310		25
311		25
312		25
313		25
314		25
315		25
316		25
317		25
318		25
319		25
320		25
321		2
322		1
323		5
324		1
325		1
326		1
327		3
328		1
329		1
330		400
331		25
332		1
333		1
334		1
335		1
336		1
337		1
338		1
339		1
340		1
341		1
342		1
343		1
344		1
345		1
346		1
347		1
348		1
349		1
350		1
351		1
352		1
353		20
354		1
355		1
356		1
357		5
358		1
359		1
360		1
361		3
362		25
363		1
364		100
365		100
366		100
367		1
368		1
369		25
370		100
371		1
372		1
373		1
374		1
375		1
376		1
377		1
378		1
379		1
380		1
381		25
382		25
383		1
384		1
385		1
386		1
387		1
388		1
389		1
390		1
391		25
392		400
393		1
394		1
395		1
396		1
397		1
398		1
399		1
400		1
401		1
402		1
403		1
404		1
405		1
406		1
407		1
408		100
409		100
410		1
411		1
412		100
413		100
414		100
415		100
416		100
417		400
418		400
419		400
420		400
421		400
422		99
423		99
424		200
425		1
426		1
427		100
428		100
429		100
430		100
431		100
432		100
433		100
434		1
435		1
436		1
437		1
438		1
439		1
440		1
441		1
442		1
443		1
444		1
445		1
446		1
447		1
448		1
449		1
450		1
451		1
452		1
453		1
454		1
455		1
456		1
457		1
458		1
459		1
460		1
461		1
462		1
463		1
464		1
465		1
466		1
467		1
468		1
469		1
470		1
471		1
472		1
473		1
474		1
475		1
476		1
477		1
478		1
479		400
480		50
481		1
482		1
483		1
484		1
485		1
486		1
487		1
488		1
489		1
490		1
491		1
492		1
493		1
494		1
495		1
496		1
497		1
498		1
499		30
500		30
501		25
502		25
503		1
504		1
505		1
506		1
507		1
508		1
509		1
510		1
511		100
512		100
513		5
514		1
515		99
516		99
517		1
518		1
519		1
520		25
521		25
522		25
523		100
524		1
525		1
526		5
527		1
528		1
529		5
530		100
531		1
532		1
533		1
534		1
535		1
536		1
537		1
538		5
539		5
540		5
541		5
542		5
543		5
544		3
545		99
546		99
547		25
548		25
549		25
550		1
551		1
552		1
553		1
554		1
555		1
556		3
557		3
558		1
559		1
560		3
561		1
562		1
563		1
564		1
565		1
566		1
567		1
568		1
569		1
570		1
571		1
572		1
573		1
574		1
575		25
576		1
577		100
578		1
579		1
580		5
581		1
582		1
583		1
584		1
585		1
586		100
587		400
588		1
589		1
590		1
591		100
592		400
593		100
594		100
595		400
596		25
597		25
598		25
599		n/a
600		n/a
601		n/a
602		3
603		1
604		100
605		400
606		400
607		100
608		400
609		100
610		400
611		100
612		100
613		100
614		100
615		400
616		400
617		400
618		400
619		100
620		100
621		100
622		400
623		400
624		400
625		1
626		1
627		1
628		1
629		1
630		1
631		200
632		200
633		200
634		200
635		1
636		1
637		1
638		1
639		1
640		1
641		1
642		1
643		1
644		1
645		1
646		1
647		1
648		1
649		1
650		1
651		1
652		1
653		1
654		1
655		1
656		1
657		1
658		1
659		1
660		1
661		1
662		100
663		400
664		100
665		1
666		1
667		1
668		1
669		1
670		1
671		1
672		1
673		1
674		1
675		1
676		1
677		1
678		3
679		1
680		1
681		1
682		1
683		1
684		1
685		1
686		1
687		1
688		1
689		1
690		1
691		1
692		1
693		1
694		1
695		1
696		1
697		1
698		1
699		100
700		100
701		100
702		100
703		25
704		25
705		25
706		25
707		1
708		1
709		1
710		1
711		1
712		1
713		1
714		1
715		1
716		1
717		100
718		100
719		100
720		400
721		400
722		400
723		1
724		1
725		1
726		1
727		1
728		1
729		1
730		1
731		1
732		1
733		1
734		1
735		1
736		1
737		1
738		1
739		1
740		1
741		1
742		1
743		1
744		1
745		400
746		400
747		400
748		1
749		1
750		400
751		100
752		400
753		1
754		1
755		1
756		1
757		1
758		1
759		1
760		1
761		1
762		100
763		100
764		400
765		100
766		100
767		100
768		400
769		400
770		400
771		99
772		99
773		99
774		99
775		100
776		1
777		1
778		1
779		1
780		99
781		99
782		99
783		99
784		99
785		1
786		1
787		1
788		1
789		1
790		1
791		1
792		1
793		1
794		1
795		1
796		1
797		1
798		1
799		1
800		1
801		1
802		1
803		1
804		1
805		1
806		1
807		1
808		1
809		1
810		1
811		1
812		1
813		1
814		1
815		1
816		1
817		1
818		1
819		1
820		1
821		1
822		1
823		1
824		100
825		400
826		1
827		1
828		1
829		1
830		1
831		1
832		1
833		100
834		100
835		100
836		100
837		1
838		1
839		1
840		1
841		1
842		1
843		1
844		1
845		1
846		1
847		1
848		1
849		50
850		1
851		1
852		5
853		5
854		1
855		1
856		1
857		1
858		1
859		1
860		1
861		1
862		1
863		1
864		1
865		1
866		1
867		1
868		1
869		1
870		1
871		1
872		1
873		1
874		1
875		1
876		1
877		1
878		1
879		1
880		100
881		1
882		1
883		100
884		400
885		1
886		1
887		1
888		1
889		1
890		1
891		1
892		1
893		1
894		1
895		1
896		1
897		1
898		1
899		1
900		1
901		1
902		1
903		1
904		1
905		1
906		1
907		1
908		1
909		1
910		1
911		100
912		1
913		200
914		1
915		1
916		1
917		1
918		1
919		1
920		1
921		1
922		1
923		1
924		1
925		1
926		1
927		400
928		1
929		25
930		1
931		99
932		1
933		1
934		1
935		1
936		1
937		5
938		1
939		1
940		1
941		1
942		1
943		1
944		1
945		1
946		1
947		100
948		1
949		99
950		1
951		1
952		1
953		1
954		1
955		1
956		1
957		1
958		1
959		1
960		1
961		1
962		1
963		1
964		1
965		100
966		1
967		5
968		5
969		5
970		5
971		5
972		5
973		5
974		100
975		1
976		1
977		1
978		1
979		1
980		1
981		5
982		1
983		1
984		1
985		10
986		1
987		1
988		99
989		1
990		1
991		1
992		1
993		1
994		1
995		1
996		1
997		1
998		1
999		15
1000		5
1001		1
1002		1
1003		1
1004		1
1005		1
1006		25
1007		3
1008		3
1009		3
1010		3
1011		3
1012		3
1013		3
1014		3
1015		3
1016		3
1017		3
1018		3
1019		3
1020		3
1021		3
1022		3
1023		3
1024		3
1025		3
1026		3
1027		3
1028		3
1029		3
1030		3
1031		3
1032		3
1033		3
1034		3
1035		3
1036		3
1037		3
1038		3
1039		3
1040		3
1041		3
1042		3
1043		3
1044		3
1045		3
1046		3
1047		3
1048		3
1049		3
1050		3
1051		3
1052		3
1053		3
1054		3
1055		3
1056		3
1057		3
1058		3
1059		3
1060		3
1061		3
1062		3
1063		3
1064		3
1065		3
1066		3
1067		3
1068		3
1069		3
1070		3
1071		1
1072		1
1073		100
1074		100
1075		100
1076		100
1077		100
1078		100
1079		100
1080		100
1081		100
1082		100
1083		100
1084		100
1085		100
1086		100
1087		100
1088		100
1089		100
1090		100
1091		100
1092		100
1093		100
1094		100
1095		100
1096		100
1097		100
1098		100
1099		100
1100		1
1101		100
1102		400
1103		200
1104		100
1105		100
1106		100
1107		3
1108		3
1109		3
1110		3
1111		3
1112		3
1113		3
1114		3
1115		3
1116		3
1117		3
1118		3
1119		3
1120		1
1121		1
1122		1
1123		1
1124		100
1125		100
1126		400
1127		100
1128		1
1129		1
1130		99
1131		1
1132		1
1133		3
1134		30
1135		1
1136		1
1137		1
1138		1
1139		1
1140		1
1141		1
1142		1
1143		1
1144		1
1145		1
1146		5
1147		5
1148		5
1149		5
1150		100
1151		5
1152		1
1153		1
1154		1
1155		1
1156		1
1157		1
1158		1
1159		1
1160		1
1161		1
1162		1
1163		1
1164		1
1165		1
1166		1
1167		1
1168		25
1169		1
1170		1
1171		1
1172		1
1173		2
1174		2
1175		2
1176		2
1177		2
1178		1
1179		99
1180		1
1181		1
1182		1
1183		1
1184		25
1185		1
1186		1
1187		1
1188		1
1189		1
1190		1
1191		25
1192		1
1193		1
1194		1
1195		1
1196		1
1197		1
1198		25
1199		1
1200		1
1201		1
1202		1
1203		1
1204		1
1205		1
1206		1
1207		1
1208		1
1209		1
1210		1
1211		1
1212		1
1213		1
1214		1
1215		1
1216		1
1217		1
1218		1
1219		1
1220		1
1221		1
1222		1
1223		1
1224		1
1225		25
1226		1
1227		1
1228		1
1229		1
1230		1
1231		1
1232		1
1233		1
1234		1
1235		99
1236		1
1237		1
1238		1
1239		1
1240		1
1241		1
1242		1
1243		1
1244		1
1245		100
1246		100
1247		1
1248		1
1249		1
1250		1
1251		1
1252		1
1253		1
1254		1
1255		1
1256		1
1257		25
1258		1
1259		1
1260		1
1261		99
1262		1
1263		1
1264		1
1265		1
1266		1
1267		400
1268		400
1269		400
1270		400
1271		400
1272		400
1273		1
1274		1
1275		1
1276		1
1277		1
1278		1
1279		1
1280		1
1281		1
1282		1
1283		1
1284		1
1285		1
1286		1
1287		1
1288		1
1289		1
1290		1
1291		10
1292		1
1293		3
1294		1
1295		1
1296		1
1297		1
1298		1
1299		1
1300		1
1301		1
1302		99
1303		1
1304		1
1305		1
1306		1
1307		1
1308		1
1309		1
1310		99
1311		1
1312		1
1313		1
1314		1
1315		3
1316		1
1317		1
1318		1
1319		1
1320		1
1321		1
1322		1
1323		1
1324		1
1325		1
1326		1
1327		1
1328		3
1329		25
1330		25
1331		3
1332		25
1333		100
1334		99
1335		99
1336		1
1337		1
1338		25
1339		25
1340		20
1341		99
1342		99
1343		1
1344		100
1345		25
1346		25
1347		25
1348		25
1349		99
1350		99
1351		99
1352		99
1353		20
1354		20
1355		20
1356		20
1357		20
1358		20
1359		20
1360		1
1361		1
1362		1
1363		1
1364		1
1365		1
1366		1
1367		1
1368		1
1369		1
1370		1
1371		1
1372		1
1373		1
1374		1
1375		1
1376		1
1377		1
1378		400
1379		400
1380		400
1381		400
1382		400
1383		400
1384		25
1385		25
1386		25
1387		25
1388		25
1389		25
1390		1
1391		1
1392		1
1393		1
1394		1
1395		1
1396		1
1397		1
1398		1
1399		1
1400		1
1401		1
1402		1
1403		1
1404		1
1405		1
1406		1
1407		1
1408		1
1409		1
1410		1
1411		1
1412		1
1413		1
1414		1
1415		1
1416		1
1417		1
1418		25
1419		1
1420		1
1421		1
1422		1
1423		1
1424		1
1425		1
1426		1
1427		1
1428		1
1429		1
1430		1
1431		1
1432		100
1433		1
1434		1
1435		1
1436		1
1437		1
1438		1
1439		1
1440		1
1441		1
1442		1
1443		1
1444		1
1445		1
1446		1
1447		400
1448		400
1449		1
1450		1
1451		1
1452		1
1453		1
1454		1
1455		1
1456		1
1457		200
1458		1
1459		1
1460		1
1461		1
1462		1
1463		1
1464		1
1465		1
1466		1
1467		1
1468		1
1469		1
1470		1
1471		1
1472		1
1473		1
1474		1
1475		1
1476		1
1477		1
1478		1
1479		1
1480		1
1481		1
1482		1
1483		1
1484		1
1485		1
1486		1
1487		1
1488		1
1489		1
1490		1
1491		1
1492		1
1493		1
1494		1
1495		1
1496		1
1497		1
1498		1
1499		1
1500		1
1501		1
1502		1
1503		1
1504		1
1505		1
1506		1
1507		1
1508		25
1509		1
1510		1
1511		1
1512		1
1513		1
1514		1
1515		1
1516		1
1517		1
1518		1
1519		1
1520		1
1521		1
1522		1
1523		1
1524		1
1525		1
1526		1
1527		1
1528		1
1529		1
1530		1
1531		1
1532		1
1533		1
1534		1
1535		1
1536		1
1537		1
1538		1
1539		1
1540		1
1541		1
1542		1
1543		1
1544		1
1545		1
1546		1
1547		1
1548		1
1549		1
1550		1
1551		1
1552		25
1553		1
1554		1
1555		1
1556		1
1557		1
1558		1
1559		1
1560		1
1561		1
1562		1
1563		1
1564		1
1565		1
1566		1
1567		1
1568		1
1569		1
1570		1
1571		1
1572		1
1573		1
1574		1
1575		1
1576		1
1577		1
1578		1
1579		1
1580		1
1581		1
1582		1
1583		1
1584		1
1585		1
1586		1
1587		1
1588		1
1589		100
1590		400
1591		100
1592		400
1593		100
1594		400
1595		1
1596		1
1597		1
1598		1
1599		1
1600		1
1601		1
1602		1
1603		1
1604		1
1605		1
1606		1
1607		1
1608		1
1609		1
1610		1
1611		1
1612		1
1613		1
1614		99
1615		1
1616		1
1617		1
1618		1
1619		1
1620		1
1621		1
1622		1
1623		1
1624		1
1625		1
1626		1
1627		1
1628		1
1629		1
1630		1
1631		1
1632		1
1633		1
1634		1
1635		1
1636		1
1637		1
1638		1
1639		1
1640		1
1641		1
1642		1
1643		1
1644		1
1645		1
1646		1
1647		1
1648		1
1649		1
1650		1
1651		1
1652		1
1653		1
1654		1
1655		1
1656		1
1657		1
1658		1
1659		1
1660		1
1661		1
1662		1
1663		1
1664		1
1665		1
1666		1
1667		1
1668		1
1669		1
1670		1
1671		1
1672		1
1673		1
1674		1
1675		1
1676		1
1677		1
1678		1
1679		1
1680		1
1681		1
1682		1
1683		1
1684		1
1685		1
1686		1
1687		1
1688		1
1689		1
1690		1
1691		1
1692		1
1693		1
1694		1
1695		1
1696		1
1697		1
1698		1
1699		1
1700		1
1701		1
1702		200
1703		1
1704		1
1705		1
1706		1
1707		1
1708		1
1709		1
1710		1
1711		1
1712		1
1713		1
1714		1
1715		1
1716		1
1717		1
1718		1
1719		1
1720		1
1721		1
1722		1
1723		400
1724		1
1725		100
1726		400
1727		100
1728		400
1729		100
1730		400
1731		1
1732		1
1733		1
1734		n/a
1735		n/a
1736		1
1737		1
1738		1
1739		1
1740		1
1741		1
1742		1
1743		1
1744		1
1745		1
1746		1
1747		1
1748		1
1749		1
1750		1
1751		1
1752		1
1753		1
1754		1
1755		1
1756		1
1757		1
1758		1
1759		1
1760		1
1761		1
1762		1
1763		1
1764		1
1765		1
1766		1
1767		1
1768		1
1769		1
1770		1
1771		1
1772		1
1773		1
1774		10
1775		1
1776		1
1777		1
1778		1
1779		1
1780		1
1781		1
1782		1
1783		99
1784		1
1785		99
1786		1
1787		5
1788		1
1789		1
1790		1
1791		1
1792		1
1793		1
1794		1
1795		1
1796		200
1797		1
1798		1
1799		1
1800		1
1801		1
1802		1
1803		n/a
1804		n/a
1805		n/a
1806		n/a
1807		n/a
1808		1
1809		99
1810		1
1811		1
1812		1
1813		1
1814		1
1815		1
1816		1
1817		1
1818		200
1819		1
1820		1
1821		1
1822		1
1823		1
1824		1
1825		1
1826		1
1827		1
1828		25
1829		1
1830		1
1831		1
1832		1
1833		1
1834		1
1835		1
1836		99
1837		1
1838		1
1839		1
1840		1
1841		1
1842		1
1843		1
1844		3
1845		1
1846		1
1847		1
1848		1
1849		1
1850		1
1851		1
1852		1
1853		1
1854		1
1855		1
1856		1
1857		1
1858		1
1859		1
1860		1
1861		1
1862		1
1863		1
1864		1
1865		1
1866		1
1867		n/a
1868		n/a
1869		10
1870		1
1871		1
1872		100
1873		1
1874		1
1875		1
1876		1
1877		1
1878		1
1879		1
1880		1
1881		1
1882		1
1883		1
1884		1
1885		1
1886		1
1887		1
1888		1
1889		1
1890		1
1891		1
1892		1
1893		1
1894		1
1895		1
1896		1
1897		1
1898		1
1899		1
1900		1
1901		1
1902		1
1903		1
1904		1
1905		1
1906		1
1907		1
1908		1
1909		1
1910		1
1911		5
1912		30
1913		99
1914		1
1915		1
1916		1
1917		1
1918		1
1919		5
1920		5
1921		1
1922		1
1923		1
1924		1
1925		1
1926		1
1927		1
1928		1
1929		1
1930		1
1931		1
1932		1
1933		1
1934		1
1935		1
1936		1
1937		1
1938		1
1939		1
1940		1
1941		1
1942		1
1943		1
1944		1
1945		1
1946		1
1947		1
1948		400
1949		400
1950		400
1951		400
1952		400
1953		400
1954		400
1955		400
1956		400
1957		400
1958		3
1959		1
1960		1
1961		1
1962		1
1963		1
1964		1
1965		1
1966		100
1967		100
1968		100
1969		3
1970		100
1971		100
1972		100
1973		100
1974		100
1975		100
1976		100
1977		1
1978		1
1979		1
1980		1
1981		1
1982		1
1983		1
1984		1
1985		1
1986		1
1987		1
1988		1
1989		1
1990		1
1991		1
1992		5
1993		1
1994		5
1995		5
1996		5
1997		5
1998		5
1999		5
2000		5
2001		5
2002		5
2003		5
2004		5
2005		1
2006		5
2007		5
2008		400
2009		400
2010		400
2011		400
2012		400
2013		400
2014		400
2015		5
2016		5
2017		5
2018		5
2019		5
2020		1
2021		1
2022		1
2023		1
2024		1
2025		1
2026		1
2027		1
2028		1
2029		1
2030		1
2031		1
2032		1
2033		1
2034		1
2035		1
2036		1
2037		1
2038		1
2039		1
2040		1
2041		1
2042		1
2043		1
2044		1
2045		1
2046		1
2047		1
2048		1
2049		1
2050		1
2051		1
2052		1
2053		1
2054		1
2055		1
2056		1
2057		1
2058		1
2059		1
2060		1
2061		1
2062		1
2063		1
2064		1
2065		1
2066		1
2067		1
2068		1
2069		1
2070		1
2071		1
2072		1
2073		1
2074		1
2075		1
2076		1
2077		1
2078		1
2079		1
2080		1
2081		1
2082		1
2083		1
2084		1
2085		1
2086		1
2087		1
2088		1
2089		1
2090		1
2091		1
2092		1
2093		1
2094		1
2095		1
2096		1
2097		1
2098		1
2099		1
2100		1
2101		1
2102		1
2103		1
2104		1
2105		1
2106		1
2107		1
2108		1
2109		1
2110		1
2111		1
2112		1
2113		1
2114		1
2115		1
2116		1
2117		1
2118		1
2119		100
2120		100
2121		5
2122		5
2123		5
2124		1
2125		1
2126		1
2127		1
2128		1
2129		1
2130		1
2131		1
2132		1
2133		1
2134		1
2135		1
2136		1
2137		1
2138		1
2139		1
2140		1
2141		1
2142		1
2143		1
2144		1
2145		1
2146		1
2147		1
2148		1
2149		1
2150		1
2151		1
2152		1
2153		1
2154		1
2155		1
2156		5
2157		5
2158		400
2159		400
2160		400
2161		3
2162		1
2163		1
2164		1
2165		1
2166		1
2167		1
2168		1
2169		400
2170		400
2171		25
2172		1
2173		100
2174		1
2175		1
2176		1
2177		1
2178		1
2179		1
2180		1
2181		1
2182		1
2183		1
2184		1
2185		1
2186		1
2187		1
2188		1
2189		1
2190		1
2191		1
2192		1
2193		1
2194		1
2195		1
2196		1
2197		1
2198		1
2199		1
2200		1
2201		1
2202		1
2203		1
2204		1
2205		5
2206		1
2207		1
2208		1
2209		30
2210		400
2211		400
2212		400
2213		400
2214		1
2215		1
2216		1
2217		1
2218		25
2219		1
2220		1
2221		1
2222		1
2223		1
2224		1
2225		1
2226		1
2227		1
2228		1
2229		1
2230		1
2231		1
2232		1
2233		1
2234		1
2235		1
2236		1
2237		1
2238		1
2239		1
2240		1
2241		1
2242		1
2243		1
2244		1
2245		1
2246		1
2247		1
2248		1
2249		1
2250		1
2251		1
2252		1
2253		1
2254		1
2255		1
2256		1
2257		1
2258		1
2259		1
2260		100
2261		100
2262		100
2263		400
2264		400
2265		1
2266		20
2267		5
2268		5
2269		1
2270		1
2271		400
2272		1
2273		1
2274		100
2275		1
2276		1
2277		1
2278		1
2279		1
2280		1
2281		1
2282		1
2283		1
2284		1
2285		1
2286		1
2287		1
2288		1
2289		1
2290		3
2291		1
2292		1
2293		1
2294		1
2295		1
2296		1
2297		3
2298		3
2299		3
2300		3
2301		3
2302		3
2303		3
2304		3
2305		3
2306		3
2307		3
2308		3
2309		3
2310		3
2311		3
2312		3
2313		3
2314		30
2315		3
2316		3
2317		3
2318		3
2319		3
2320		1
2321		3
2322		20
2323		20
2324		20
2325		20
2326		20
2327		20
2328		20
2329		20
2330		1
2331		1
2332		1
2333		400
2334		10
2335		10
2336		10
2337		1
2338		1
2339		1
2340		100
2341		1
2342		1
2343		1
2344		20
2345		20
2346		20
2347		20
2348		20
2349		20
2350		20
2351		20
2352		20
2353		20
2354		20
2355		20
2356		20
2357		25
2358		25
2359		20
2360		1
2361		1
2362		1
2363		1
2364		1
2365		1
2366		1
2367		1
2368		1
2369		1
2370		1
2371		1
2372		1
2373		1
2374		1
2375		1
2376		1
2377		1
2378		1
2379		1
2380		1
2381		1
2382		1
2383		1
2384		1
2385		1
2386		1
2387		1
2388		1
2389		1
2390		1
2391		1
2392		1
2393		1
2394		1
2395		1
2396		1
2397		1
2398		1
2399		1
2400		1
2401		1
2402		1
2403		1
2404		1
2405		1
2406		1
2407		1
2408		1
2409		1
2410		1
2411		1
2412		1
2413		1
2414		1
2415		1
2416		1
2417		1
2418		1
2419		1
2420		1
2421		1
2422		1
2423		1
2424		1
2425		5
2426		5
2427		5
2428		1
2429		1
2430		1
2431		25
2432		400
2433		400
2434		400
2435		100
2436		3
2437		3
2438		3
2439		1
2440		1
2441		1
2442		1
2443		1
2444		1
2445		1
2446		1
2447		1
2448		1
2449		1
2450		2
2451		2
2452		2
2453		2
2454		2
2455		2
2456		2
2457		2
2458		2
2459		2
2460		2
2461		2
2462		2
2463		2
2464		2
2465		2
2466		2
2467		2
2468		2
2469		2
2470		2
2471		2
2472		2
2473		2
2474		2
2475		2
2476		2
2477		2
2478		2
2479		2
2480		2
2481		2
2482		2
2483		2
2484		2
2485		2
2486		2
2487		2
2488		2
2489		1
2490		1
2491		1
2492		5
2493		1
2494		1
2495		1
2496		1
2497		1
2498		1
2499		1
2500		1
2501		1
2502		1
2503		100
2504		100
2505		400
2506		400
2507		400
2508		400
2509		1
2510		1
2511		1
2512		1
2513		1
2514		1
2515		1
2516		1
2517		1
2518		200
2519		1
2520		1
2521		1
2522		1
2523		1
2524		1
2525		1
2526		1
2527		1
2528		1
2529		1
2530		1
2531		1
2532		1
2533		1
2534		1
2535		1
2536		1
2537		1
2538		1
2539		1
2540		1
2541		1
2542		1
2543		1
2544		1
2545		1
2546		1
2547		1
2548		1
2549		200
2550		1
2551		1
2552		1
2553		1
2554		1
2555		1
2556		1
2557		1
2558		1
2559		1
2560		1
2561		1
2562		1
2563		1
2564		1
2565		1
2566		200
2567		1
2568		1
2569		1
2570		1
2571		1
2572		1
2573		1
2574		1
2575		1
2576		1
2577		1
2578		1
2579		1
2580		1
2581		200
2582		1
2583		1
2584		1
2585		1
2586		99
2587		1
2588		1
2589		1
2590		99
2591		1
2592		1
2593		1
2594		1
2595		1
2596		1
2597		1
2598		1
2599		1
2600		1
2601		1
2602		1
2603		1
2604		1
2605		1
2606		1
2607		25
2608		1
2609		1
2610		1
2611		1
2612		1
2613		1
2614		1
2615		1
2616		1
2617		1
2618		1
2619		1
2620		1
2621		1
2622		1
2623		1
2624		1
2625		5
2626		5
2627		200
2628		200
2629		200
2630		200
2631		1
2632		1
2633		1
2634		1
2635		1
2636		1
2637		1
2638		1
2639		1
2640		1
2641		1
2642		1
2643		1
2644		1
2645		1
2646		1
2647		1
2648		1
2649		1
2650		1
2651		1
2652		1
2653		1
2654		1
2655		1
2656		1
2657		1
2658		1
2659		1
2660		1
2661		1
2662		1
2663		1
2664		1
2665		1
2666		1
2667		1
2668		1
2669		1
2670		1
2671		1
2672		1
2673		3
2674		5
2675		5
2676		5
2677		400
2678		400
2679		400
2680		400
2681		400
2682		400
2683		400
2684		400
2685		400
2686		400
2687		400
2688		400
2689		400
2690		400
2691		400
2692		100
2693		100
2694		100
2695		100
2696		400
2697		100
2698		400
2699		1
2700		1
2701		100
2702		1
2703		1
2704		1
2705		1
2706		1
2707		1
2708		1
2709		1
2710		1
2711		1
2712		1
2713		1
2714		1
2715		1
2716		1
2717		1
2718		1
2719		1
2720		1
2721		1
2722		1
2723		1
2724		1
2725		1
2726		1
2727		1
2728		1
2729		1
2730		1
2731		1
2732		1
2733		1
2734		1
2735		1
2736		1
2737		1
2738		1
2739		5
2740		5
2741		1
2742		1
2743		1
2744		200
2745		1
2746		1
2747		1
2748		1
2749		1
2750		1
2751		100
2752		100
2753		100
2754		100
2755		100
2756		20
2757		1
2758		1
2759		1
2760		1
2761		1
2762		1
2763		1
2764		1
2765		1
2766		10
2767		3
2768		1
2769		1
2770		1
2771		1
2772	~	n/a
2773	~	n/a
2774		1
2775	~	n/a
2776		1
2777	~	n/a
2778	~	n/a
2779		1
2780	~	n/a
2781		1
2782	~	n/a
2783	~	n/a
2784		1
2785	~	n/a
2786		1
2787		100
2788		400
2789		400
2790		400
2791		400
2792		100
2793		100
2794		100
2795		1
2796		1
2797		1
2798		1
2799		1
2800		1
2801		1
2802		1
2803		1
2804		1
2805		1
2806		1
2807		1
2808		1
2809		1
2810		1
2811		1
2812		1
2813		1
2814		1
2815		1
2816		1
2817		1
2818		1
2819		1
2820		1
2821		1
2822		200
2823		1
2824		1
2825		1
2826		1
2827		1
2828		1
2829		1
2830		1
2831		1
2832		1
2833		1
2834		1
2835		1
2836		1
2837		1
2838		1
2839		1
2840		1
2841		1
2842		1
2843		1
2844		1
2845		1
2846		1
2847		1
2848		1
2849		1
2850		1
2851		1
2852		1
2853		1
2854		1
2855		1
2856		1
2857		1
2858		1
2859		1
2860		100
2861		400
2862		1
2863		1
2864		3
2865		1
2866		1
2867		1
2868		100
2869		3
2870		3
2871		3
2872		3
2873		3
2874		3
2875		3
2876		3
2877		3
2878		3
2879		3
2880		1
2881	~	n/a
2882		1
2883		3
2884		3
2885		3
2886		99
2887		25
2888		1
2889		3
2890		3
2891		3
2892		3
2893		3
2894		3
2895		3
2896		99
2897		1
2898		1
2899		1
2900		1
2901		1
2902		1
2903		n/a
2904		1
2905		1
2906		1
2907		1
2908		1
2909		1
2910		1
2911		1
2912		1
2913		1
2914		1
2915		1
2916		1
2917		1
2918		1
2919		1
2920		1
2921		1
2922		1
2923		1
2924		1
2925		1
2926		1
2927		1
2928		1
2929		1
2930		1
2931		1
2932		1
2933		1
2934		1
2935		1
2936		1
2937		1
2938		1
2939		1
2940		1
2941		1
2942		1
2943		1
2944		1
2945		1
2946		1
2947		1
2948		1
2949		1
2950		1
2951		1
2952		1
2953		1
2954		1
2955		1
2956		1
2957		1
2958		1
2959		1
2960		1
2961		1
2962		1
2963		1
2964		1
2965		1
2966		1
2967		1
2968		1
2969		1
2970		1
2971		1
2972		1
2973		1
2974		1
2975		1
2976		1
2977		1
2978		1
2979		1
2980		1
2981		1
2982		1
2983		1
2984		1
2985		1
2986		1
2987		1
2988		1
2989		n/a
2990		n/a
2991		n/a
2992		1
2993		1
2994		1
2995		1
2996		100
2997		20
2998		1
2999		1
3000		1
3001		30
3002		100
3003		99
3004		100
3005		10
3006		1
3007		1
3008		1
3009		99
3010		99
3011		99
3012		1
3013		1
3014		1
3015		1
3016		1
3017		1
3018		1
3019		1
3020		1
3021		1
3022		1
3023		1
3024		3
3025		3
3026		3
3027		3
3028		3
3029		1
3030		1
3031		1
3032		1
3033		1
3034		1
3035		1
3036		1
3037		1
3038		3
3039		3
3040		3
3041		3
3042		3
3043		1
3044		1
3045		100
3046		1
3047		1
3048		1
3049		1
3050		1
3051		1
3052		1
3053		1
3054		1
3055		1
3056		1
3057		1
3058		1
3059		1
3060		1
3061		1
3062		1
3063		1
3064		1
3065		1
3066		100
3067		400
3068		1
3069		1
3070		1
3071		1
3072		1
3073		1
3074		1
3075		1
3076		1
3077		100
3078		100
3079		10
3080		10
3081		100
3082		400
3083		400
3084		1
3085		5
3086		100
3087		100
3088		400
3089		400
3090		1
3091		1
3092		1
3093		2
3094		99
3095		1
3096		1
3097		1
3098		1
3099		1
3100		100
3101		400
3102		1
3103		1
3104		1
3105		1
3106		1
3107		1
3108		99
3109		1
3110		1
3111		5
3112		100
3113		100
3114		100
3115		99
3116		99
3117		1
3118		1
3119		1
3120		1
3121		1
3122		1
3123		1
3124		1
3125		1
3126		1
3127		1
3128		1
3129		1
3130		1
3131		1
3132		1
3133		1
3134		1
3135		1
3136		1
3137		1
3138		1
3139		1
3140		1
3141		1
3142		1
3143		1
3144		200
3145		200
3146		200
3147		1
3148		1
3149		1
3150		1
3151		1
3152		1
3153		1
3154		1
3155		1
3156		1
3157		1
3158		1
3159		1
3160		1
3161		1
3162		1
3163		1
3164		1
3165		1
3166		1
3167		1
3168		1
3169		1
3170		1
3171		1
3172		1
3173		1
3174		1
3175		1
3176		1
3177		1
3178		1
3179		1
3180		1
3181		1
3182		1
3183		1
3184		1
3185		1
3186		1
3187		1
3188		1
3189		1
3190		3
3191		5
3192		5
3193		5
3194		5
3195		5
3196		99
3197		99
3198		1
3199		1
3200		1
3201		1
3202		1
3203		5
3204		5
3205		5
3206		5
3207		5
3208		5
3209		1
3210		1
3211		1
3212		1
3213		1
3214		100
3215		25
3216		25
3217		25
3218		25
3219		25
3220		25
3221		25
3222		25
3223		1
3224		1
3225		1
3226		1
3227		1
3228		1
3229		2
3230		2
3231		2
3232		2
3233		2
3234		100
3235		1
3236		1
3237		1
3238		400
3239		1
3240		1
3241		1
3242		1
3243		1
3244		1
3245		1
3246		1
3247		1
3248		1
3249		1
3250		1
3251		1
3252		1
3253		1
3254		1
3255		1
3256		1
3257		1
3258		1
3259		1
3260		1
3261		25
3262		1
3263		1
3264		1
3265		1
3266		1
3267		1
3268		1
3269		1
3270		1
3271		100
3272		100
3273		400
3274		100
3275		100
3276		100
3277		100
3278		1
3279		1
3280		1
3281		1
3282		1
3283		1
3284		1
3285		1
3286		1
3287		1
3288		1
3289		1
3290		1
3291		1
3292		1
3293		1
3294		1
3295		1
3296		1
3297		1
3298		1
3299		1
3300		1
3301		1
3302		1
3303		1
3304		1
3305		1
3306		1
3307		1
3308		1
3309		1
3310		1
3311		1
3312		1
3313		1
3314		1
3315		1
3316		1
3317		1
3318		3
3319		3
3320		3
3321		3
3322		3
3323		3
3324		3
3325		3
3326		3
3327		3
3328		3
3329		3
3330		3
3331		n/a
3332		3
3333		1
3334		1
3335		1
3336		1
3337		1
3338		100
3339		100
3340		400
3341		400
3342		400
3343		400
3344		400
3345		400
3346		400
3347		200
3348		400
3349		1
3350		1
3351		1
3352		1
3353		1
3354		1
3355		1
3356		1
3357		1
3358		1
3359		1
3360		1
3361		1
3362		1
3363		1
3364		1
3365		1
3366		1
3367		1
3368		1
3369		1
3370		1
3371		1
3372		1
3373		1
3374		1
3375		1
3376		1
3377		1
3378		99
3379		99
3380		100
3381		1
3382		1
3383		1
3384		1
3385		3
3386		3
3387		3
3388		3
3389		1
3390		1
3391		1
3392		1
3393		1
3394		1
3395		1
3396		1
3397		1
3398		n/a
3399		1
3400		1
3401		1
3402		1
3403		1
3404		n/a
3405		1
3406		1
3407		1
3408		1
3409		1
3410		1
3411		1
3412		1
3413		1
3414		1
3415		1
3416		1
3417		1
3418		1
3419		1
3420		1
3421		1
3422		1
3423		1
3424		1
3425		1
3426		1
3427		1
3428		1
3429		1
3430		1
3431		1
3432		1
3433		1
3434		1
3435		1
3436		1
3437		1
3438		1
3439		1
3440		1
3441		1
3442		1
3443		1
3444		1
3445		1
3446		1
3447		1
3448		1
3449		1
3450		1
3451		1
3452		1
3453		n/a
3454		n/a
3455		n/a
3456		25
3457		25
3458		25
3459		25
3460		100
3461		100
3462	~	n/a
3463	~	n/a
3464		1
3465	~	n/a
3466		1
3467		25
3468		1
3469		1
3470		1
3471		1
3472		400
3473		1
3474		1
3475		1
3476		1
3477		99
3478		1
3479		1
3480		1
3481		1
3482		1
3483		1
3484		1
3485		1
3486		1
3487		1
3488		1
3489		1
3490		1
3491		1
3492		1
3493		1
3494		1
3495		1
3496		1
3497		1
3498		1
3499		1
3500		1
3501		1
3502		1
3503		1
3504		1
3505		1
3506		1
3507		1
3508		1
3509		1
3510		1
3511		1
3512		1
3513		1
3514		1
3515		1
3516		1
3517		1
3518		1
3519		1
3520		1
3521		1
3522		1
3523		1
3524		1
3525		1
3526		3
3527		3
3528		3
3529		3
3530		3
3531		1
3532		5
3533		3
3534		3
3535		3
3536		1
3537		1
3538		1
3539		1
3540		1
3541		1
3542		1
3543		1
3544		30
3545		1
3546		1
3547		99
3548		99
3549		1
3550		3
3551		3
3552		3
3553		3
3554		3
3555		3
3556		3
3557		3
3558		3
3559		3
3560		3
3561		3
3562		3
3563		5
3564		3
3565		1
3566		1
3567		99
3568		99
3569		1
3570		1
3571		1
3572		1
3573		100
3574		100
3575		100
3576		100
3577		1
3578		1
3579		1
3580		1
3581		1
3582		1
3583		1
3584		400
3585		1
3586		1
3587		1
3588		1
3589		1
3590		1
3591		1
3592		1
3593		1
3594		1
3595		1
3596		1
3597		3
3598		3
3599		3
3600		3
3601		3
3602		5
3603		5
3604		5
3605		5
3606		5
3607		5
3608		5
3609		100
3610		100
3611		1
3612		1
3613		5
3614		5
3615		5
3616		25
3617		1
3618		5
3619		1
3620		1
3621		100
3622		200
3623		1
3624		1
3625		1
3626		5
3627		1
3628		1
3629		5
3630		5
3631		5
3632		5
3633		100
3634		100
3635		100
3636		100
3637		100
3638		200
3639		200
3640		200
3641		200
3642		200
3643		1
3644		1
3645		1
3646		1
3647		1
3648		1
3649		1
3650		1
3651		1
3652		1
3653		1
3654		1
3655		1
3656		1
3657		1
3658		1
3659		1
3660		1
3661		1
3662		1
3663		5
3664		1
3665		1
3666		1
3667		1
3668		1
3669		1
3670		1
3671		1
3672		1
3673		1
3674		1
3675		1
3676		1
3677		1
3678		1
3679		1
3680		1
3681		1
3682		1
3683		1
3684		1
3685		1
3686		1
3687		1
3688		1
3689		1
3690		1
3691		1
3692		1
3693		1
3694		1
3695		1
3696		1
3697		1
3698		1
3699		1
3700		1
3701		1
3702		1
3703		1
3704		1
3705	~	n/a
3706	~	n/a
3707		5
3708		1
3709		1
3710		1
3711		1
3712		1
3713		1
3714		1
3715		1
3716		1
3717		1
3718		1
3719		1
3720		1
3721		1
3722		5
3723		1
3724		1
3725		25
3726		5
3727		5
3728		5
3729		5
3730		1
3731		1
3732		1
3733		1
3734		1
3735		1
3736		100
3737		100
3738		100
3739		100
3740		100
3741		100
3742		1
3743		1
3744		1
3745		1
3746		1
3747		1
3748		1
3749		1
3750		3
3751		400
3752		400
3753		400
3754		100
3755		100
3756		100
3757		1
3758		1
3759		1
3760		400
3761		400
3762		400
3763		1
3764		1
3765		1
3766		1
3767		1
3768		1
3769		1
3770		1
3771		1
3772		1
3773		1
3774		1
3775		1
3776		1
3777		1
3778		1
3779		1
3780		1
3781		1
3782		1
3783		3
3784		1
3785		1
3786		1
3787		1
3788		1
3789		1
3790		1
3791		1
3792		1
3793		1
3794		5
3795		1
3796		1
3797		1
3798		1
3799		1
3800		1
3801		1
3802		1
3803		1
3804		1
3805		1
3806		1
3807		1
3808		1
3809		1
3810		1
3811		1
3812		1
3813		1
3814		1
3815		1
3816		1
3817		50
3818		1
3819		1
3820		1
3821		1
3822		n/a
3823		1
3824		1
3825		1
3826		1
3827		1
3828		3
3829		1
3830		1
3831		1
3832		1
3833		1
3834		1
3835		1
3836		1
3837		1
3838		1
3839		1
3840		1
3841		1
3842		1
3843		1
3844		1
3845		1
3846		1
3847	~	n/a
3848	~	n/a
3849	~	n/a
3850	~	n/a
3851	~	n/a
3852		1
3853	~	n/a
3854		1
3855		1
3856		1
3857		1
3858		1
3859		1
3860		3
3861	~	n/a
3862	~	n/a
3863		1
3864		1
3865		1
3866		1
3867		1
3868		1
3869		1
3870		1
3871		1
3872		1
3873		1
3874		1
3875		1
3876		1
3877		1
3878		1
3879		1
3880		1
3881		1
3882		1
3883		1
3884		1
3885		1
3886		1
3887		1
3888		1
3889		1
3890		1
3891		1
3892		1
3893		1
3894		1
3895		1
3896		1
3897		1
3898		1
3899		1
3900		1
3901		1
3902		1
3903		200
3904		200
3905		200
3906		200
3907		200
3908		200
3909		1
3910		1
3911		1
3912		1
3913		1
3914		1
3915		1
3916		1
3917		1
3918		1
3919		1
3920		1
3921		1
3922		1
3923		1
3924		1
3925		1
3926		1
3927		1
3928		1
3929		1
3930		1
3931		1
3932		1
3933		1
3934		1
3935		1
3936		1
3937		1
3938		1
3939		1
3940		1
3941		1
3942		1
3943		1
3944		1
3945		200
3946		1
3947		1
3948		1
3949		1
3950		1
3951		100
3952		400
3953		100
3954		400
3955		100
3956		400
3957		200
3958		1
3959		1
3960		1
3961		1
3962		1
3963		1
3964		1
3965		1
3966		1
3967		1
3968		1
3969		1
3970		1
3971		1
3972		1
3973		1
3974		1
3975		1
3976		1
3977		1
3978	~	n/a
3979		10
3980		10
3981		10
3982		5
3983		5
3984		5
3985		5
3986		5
3987		5
3988		1
3989		1
3990		1
3991		1
3992		1
3993		1
3994		1
3995		1
3996		1
3997		1
3998		1
3999		1
4000		1
4001		1
4002		1
4003		1
4004		1
4005		1
4006		1
4007		1
4008		1
4009		5
4010	~	n/a
4011		5
4012		5
4013		5
4014		5
4015		5
4016		5
4017		5
4018		5
4019		5
4020		5
4021		5
4022		5
4023		5
4024		5
4025		5
4026		5
4027		5
4028		5
4029		5
4030		5
4031		5
4032		5
4033		5
4034		5
4035		5
4036		5
4037		5
4038		1
4039		1
4040		1
4041		25
4042		25
4043		25
4044		25
4045		25
4046		25
4047		25
4048		25
4049		1
4050		100
4051		100
4052		400
4053		400
4054		1
4055		1
4056		1
4057		1
4058	~	n/a
4059		1
4060		1
4061		1
4062		1
4063		1
4064		1
4065		1
4066		1
4067		1
4068		3
4069		3
4070		3
4071		1
4072		1
4073		1
4074		1
4075		1
4076		1
4077		1
4078		1
4079		1
4080		1
4081		1
4082		1
4083		1
4084		1
4085		1
4086		1
4087		1
4088		1
4089		1
4090		100
4091		100
4092		1
4093		1
4094		1
4095		1
4096		1
4097		1
4098		1
4099		1
4100		1
4101		1
4102		1
4103		1
4104		1
4105		1
4106		1
4107		1
4108		1
4109		1
4110		1
4111		1
4112		1
4113		1
4114		1
4115		1
4116		1
4117		1
4118		1
4119		1
4120		1
4121		1
4122		1
4123		1
4124		1
4125		1
4126		1
4127		1
4128		1
4129		1
4130		1
4131		1
4132		1
4133		1
4134		1
4135		1
4136		1
4137		1
4138		1
4139		100
4140		400
4141		1
4142		1
4143	~	n/a
4144		1
4145		1
4146		1
4147		1
4148		1
4149		1
4150		1
4151		1
4152		1
4153		1
4154		1
4155		1
4156		1
4157		1
4158		1
4159		200
4160		1
4161		1
4162		1
4163		1
4164		1
4165		1
4166		1
4167		1
4168		1
4169		1
4170		1
4171		1
4172		1
4173		1
4174		1
4175		1
4176		1
4177		1
4178		1
4179		1
4180		200
4181		1
4182		1
4183		1
4184		1
4185		1
4186		1
4187		1
4188		1
4189		1
4190		1
4191		1
4192		1
4193		1
4194		1
4195		1
4196		1
4197		1
4198		1
4199		1
4200		1
4201		200
4202		1
4203		1
4204		1
4205		1
4206		1
4207		1
4208		1
4209		1
4210		1
4211		1
4212		1
4213		1
4214		1
4215		1
4216		1
4217		1
4218		1
4219		1
4220		1
4221		1
4222		200
4223		1
4224		1
4225		1
4226		1
4227		1
4228		1
4229		100
4230		100
4231		100
4232		100
4233		400
4234		400
4235		400
4236		400
4237		1
4238		100
4239		100
4240		100
4241		25
4242		1
4243		1
4244		1
4245		1
4246		1
4247		1
4248		1
4249		1
4250		1
4251		1
4252		1
4253		1
4254		1
4255		1
4256		1
4257		1
4258		1
4259		1
4260		400
4261		5
4262		1
4263		1
4264		1
4265		1
4266		1
4267		1
4268		1
4269		1
4270		1
4271		3
4272		1
4273		1
4274		3
4275		1
4276		1
4277		100
4278		100
4279		400
4280		400
4281		1
4282		5
4283		5
4284		5
4285		5
4286		5
4287		5
4288		5
4289		5
4290		5
4291		5
4292		5
4293		5
4294		5
4295		5
4296		5
4297		5
4298		1
4299		1
4300		1
4301		1
4302		1
4303		1
4304		1
4305		1
4306		1
4307		1
4308		1
4309		1
4310		1
4311		200
4312		1
4313		1
4314		1
4315		1
4316		1
4317		1
4318		1
4319		1
4320		1
4321		1
4322		1
4323		1
4324		1
4325		1
4326		1
4327		1
4328		1
4329		1
4330		1
4331		1
4332		1
4333		1
4334		5
4335		5
4336		5
4337		5
4338		5
4339		5
4340		3
4341		1
4342		1
4343		1
4344		1
4345		2
4346		1
4347		1
4348		1
4349		25
4350		25
4351		25
4352		25
4353		25
4354		25
4355		1
4356		1
4357		1
4358		1
4359		5
4360		1
4361		5
4362		3
4363		5
4364		1
4365		1
4366		1
4367		1
4368		1
4369		1
4370		1
4371		1
4372		1
4373		5
4374		5
4375		5
4376		1
4377		25
4378		25
4379		1
4380		1
4381		1
4382		1
4383		100
4384		100
4385		100
4386		100
4387		100
4388		100
4389		25
4390		5
4391		100
4392		100
4393		2
4394		2
4395		5
4396		1
4397		1
4398		1
4399		1
4400		5
4401		3
4402		3
4403		5
4404		1
4405		5
4406		5
4407		5
4408		5
4409		1
4410		5
4411		5
4412		5
4413		5
4414		5
4415		1
4416		200
4417		1
4418		5
4419		3
4420		1
4421		1
4422		100
4423		99
4424		400
4425		1
4426		1
4427		1
4428		1
4429		1
4430		1
4431		1
4432		1
4433		1
4434		1
4435		1
4436		1
4437		1
4438		1
4439		1
4440		1
4441		1
4442		1
4443		1
4444		1
4445		99
4446		99
4447		99
4448		99
4449		99
4450		1
4451		1
4452		1
4453		1
4454		1
4455		1
4456		1
4457		99
4458		99
4459		99
4460		1
4461		1
4462		1
4463		1
4464		5
4465		5
4466		1
4467		1
4468		1
4469		1
4470		1
4471		1
4472		1
4473		1
4474		1
4475		1
4476		1
4477		20
4478		20
4479		20
4480		5
4481		1
4482		3
4483		1
4484		1
4485		1
4486		400
4487		400
4488		400
4489		400
4490		400
4491		400
4492		400
4493		400
4494		400
4495		400
4496		400
4497		400
4498		400
4499		400
4500		400
4501		400
4502		400
4503		400
4504		400
4505		400
4506		400
4507		400
4508		400
4509		400
4510		400
4511		400
4512		400
4513		400
4514		400
4515		400
4516		400
4517		400
4518		400
4519		400
4520		400
4521		400
4522		400
4523		400
4524		400
4525		400
4526		400
4527		400
4528		400
4529		400
4530		400
4531		400
4532		400
4533		400
4534		400
4535		400
4536		400
4537		400
4538		400
4539		400
4540		400
4541		1
4542		1
4543		1
4544		1
4545		1
4546		1
4547		100
4548		400
4549		1
4550		1
4551		1
4552		1
4553		1
4554		50
4555		1
4556		1
4557		1
4558		1
4559		1
4560		1
4561		1
4562		1
4563		1
4564		100
4565		400
4566		1
4567		1
4568		1
4569		1
4570		1
4571		1
4572		1
4573		1
4574		1
4575		1
4576		1
4577		1
4578		1
4579		1
4580		200
4581		1
4582		1
4583		1
4584		1
4585		1
4586		1
4587		1
4588		1
4589		1
4590		1
4591		1
4592		1
4593		1
4594		1
4595		1
4596		1
4597		1
4598		1
4599		1
4600		1
4601		1
4602		1
4603		1
4604		1
4605		1
4606		1
4607		1
4608		25
4609		1
4610		1
4611		1
4612		1
4613		1
4614		5
4615		5
4616		5
4617		5
4618		5
4619		5
4620		5
4621		5
4622		5
4623		5
4624		5
4625		5
4626		1
4627		1
4628		1
4629		1
4630		1
4631		1
4632		1
4633		1
4634		1
4635		1
4636		1
4637		1
4638		1
4639		1
4640		100
4641		100
4642		100
4643		100
4644		100
4645		100
4646		100
4647		400
4648		1
4649		1
4650		1
4651		1
4652		1
4653		1
4654		1
4655		1
4656		1
4657		1
4658		1
4659		1
4660		1
4661		1
4662		3
4663		3
4664		1
4665		1
4666		1
4667		400
4668		100
4669		1
4670		1
4671		1
4672		1
4673		1
4674		1
4675		1
4676		1
4677		1
4678		1
4679		1
4680		1
4681		1
4682		5
4683		1
4684		1
4685		1
4686		1
4687		1
4688		1
4689		1
4690		1
4691		1
4692		1
4693		1
4694		1
4695		1
4696		1
4697		1
4698		1
4699		1
4700		1
4701		1
4702		5
4703		1
4704		1
4705		1
4706		1
4707		1
4708		1
4709		1
4710		1
4711		1
4712		1
4713		1
4714		1
4715		1
4716		1
4717		50
4718		50
4719		50
4720		50
4721		50
4722	~	n/a
4723		1
4724		1
4725		1
4726		1
4727		1
4728		1
4729		1
4730		1
4731		1
4732		1
4733		1
4734		1
4735		1
4736		1
4737		1
4738		1
4739		1
4740		1
4741		1
4742		1
4743		1
4744		1
4745		1
4746		1
4747		1
4748		1
4749		1
4750		1
4751		1
4752		1
4753		1
4754		1
4755		1
4756		1
4757		1
4758		1
4759		1
4760		1
4761		1
4762		1
4763		1
4764		1
4765		1
4766		1
4767		1
4768		1
4769		1
4770		1
4771		1
4772		1
4773		1
4774		1
4775		1
4776		100
4777		1
4778		3
4779		1
4780		1
4781		1
4782		3
4783		1
4784		1
4785		1
4786		1
4787		1
4788		1
4789		1
4790		1
4791		1
4792		1
4793		1
4794		1
4795		1
4796		1
4797		1
4798		1
4799		1
4800		1
4801		1
4802		1
4803		1
4804		1
4805		1
4806		1
4807		1
4808		1
4809		1
4810		1
4811		1
4812		1
4813		1
4814		1
4815		1
4816		1
4817		1
4818		1
4819		1
4820		1
4821		1
4822		1
4823		1
4824		99
4825		99
4826		99
4827		99
4828		1
4829		5
4830		5
4831		5
4832		5
4833		5
4834		5
4835		5
4836		5
4837		5
4838		5
4839		5
4840		5
4841		5
4842		5
4843		5
4844		5
4845		5
4846		1
4847		5
4848		1
4849		5
4850		1
4851		5
4852		5
4853		5
4854		5
4855		5
4856		5
4857		5
4858		1
4859		1
4860		1
4861		1
4862		1
4863		1
4864		1
4865		1
4866		1
4867		1
4868		1
4869		1
4870		20
4871		25
4872		1
4873		1
4874		1
4875		1
4876		1
4877		5
4878		5
4879		5
4880		1
4881		1
4882		1
4883		1
4884		1
4885		1
4886		1
4887		1
4888		1
4889		1
4890		1
4891		1
4892		1
4893		1
4894		1
4895		1
4896		1
4897		1
4898		1
4899		1
4900		1
4901		1
4902		1
4903		1
4904		1
4905		1
4906		1
4907		25
4908		99
4909		99
4910		5
4911		1
4912		1
4913		1
4914		1
4915		99
4916		1
4917		1
4918		1
4919		1
4920		1
4921		1
4922		1
4923		1
4924		1
4925		1
4926		1
4927		1
4928		1
4929		1
4930		1
4931		1
4932		1
4933		1
4934		1
4935		1
4936		1
4937		1
4938		1
4939		1
4940		1
4941		1
4942		1
4943		1
4944		1
4945		1
4946		1
4947		1
4948		1
4949		1
4950		1
4951		1
4952		1
4953		1
4954		1
4955		1
4956		1
4957		3
4958		1
4959		1
4960		1
4961		3
4962		100
4963		1
4964		1
4965		1
4966		1
4967		1
4968		1
4969		1
4970		1
4971		1
4972		1
4973		1
4974		1
4975		1
4976		1
4977		1
4978		1
4979		1
4980		1
4981		1
4982		1
4983		1
4984		1
4985		1
4986		50
4987		1
4988		3
4989		1
4990		1
4991		1
4992		1
4993		1
4994		1
4995		1
4996		1
4997		1
4998		1
4999		1
5000		1
5001		1
5002		5
5003		5
5004		1
5005		1
5006		1
5007		1
5008		1
5009		5
5010		1
5011		1
5012		1
5013	~	n/a
5014		1
5015		1
5016		1
5017		1
5018		1
5019		1
5020		1
5021		1
5022		1
5023		1
5024		1
5025		1
5026		1
5027		1
5028		1
5029		1
5030		1
5031		1
5032		1
5033		1
5034		1
5035		1
5036		1
5037		1
5038		1
5039		1
5040		1
5041		5
5042		5
5043		1
5044		1
5045		1
5046		1
5047		1
5048		1
5049		1
5050		1
5051		1
5052		1
5053		1
5054		1
5055		1
5056		1
5057		1
5058		1
5059		1
5060		1
5061		1
5062		1
5063		1
5064		1
5065		1
5066		5
5067		5
5068		1
5069		1
5070		15
5071		1
5072		1
5073		1
5074		1
5075		1
5076		1
5077		1
5078		1
5079		1
5080		1
5081		1
5082		1
5083		1
5084		1
5085		1
5086		1
5087		1
5088		1
5089		1
5090		1
5091		1
5092		5
5093		5
5094		1
5095		1
5096		1
5097		1
5098		1
5099		1
5100		1
5101		1
5102		1
5103		1
5104		1
5105		1
5106		1
5107		1
5108		1
5109		1
5110		1
5111		3
5112		1
5113		1
5114		1
5115		1
5116		1
5117		1
5118		1
5119		1
5120		3
5121		1
5122		1
5123		1
5124		1
5125		1
5126		1
5127		25
5128		25
5129		1
5130		1
5131		1
5132		5
5133		1
5134		1
5135		5
5136		1
5137		1
5138		1
5139		1
5140		1
5141		1
5142		1
5143		1
5144		1
5145		1
5146		1
5147		1
5148		1
5149		1
5150		1
5151		1
5152		1
5153		1
5154		1
5155		1
5156		1
5157		1
5158		1
5159		1
5160		1
5161		1
5162		200
5163		1
5164		1
5165		1
5166		1
5167		1
5168		1
5169		1
5170		1
5171		1
5172		1
5173		1
5174		1
5175		1
5176		1
5177		1
5178		1
5179		1
5180		1
5181		1
5182		1
5183		200
5184		1
5185		1
5186		1
5187		1
5188		1
5189		1
5190		1
5191		1
5192		1
5193		1
5194		1
5195		1
5196		1
5197		1
5198		1
5199		1
5200		1
5201		1
5202		1
5203		1
5204		200
5205		1
5206		1
5207		1
5208		1
5209		1
5210		1
5211		20
5212		5
5213		1
5214		25
5215		100
5216		400
5217		400
5218		1
5219		1
5220		1
5221		1
5222		1
5223		1
5224		1
5225		1
5226		1
5227		1
5228		1
5229		1
5230		1
5231		1
5232		1
5233		1
5234		1
5235		1
5236		1
5237		1
5238		1
5239		1
5240		1
5241		1
5242		1
5243		1
5244		1
5245		1
5246		1
5247		1
5248		1
5249		1
5250		1
5251		1
5252		1
5253		1
5254		1
5255		1
5256		1
5257		1
5258		1
5259		1
5260		1
5261		1
5262		1
5263		1
5264		1
5265		1
5266		1
5267		1
5268		1
5269		1
5270		1
5271		1
5272		1
5273		1
5274		1
5275		5
5276		1
5277		5
5278		5
5279		1
5280		1
5281		1
5282		1
5283		1
5284		1
5285		1
5286		10
5287		10
5288		1
5289		1
5290		1
5291		400
5292		200
5293		100
5294		1
5295		1
5296		1
5297		1
5298		1
5299		1
5300		5
5301		1
5302		1
5303		1
5304		1
5305		1
5306		100
5307		400
5308		1
5309		1
5310		1
5311		5
5312		5
5313		5
5314		1
5315		1
5316		1
5317		1
5318		1
5319		1
5320		30
5321		30
5322		1
5323		1
5324		1
5325		1
5326		1
5327		5
5328		5
5329		1
5330		1
5331		1
5332		1
5333		1
5334		3
5335		1
5336		1
5337		1
5338		1
5339		1
5340		1
5341		1
5342		1
5343		1
5344		100
5345		1
5346		1
5347		1
5348		99
5349		50
5350		5
5351		1
5352		1
5353		100
5354		1
5355		1
5356		1
5357		1
5358		1
5359		1
5360		1
5361		1
5362		1
5363		400
5364		1
5365		400
5366		400
5367		400
5368		400
5369		400
5370		400
5371		400
5372		400
5373		400
5374		400
5375		400
5376		400
5377		99
5378		99
5379		99
5380		99
5381		1
5382		1
5383		5
5384		5
5385		1
5386		1
5387		1
5388		1
5389		1
5390		1
5391		1
5392		99
5393		99
5394		99
5395		100
5396		400
5397		200
5398		50
5399		200
5400		1
5401		100
5402		100
5403		100
5404		100
5405		100
5406		100
5407		100
5408		100
5409		400
5410		400
5411		400
5412		400
5413		400
5414		400
5415		400
5416		400
5417		100
5418		400
5419		100
5420		400
5421		100
5422		400
5423		100
5424		400
5425		100
5426		400
5427		100
5428		400
5429		100
5430		400
5431		100
5432		400
5433		100
5434		400
5435		100
5436		400
5437		1
5438		30
5439		100
5440		100
5441		100
5442		100
5443		100
5444		100
5445		400
5446		400
5447		400
5448		400
5449		400
5450		400
5451		1
5452		1
5453		1
5454		1
5455		1

Search forums

Follow along with the video below to see how to install our site as a web app on your home screen.

Note: This feature may not be available in some browsers.

Game Mechanics Improved duplication/research quality-of-life

Thread starter antrobot1234
Start date May 18, 2020
Terraria - Discussion
Game Suggestions

antrobot1234

May 18, 2020

I've been playing journey mode with master mode difficulty set, and so far it's been pretty fun! however, there have been a few gripes about how annoying certain features (or lack thereof) can get at times, especially later in the game. Currently, I feel like the player's research-duplication menu and the players inventory have completely separate functionalities, when in my opinion there should be some form of linkage between the two. As such, I have a list of suggestions that I think would greatly improve the day-to-day of journey mode (including a few more general ones). duplication menu/research menu 1: making shift-rightclick insert one of an item into your inventory (similar to how right click allows you to get 1 of an item and shift-click allows you to get a stack inserted in your inventory) 2: adding a "clear all researched" and "restock" buttons to the duplication menu. the restock option would work exactly like the restock option does for any storage interface. the clear all researched would get rid of any non-favorited item in your inventory that you have already unlocked duplication of 3: adding an option to automatically erase any researched item and to research items that haven't been yet (on pickup) 4: adding a "research all" button which automatically researches everything in your inventory that you haven't favorited and hasn't been unlocked yet 5: holding a hotkey (such as ctrl) should give you debug information on an item (such as ID, numerical weapon stats, and block hardness) searching/grouping 1: clearing the search bar when right-clicked 2: have an option to automatically defocus the search box whenever you click away from your inventory or the duplication menu 3: allowing user defined groups based on manual addition or filters (such as cost >= 1500, name contains "potion",or category furniture). each player-defined category can be assigned the icon of any researched item. 4: adding sorting functionality 5: adding a blacklist feature that gets rid of an item from any other category and adds it to a special blacklist category crafting/progression management 1: adding an option to allow players to craft with any duplicatable items (with an optional name/catagory filter) 2: adding an option to disable any item from the recipe browser if it's been researched. 3: adding either a list of every item not researched, or a progress bar to show how many of terraria's items have been researched. misc suggestions 1: Infection spread should work like a slider similar to enemy difficulty or time scaling (ranging from 0 to some number X times the standard infection spread) 2: showing research progression on items in other places besides the player inventory (mainly shops) 3: time you should be able to control the time of day via a slider instead of only being able to chose between 4 options if you have any more in a similar vein, or have any questions/comments about my suggestions, don't hesitate to post a reply about it even if none of these features are added, at least expose journey mode functionality to mods come tmodloader's 1.4 release so these features could be added by others (maybe even me!)

justinbrick

Jun 7, 2020

Bump, I've been playing Journey for a while and would really love to see these being a thing, it would be great to have hotkeys and stuff like this, and some minor changes like these would make a big difference!

Jun 14, 2020

Bump. These are all insanely useful suggestions and would eliminate a ton of hassle. My biggest gripe is about the search bar. Having a duplication menu search toggle hotkey would be great. I mean, really just custom hotkeys for all Journey mode powers, although I'm sure there will be a mod for that at some point.

Official Terrarian

Jun 15, 2020

Yes. My suggestion is just make the Angler not give duplicates of researched items.

Nov 1, 2020

Bump again. These are really good suggestions !

Nov 2, 2020

they did add more categories, which was a step in the right direction, but given that 1.4.1 was the mast major update, i suspect that these will have to be modded in.

antrobot1234 said: they did add more categories, which was a step in the right direction, but given that 1.4.1 was the mast major update, i suspect that these will have to be modded in. Click to expand...

This site uses cookies to help personalise content, tailor your experience and to keep you logged in if you register. By continuing to use this site, you are consenting to our use of cookies. Accept Learn more…

Join our discord

How to duplicate items in Terraria 1.4

26th Sep 2020

With the release of Terraria 1.4 , there’s so much new content that some people don’t even know where to start. Because of this, many players end up looking for new duplication glitches to make the game easier.

Something new that was added is Journey Mode , which is sort of a creative mode where you can duplicate any item indefinitely. This guide will show you how to use duplication in Journey Mode, as well as explain the easiest duplication glitches to do in any mode.

How to duplicate in Journey Mode

Journey Mode is a new game type that’s completely separate from the others. To start Journey Mode, you need to create a new Journey character and start a Journey world. You can only play on those worlds with Journey characters, making it impossible to transfer duped Journey items onto a normal map.

Once you’ve loaded into your Journey world, you’re already ready to start duplicating. When you open your inventory, you’ll notice a little rabbit icon underneath it, which opens your power menu. The power menu is a collection of all your “creative mode” powers.

The little gear in the power menu is called the Research section, which allows you to put any item into it to research. When the research requirements are fulfilled, you can access that item from the creative menu and duplicate as many as you want.

Every item will have different amounts needed to research. Consumables typically need 100 items, whereas accessories and weapons only need 1.

Server duplication glitch

The classic server duplication glitch isn't unique to just Terraria. It involves exploiting a server and autosave to duplicate any items you loaded in with. This won’t work if you’re the host of the server, unless you’re hosting the server via TShock or other methods.

To do this, make sure that you have all the items you want to dupe in your inventory. Load into the server and quickly find a nearby container, or have a friend help you out. Remove the item and place it into a container or give it to your friend, and then force close the game.

This can be done by using ALT + F4 or task manager, and both work equally well. The server dupe method works on console as well, so it’s not limited to the PC version. It also isn’t expected to change anytime soon, so enjoy getting all the items you want.

Boulder glitch

If you’re by yourself or don’t have a server set up, the next best thing is the boulder dupe glitch . This may or may not be patched in coming updates, so definitely try out the above method before you do this one.

For this one to work, you need to be hosting a multiplayer game. It doesn’t work in singleplayer, so be sure that multiplayer is on. You’ll need the following items for this glitch:

Wood blocks
1 Sand Block
Bars to dupe

How to duplicate in Terraria Screenshot 1

Start off the glitch by creating this little structure.

Then, climb up next to where the table is and break the door. If it’s been done correctly, the table should break and the sand should fall to the ground.

The next step is to place another table onto the blocks you’re standing on, and then place a boulder onto the table. On top of the boulder, place the bars or chests you want to duplicate. Opening and closing the door will cause items to be duped each time you click. Here’s what the finished product should look like:

How to duplicate in Terraria Screenshot 2

Now that you know how to duplicate items, be sure you use your new powers wisely. Definitely don’t do this in a server where you can be banned, and only do it for worlds you or your friends own. There are many more glitches than these, but these are some of the easiest ones you can do.

Have you found this article helpful?

Sharing is caring

Read other articles in this category:

Duplicate Items

How to find all the Lost Forges in Destiny 2

Destiny 2’s Black Armory DLC introduced a ton of new content such as weapons, armor, activities, and Exotic Quest Lines. The most noteworthy additions in Black Armory are the Lost Forges activities, which are 3 player Horde missions similar to Escalation Protocol activities. Players often have 2 questions about these Forges: what are Forges, and how do you find them? This guide will answer both of those questions, and give you some other info along the way. What are Lost Forges? Forges are 3 player events that are required to craft the Black Armory Exotic weapons.

Netflix for Games: Amazon on cloud gaming

There are signs that Amazon may want to offer game streaming as early as 2020. In the future, first-class games will be able to be played by anyone who has a smartphone or other streaming-enabled device.

Duplication

Duplication (also known as duping) is a process by which the player creates multiple copies of an item using an exploit or glitch.

Using any of these methods may rapidly make the game less enjoyable and can possibly corrupt the game if it is overused— use these methods at your own risk .
Many players of Terraria do not support duplication when playing single player but will use it for PvP. Duping Fallen Stars is very useful for using the Star Cannon .

Duplication on Mobile [ ]

Character duplication exploit [ ].

Put anything you want to dupe in your inventory.
Exit the world.
Backup the character with the items.
Go back into the world and put items in a chest.
Exit the world then reenter with original character.
(Optional) Delete the character with the empty inventory.

This does not really use a glitch or a bug, but it was pretty effective. (Patched in 1.3 update)

Chest Duplication [ ]

Have two players in the same world with a chest.
Have the item(s) you want to dupe in the chest.
Save the game.
After the game has saved, have Player Two take the items out, and exit without saving.
Get Player Two to rejoin.

Player two will still have the items but the same items will still be in the chest. There are now two, (or two sets) of the item(s) you duplicated. This works on mobile.

World Duplication [ ]

Make a new world, and put the items you want to duplicate into a chest
Backup that world
Go into the backup copy of the world, and take the items out
Delete the backuped world.
Go back to the original world and insert the duped items into the chest.

This strategy is effective and it is singleplayer.

These tactics effectively double the amount per-use

Two-Player Duplication [ ]

Go in your world and invite a friend.
Both of you find a chest and open it at the same time.
One of you put the item in you want to dupe.
Both of you click "loot" at the same time.
Repeat with different items if you want.

Note: This glitch is old, and may not work for the newest versions of Terraria. Please understand this if the glitch does not work.

Single-Player Chest Duplication [ ]

Load any world.
Place the item(s) you want to dupe into a chest.
Save and exit.
Load the same world.
Put the item in your inventory. Any item you transfer from a chest to your inventory in this step will be duped.
Die, then pause the game before you respawn. Do not Save and exit.
Reload Terraria. This can be done by swiping up/pressing the home button twice to view all your apps, then swiping Terraria up so it closes.
The items have now been duped. Any items in chests will be the same as in step 2, while any items transferred in step 5 will be in that character’s inventory.

Note: the money you lose by dying in step 6 will be lost, as will any items put into chests from step 4-6. It is highly recommended to place any money you have on your character into a chest before step 3.

This glitch only works on mobile, and has not been patched as of now.

Random add- this also works on console, except instead of refreshing, just quit the game. Hope that helps.

Duplication on PC [ ]

Singleplayer [ ].

Start a Terraria server with the TerrariaServer file in your Terraria folder.
Join your server.
Create a chest with the items you want to duplicate in it.
On the server console, type " save ".
When it is done saving, go to the chest and take the items.
Disconnect from the server.
On the server console, type " exit-nosave ".
Your items will be in the chest and in your inventory.

Multiplayer [ ]

Ensure autosave is off.
Visit a friend and drop off any stuff you want to be duplicated.
Exit without saving, then have them invite you back. You will rejoin with all of your original items, and the items you dropped will still be there, waiting to be picked up.

Multiplayer Optional [ ]

Join a multiplayer or friends world.
Drop the item you want to duplicate without standing on top of it.
Fill up your inventory.
Stand over the object and hold down shift and click an item you want to put into your portable trash can, and the item should be duplicated multiple times (item may be on the ground and freeing up space in your inventory causes multiples to be created).
To pick up the item just in case it bugs/glitches, move away from the item, free up space in your inventory and then walk over to the item and pick it up.
This still works since October 26, 2013.
Duplicating items this way and putting them in chests may make the chest become buggy and unusable as it will make the chest look like it lost some of its properties of storage.
The chest if cleared and destroyed may fix this, however, it still may be possible for the chest to make the world you put the duplicate items in bugged and broken, thus making it unloadable.
Make a backup save before doing anything with this duplication as long as it doesn't involve a chest.
Using a Safe or Piggy Bank does not cause this bug/glitch to happen.
It is also unknown of what causes this to happen (for now).
the issue may be due to lag or possibly certain settings, may also be caused by a character made before a certain patch or from the first release. (tested with other new characters and only works with the 1 character)

Ice Rod [ ]

Place a storage object that can hold items.
Fill the container with any item(s).
Use the Ice Rod on a corner of the storage.
Use a Pickaxe to break the container.
Enjoy infinite storage.

Mechanisms [ ]

The chest glitch setup

Place any chest on top of at least one Active Stone Block .
Place any item(s) in the chest.
Use Wire to connect the active stone to a timer .
Activate the timer.
the chest duplication bug was fixed in 1.2, but there is another way that wasn't (2nd photo).

Liquid Duplication [ ]

The pumps and wire for the water/lava generator.

Pumps Method [ ]

Using pumps, you can make a duplicator which will automatically make more Water or Lava . To do this, you will need an Inlet Pump , an Outlet Pump , water/lava, Wire and a Timer . Connect the Wire to the Timer and both pumps. Activate the timer and wait.

Note: As of update 1.4.1, this method does not seem to be working.

Blocks Method ( very simple ) [ ]

This method for duplicating liquid is a fast, cheap, and easy alternative to the pump systems or vast chambers. First, find a flat surface of blocks 13 blocks wide. Next, dig an 11 block wide, one block deep trench in the surface. You should have block+++++++++++block . Pour a bucket of fluid into the trench so that the liquid spreads evenly throughout the trench. Now dig out the block in the center (make sure there's something under it!), with 5 blocks on either side. The fluid should fill up the block you dug out, but keep a thin layer of liquid on the 5 blocks to either side. It will take a bit to fill up, more noticeably with lava, but you must wait until it is completely full to collect more liquid . Once the block is full of liquid, use your bucket to take more as many times as you like! You can also make it better/safer by placing planks above your lava generator so as to not take damage, or by installing it in your ceiling and reaching up to take it. Just remember to never replace any of the blocks with liquid in them.

Note: Once the middle block has been removed and its space has been filled with water, you can remove the block under it and the water will continue pouring at a slow pace. A battery of these generators can fill up a man-made lake fairly quickly. Also useful for Obsidian farming (keep in mind that you don't want the water to drop directly into lava as it will disappear instead of forming obsidian, you need to make at least a tiny body of water to pour onto lava).

Note that this method has not yet worked with honey, probably due to its slow flow speed.

Terraria - Infinite Water Bug, refilling the Ocean

Note: As of update 1.4.1, this method does not seem to be working.

Infinite Water Shaft [ ]

This method is done by placing water in a deep enough shaft. The top of the shaft must be off-screen, far away from the player, outside of the area in which the game is able to check if entities spawn or despawn so the water at the top of the shaft will not be removed, therefore pouring liquid endlessly into the shaft. To make this work, a shaft of at least 2 screens high needs to be used. or pc just use a bottomless water bucket

"Doubler" Duplication [ ]

Go to the "Players" folder in your Terraria folder, which can usually be found at C:\Users\USER\Documents\My Games\Terraria (or just use the search function in your start menu).
Start a single player game.
Put any item you want to duplicate in your inventory (very important) and save and exit your game.
Look in your "players" folder: there will be a file (or multiple files if you have multiple characters) which looks something like "Player1.plr".
Copy and paste this file so that there are now two of the same file in your "Players" folder (the name will change to "Player1-copy.plr" or something close to this).
From Terraria's main menu, reload your game. You will notice at the character selection screen that you now have two of the same character to choose from. Choose the second one and continue to your world.
Once in your world, take the item you wish to duplicate and stick it in a chest (it helps to place a chest right next to your bed or spawn point in order to save a little time). Save and exit.
From Terraria's main menu, reload your game with your original character. Now your original has the item you wish to duplicate still in its inventory, as well as in the chest.
DELETE both the original AND the copied file in your "players" folder BEFORE you save and exit your world (when you save and exit, a brand new save file will appear in your "players" folder).
Save and exit your world, copy and paste your most recent save, rinse and repeat.

Not working in 1.2: You need: 1 NPC (not guide) The item(s) you want to dupe Money! First, open the shop from an NPC, then select the item you want to dupe, sell the item buy it back, now you can buy it again, and again. This can be done with every item, so long you have enough money.

Duplication on the Console Version [ ]

With chests [ ].

Place the item you want to duplicate in a chest then save & exit the world.
Re-enter world in single player.
Take the items you want to duplicate from the chest.
Press save and exit
Force close the game when it says "Saving world data %100"
Enter world again and grab items.
Rinse and repeat.

Without Chests [ ]

Requires two system accounts; works with one controller, better with two.

There are two points in this process at which the game must be saved. If the game saves anywhere else you must start all over from the first step.

Load both system accounts and have them stand about 3 or 4 body widths apart facing each other. Have the second account's inventory open so you can tell when they have picked up everything - also have them give you anything you intend to copy. Now save the game. Timing is important over the next few steps ; there are several points at which the system will autosave your data.
Give the stuff you want to be copied to the second account on your system (open your inventory and drop the items so the other account can pick them up).
Have the second system account exit the game through the start menu as soon as you are done gifting them your items. This saves their data so don't skip this step.
Force quit as soon as the other account is out of the game. This prevents the game from auto saving your empty inventory after they exit.
Load both accounts and retrieve your copied items. You should have doubled your inventory goods.

Any Item [ ]

Requires online account. On PS4 you need a PSN account. Also, it does not require the online network (for PS4 you don't need PS plus).

Log on to your network account, go onto the character that has the items that you want to duplicate.
Exit to the home screen and go to characters.
Hover over the character with the items you want to duplicate and press L1 to upload the character to the cloud.
Enter a world and put the items you want to dupe in a chest and exit, then go to Characters.
Hover over the same character then press R1 to download the character.
Enter the same world you would have duplicated the items in. You can continuously duplicate things by repeatedly downloading the character but make sure you put the items in the chest or when you download the character, all of the items you have duplicated will return to the normal amount.
This may cause the world you have used to not load the next time you start the game, which causes the system to lock up. Loading a different world, returning to the main menu, then attempting to load the map that wouldn't load should resolve this problem.

Magic Mirror [ ]

Requires you to have a magic mirror in the top bar.

Open your inventory and select the item you want to duplicate.
Use the magic mirror.
Open your inventory fast, and grab the item; has to be the right timing.
The item should be held, and be in your inventory.
If you grab the item too fast, and also put it in your inventory too fast, it will disappear.

Gallery [ ]

Fastest way to duplicate on console (Singleplayer).

1 Vile Powder
2 Heart Statue
3 Flame Wings

How to Duplicate in Terraria
Terraria Blogs

Make Your Own Terraria Server

Your own Terraria server is only 5 minutes away!

Method 1: Using a Modded Terraria Server

Open the Modded Terraria Server with Scalacube. Then, join a server.
Make a chest and fill it with the items you want to duplicate.
Type "save" into the server panel.
Go to the chest and take the stuff after it has finished saving.
Cut your connection to the server.
Enter "exit-nosave" into the server terminal.

Method 2: Using the Research Power Menu

Toggle the research power menu open by clicking the icon with the three colored blocks.
By doing this, you'll have access to a menu of your inventory that includes everything you can duplicate.

Method 3: Using a Local Server

Acquire the things you want to duplicate and keep them in stock.
Save your work and leave your planet.
Choose Multiplayer.
Choose Play & Host.
Launch a personal server.
When entering the world, place the objects you wish to replicate in a chest, then close the chest menu.
Push ALT and F4.
Set up your single-player world.
There are duplicates of your things.

Method 4: Using a Duplication Glitch

Pack a chest with the items you want to duplicate.
Save your world and depart it.
Return to your world and remove the contents of the chest.
Use Task Manager or Alt + F4 to force Terraria to close.
Reopen your world and Terraria.
The original things should still be in the chest and the duplicates should be in your inventory.

Method 5: Using Journey Mode

Final Thoughts

Our company.

Scalable Hosting Solutions OÜ Registration code: 14652605 VAT number: EE102133820 Address: Harju maakond, Tallinn, Kesklinna linnaosa, Vesivärava tn 50-201, 10152

Privacy Policy
Terms and Conditions
Refund policy
Control Panel
Affiliate Program
Apply for Sponsorship

Game Server Hosting

Minecraft Server Hosting Bedrock Server Hosting ARK Server Hosting Palworld Server Hosting Project Zomboid Server Hosting Rust Server Hosting Valheim Server Hosting Hytale Server Hosting Terraria Server Hosting Factorio Server Hosting CS: GO 2 Server Hosting All Games

Minecraft Hosting

Modded Minecraft Server Hosting Best Minecraft Server Hosting How To Make A Minecraft Server Minecraft Forge Server Hosting Free Minecraft Server Hosting Minecraft VR

Minetest Forums

The official Minetest discussion board

Unanswered topics
Active topics
Board index User-contributed Content Mods WIP Mods

[Mod] Research N' Duplication [rnd]

by Noodlemire » Thu Jul 09, 2020 00:42 Post

Re: [Mod] Research N' Duplication [rnd]

by Noodlemire » Thu Jul 16, 2020 02:54 Post

by Sokomine » Wed Jul 22, 2020 20:45 Post

by Ignaramico » Sun Sep 06, 2020 00:32 Post

by Noodlemire » Mon Sep 07, 2020 17:20 Post

Ignaramico wrote: ↑ Sun Sep 06, 2020 00:32 Is there a way to remove or rearrange the items of the duplicate window?, at a point i researched an iron tools but since i have a diamond tools reasearched now, i dont need the iron pickaxe anymore

by Wuzzy » Mon Sep 14, 2020 14:33 Post

by Ignaramico » Tue Dec 22, 2020 00:22 Post

by Noodlemire » Tue Dec 22, 2020 21:51 Post

Ignaramico wrote: ↑ Tue Dec 22, 2020 00:22 I tried unified inventory just for fun, and it conflicts with the mod, is the mod from content page updated for the support?

by PolySaken » Fri Dec 25, 2020 00:57 Post

Wuzzy wrote: ↑ Mon Sep 14, 2020 14:33 One issue that annoys me about many mods like this one is that they write the itemstring (like "default:glass") in the GUI instead of the proper name (like "Glass").

Return to “WIP Mods”

Who is online

Users browsing this forum: Baidu [Spider] and 1 guest

Board index
All times are UTC
Delete cookies

Privacy | Terms

How to research and duplicate items in Terraria

How to use the new duplication feature in 1.4

May 16, 2020
Guides Terraria

Screengrab via Re-Logic

Researching items is relatively easy. The research option is available from the power menu. Just hit Esc, click on the power menu icon just below your inventory to access the available powers.

About the author

Davy Davison

I am an avid PC gamer - I play a lot of Gacha games, MMOs, Survival games and TCGs. I am also getting more into mobile games. I cover and play a little bit of everything and love to explore new genres. When I am not actively playing or writing about games I am watching streams or managing a Minecraft server.

Research N' Duplicate

Obtain and research enough of a specific item to unlock the ability to infinitely duplicate it.

Building Mechanics and Tools Inventory Survival

How do I install this?

Inspired directly by Terraria's recent 1.4 update, this mod offers an "earned creative" mode to survival players. When active, you can use a specific amount of an item for research. Once an item is fully researched, it is permanently unlocked in the duplication menu, letting you create an infinite amount of that item.

You can choose how to fill out your duplication menu and only see types of items you actually use, but more importantly, you have to play the game in a somewhat normal fasion in order to unlock duplication. There'll be a lot less grinding, but rare materials will still be rare and difficult to research. The overall goal is to create gameplay where you can create impressive builds with relative ease, but there's still a big reason to interact with the game's other features, like exploring and fighting. In turn, those goals may naturally lead to situations where you wish to make a practical super-contraption with whichever dupes you've unlocked so far.

As long as sfinv is active, "Research" and "Duplicate" tabs will appear in your survival inventory. Otherwise, those menus can be shown using the /research and /duplicate commands, respectively.

Do you recommend this mod?

This is a great QoL mod

This has been a complete time saver when building on my server. The only issue is that it doesn't work well with Unified Inventory as it offsets to where it's hard to see the borders of the R&D screen.

Good alternative to the grind

Depending on your playstyle/world, this can drastically change the way gameplay is enjoyed. It works well!

I was just damn amazed on using this mod it is reallly amazing.Thanks to this modd farming,combating and mining is easier than before

The Elder Scrolls Online

Dev Tracker

Research 1 Helm Trait to Unlock

Rosveen wrote: » Yes. To craft a set item, you need to research a specific number of traits on it first (doesn't matter which ones). The requirements for every set are different, ranging from 2 to 8. Seducer needs 3.

Get the Reddit app

Dig, fight, explore, build! Nothing is impossible in this action-packed adventure game. The world is your canvas and the ground itself is your paint.

Dear Re-Logic, trying to unlock duplication of every item in Terraria is an amazing meta-game, but is almost impossible without better organization of the item dupe menu. Having more tabs for specific categories as well as a progress bar (like the bestiary) would be a godsend!

By continuing, you agree to our User Agreement and acknowledge that you understand the Privacy Policy .

Enter the 6-digit code from your authenticator app

You’ve set up two-factor authentication for this account.

Enter a 6-digit backup code

Create your username and password.

Reddit is anonymous, so your username is what you’ll go by here. Choose wisely—because once you get a name, you can’t change it.

Reset your password

Enter your email address or username and we’ll send you a link to reset your password

Check your inbox

An email with a link to reset your password was sent to the email address associated with your account

Choose a Reddit account to continue

Search Menu
Sign in through your institution
Chemical Biology and Nucleic Acid Chemistry
Computational Biology
Critical Reviews and Perspectives
Data Resources and Analyses
Gene Regulation, Chromatin and Epigenetics
Genome Integrity, Repair and Replication
Molecular Biology
Nucleic Acid Enzymes
RNA and RNA-protein complexes
Structural Biology
Synthetic Biology and Bioengineering
Advance Articles
Breakthrough Articles
Molecular Biology Database Collection
Special Collections
Scope and Criteria for Consideration
Author Guidelines
Data Deposition Policy
Database Issue Guidelines
Web Server Issue Guidelines
Submission Site
About Nucleic Acids Research
Editors & Editorial Board
Information of Referees
Self-Archiving Policy
Dispatch Dates
Advertising and Corporate Services
Journals Career Network
Journals on Oxford Academic
Books on Oxford Academic

Article Contents

Introduction, materials and methods, data availability, supplementary data, acknowledgements, adarp150 counteracts whole genome duplication.

Article contents
Figures & tables
Supplementary Data

Frank van Gemert, Alexandra Drakaki, Isabel Morales Lozano, Daniël de Groot, Maud Schoot Uiterkamp, Natalie Proost, Cor Lieftink, Marieke van de Ven, Roderick L Beijersbergen, Heinz Jacobs, Hein te Riele, ADARp150 counteracts whole genome duplication, Nucleic Acids Research , 2024;, gkae700, https://doi.org/10.1093/nar/gkae700

Permissions Icon Permissions

Impaired control of the G1/S checkpoint allows initiation of DNA replication under non-permissive conditions. Unscheduled S-phase entry is associated with DNA replication stress, demanding for other checkpoints or cellular pathways to maintain proliferation. Here, we uncovered a requirement for ADARp150 to sustain proliferation of G1/S-checkpoint-defective cells under growth-restricting conditions. Besides its well-established mRNA editing function in inversely oriented short interspersed nuclear elements (SINEs), we found ADARp150 to exert a critical function in mitosis. ADARp150 depletion resulted in tetraploidization, impeding cell proliferation in mitogen-deprived conditions. Mechanistically we show that ADAR1 depletion induced aberrant expression of Cyclin B3, which was causative for mitotic failure and whole-genome duplication. Finally, we find that also in vivo ADAR1-depletion-provoked tetraploidization hampers tumor outgrowth.

Evading growth suppressors and resisting cell death have been identified as hallmarks of cancer ( 1 ). Many cancers have lost the canonical tumor suppressor pRB or other proteins that activate the G1/S checkpoint to prevent DNA synthesis in the absence of mitogenic signaling. This condition is often accompanied by loss of the guardian of the genome p53 that halts cell cycle progression or induces apoptosis in response to overwhelming DNA damage. Further suppression of cell death is frequently achieved by amplification of the anti-apoptotic protein Bcl2. To mimic these hallmarks of cancer, we previously disrupted all three retinoblastoma family members in Mouse Embryonic Fibroblasts (Triple Knock Out (TKO) MEFs), alleviating the G1/S checkpoint. Indeed, these cells can enter S-phase under mitogen-deprived conditions but consequently suffer from severe DNA replication stress, leading to cell cycle arrest and apoptosis. Evading these responses was achieved by overexpression of Bcl2 (TB) and disruption of p53 (TBP). The concomitant suppression of apoptosis and cell cycle arrest allowed G1/S-checkpoint-defective cells to proliferate mitogen independently, thus mimicking in a cell culture model the unrestrained proliferative capacity of cancer cells ( 2 , 3 ). However, mitogen-independently-proliferating TBP cells still suffered from DNA replication stress and critically relied on the intra-S-phase checkpoint proteins ATR and CHK1. In shRNA and CRISPR/Cas9 drop-out screens, we sought to identify additional pathways essential for TBP cells to mitigate the deleterious consequences of replication stress: the loss of specific shRNAs or gRNAs from libraries points to pathways that are needed to sustain proliferation under growth-restricting conditions ( 4 ).

Here, we demonstrate that TBP cells critically relied on ADAR1 to maintain mitogen-independent proliferative capacity. ADAR1 has recently received much attention as an RNA editing enzyme that catalyzes the conversion of adenosine (A) to inosine (I) in double-stranded RNA (dRNA). Although the A to I conversion by ADAR1 can recode transcripts, editing by ADAR1 predominantly occurs in non-coding regions such as introns and 3′ untranslated regions ( 5 ). ADAR1 produces two protein isoforms, ADARp110 and ADARp150, containing three dRNA binding domains (dRBD1-3) and a catalytic deaminase domain. Unique to ADARp150 is the Zα-domain that allows binding to left-handed Z-RNA/Z-DNA ( 6 ). The short isoform ADARp110 is constitutively expressed in the nucleus and has been implicated in resolving R-loops at telomeres ( 7 ). The longer ADARp150 is well known for its role in editing inversely oriented short interspersed nuclear elements (SINEs) found in endogenous mRNAs. Editing of such RNA structures prevents recognition by a family of cytosolic pattern recognition receptors known as retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs), key sensors of virus infection ( 8 ). Recent studies suggested activation of this pathway to be causative for developmental defects in patients suffering from the type 1 interferonopathy Aicardi-Goutières syndrome (AGS), who carry an inherited defect in ADAR1 ( 6 , 9 ).

We uncovered an unexpected role of ADARp150 in proper chromosome segregation during mitosis: upon ADAR1 depletion, TBP cells gradually became tetraploid by occasional whole genome duplication (WGD) events. Tetraploidy turned out to hamper mitogen-independent proliferation of TBP cells, thus explaining the requirement for ADAR1. Mechanistically we show ADARp150 depletion induced overexpression of Cyclin B3 that was critical for WGD. Finally, we show that tetraploidy also hampered tumor outgrowth in vivo suggesting that in vitro growth-restricting rather than growth-promoting culturing conditions reflect the tumor microenvironment in vivo .

Generating cell lines

TBP MEFs were generated and cultured as described previously ( 4 ). WT and p53 −/− hTERT ARPE-19 cells were kindly provided by Job de Lange ( 10 ) (ATCC Cat# CRL-2302, RRID: CVCL_0145). CRISPR/Cas9 technology was used to inactivate Rb (sgRNA: 5′-TGAACGACATCTCATCT-3′), Rbl1 (sgRNA: 5′-TTTCGTGAACGTATAGAA-3′) and Rbl2 (sgRNA: 5′-CGAGGTTGCTCCTCTTGA-3′) in these cells. Bcl2 cDNA was overexpressed using retroviral transduction (LZRS-ZEO-Bcl2 3 ). These triple knockout, Bcl2 overexpressing and p53 −/− hTERT ARPE-19 cells (TBP ARPE) were cultured in the presence of 10% FCS (Capricorn) supplemented with 0.1 mg/ml penicillin-streptomycin (Sigma). Adar1 knockout clones (TBP MEF) were generated using CRISPR/Cas9 (mouse sgRNA 5′- TACTCTAACAACCCGCTGAC -3′ ). Stable ADAR1 and CCNB3 knockdown TBP ARPE cultures were prepared by lentiviral transduction of pLKO.1 shRNA vectors from the human TRC v1.0 collection (NT: Empty pLKO.1 vector, Adar1 : shRNA #1 TRCN0000050788 and shRNA #2 TRCN0000050789, CCNB3 : shRNA #1 TRCN0000006461 and shRNA #2 TRCN0000006462). Concomitant gene knockout clones of IFNAR1 (sgRNA: 5′-GGCGTGTTTCCAGACTGTTT-3′), IFIH1 (sgRNA: 5′-TTGGACTCGGGAATTCGTGG-3′), RIG-1 (sgRNA: 5′-TCAGGCTGAGAAAAACAACA-3′), Eif2AK2 (sgRNA 5′-GCAACCTACCTCCTATCATG-3′), ZBP1 (sgRNA: 5′-TGGGACACAGCAATGAGATG-3′) and RNASEL (sgRNA: 5′-GCGTGTTTGGATGTGCACAG-3′) were generated using CRSIPR/Cas9 technology. sgRNAs were designed using CRISPick software ( 11 ). FUCCI constructs CSII-EF-MCS-mKO-hCdt1 (30/120) and CSII-EF-MCS-mAG-hGem (1/110) were introduced into TBP cells by lentiviral transduction and FACS-sorted to obtain double-positive cultures. ADARp110 and ADARp150 cDNA was reconstituted into TBP cells by transfecting Pvu1-linearized pm-GFP-ADAR-p110 (Addgene #117928), pmGFP-ADAR-p150 (Addgene #117927) or control pmGFP (Addgene #117926) (vector only). Transfected cells were passed in 0.5 mg/ml G418 until non-transfected control cells were cleared. ADAR-p150 mutant cDNA was created by site-directed mutagenesis PCR of the pmGFP-ADAR-p150 plasmid. ADARp150-E912A primers: 5′-ACTGCCATGCAG C AATAATCTCCCG-3′ & 5′-CGGGAGATTATT G CTGCATGGCAGT-3′. ADARp150-Zα mut primers: 5′-AAATC T ATCGAGTTTTA GC CTCCCTGGCA-3′ & 5′-TGCCAGGGAG GC TAAAACTCGAT A GATTT-3′.

Cell culture

Doubling time of cell cultures was measured by growing 0.15 × 10 6 cells in a 10 cm culture dish for 3–4 days. Cells were counted and the doubling time was calculated using the following formula: incubation time * ln(2)/ln(final cell count/seeding cell count) ( https://www.omnicalculator.com/biology/cell-doubling-time ). For serum starvation cell were seeded and allowed to attach for 4 h, washed with PBS, and incubated for the indicated number of days in serum deprived media. To generate growth curves, we grew cells in μClear 96-well plate from Greiner and imaged using IncuCyte ZOOM instrument (Essen Bioscience) every 4 h.

Flow cytometry

The fraction diploid and tetraploid G1 cells on FACS were analyzed using the FUCCI cell cycle reporters and DAPI. Asynchronous FUCCI + cultures were harvested using a two-step fixation protocol. First for 10 min in 4% formaldehyde and subsequently in 90% ice-cold methanol. Before flow cytometry analysis using the LSR2 SORP (BD Biosciences) cells were stained with 7 mg/ml DAPI. FACS-sorting of diploid and tetraploid TBP ARPE cells was performed by using live-cell fluorescent dye Hoechst 33342 (Invitrogen). To detect cell death among serum starved TBP MEFs we used Zombie NIR TM Fixable Viability Kit (Biolegend). Finally, cell cycle profiling was performed as described previously ( 2 ). In short, TBP ARPE cells were labeled with 10 mM BrdU, ethanol-fixed and stained using propidium iodide. All FACS data was analyzed using FloJo TM software version 10.7.1 (Becton Dickson & Company).

Chromosome spreads

Cells were treated for with 0.1 μg/ml KaryoMAX TM Colcemid TM (Gibco) for 3 hours before harvesting. Next, harvested cells were resuspended in 75 mM KCl solution for 10 minutes and fixed using 3:1 methanol/glacial acetic acid. Fixed cells were dropped onto IHC microscopy slides (DAKO) and stained with 1 mg/ml DAPI. Chromosome spreads were imaged using the metafer system (Metasystems)

Neutral comet assay

Neutral comet assay was performed according to Olive et al. ( 12 ) In short, TBP ARPE cells were harvested and embedded in 1% low agarose gel onto CometSlide (R&D Systems), electrophoresed and stained with propidium iodide. Finally, comets were imaged using the inverted Zeiss AcioObserver Z1 microscope (63× objective) and analyzed using CASP software ( 2 ).

DNA fiber assay

DNA fibers were performed as described earlier ( 2 ). Briefly, cells were labeled with 25 μM CldU followed by 250 μM IdU, both 20 minutes. Next, cells were harvested, lysed, and spread onto microscopy slides (Dako). After fixation using 3:1 methanol:glacial acetic acid slides were incubated in 2.5 M HCl for 1 h and 15 min. Rat-anti-BrdU (Novus Cat# NB 500-169, RRID: AB_341913, 1:500) and mouse-anti-BrdU (BD Biosciences Cat# 340649, RRID: AB_400443, 1:750) were used to detect CldU and IdU, respectively. After washing, the primary antibodies were fixed using 4% paraformaldehyde for 10 min. Finally, slides were incubated with goat-anti-mouse Alexa-fluor TM 488 (Thermo Fisher Scientific Cat# A-21131, RRID: AB_2535771, 1;500) and goat anti-rat Alexa-fluor TM 555 (Thermo Fisher Scientific Cat# A-21434 (also A21434), RRID: AB_2535855, 1:500) for 1 h and 30 min and imaged using the 63× objective of the inverted Zeiss AcioObserver Z1 microscope. ImageJ software (ImageJ, RRID: SCR_003070) was used to assess the replication fork speed (1 μm = 2.59 kb ( 13 )).

Immunoblotting

Protein lysates were prepared using ELB buffer (150 mM NaCl, 50 mM Hepes pH 7.5, 5 mM EDTA, 0.1% NP-40) supplemented with protease inhibitors (Roche). Protein concentration was determined using the BCA protein assay kit (Roche), as described previously ( 10 ). 20 μg protein was loaded onto 4–12% NuPAGE Bis–Tris gels (Life Technologies). Primary antibodies used: ADAR1 (Santa Cruz Biotechnology Cat# sc-73408, RRID: AB_2222767), RB1 (Santa Cruz Biotechnology Cat# sc-50-G, RRID:AB_632340 ), RBL1 (Santa Cruz Biotechnology Cat# sc-318, RRID: AB_2175428), RBL2 (D09855-2 Oncogene), BCL2 (Santa Cruz Biotechnology Cat# sc-509, RRID: AB_626733), p53 (BD Biosciences Cat# 554293, RRID: AB_395348), IFNAR1 (Thermo Fisher Scientific Cat# PA5-79441, RRID: AB_2746557), MDA5 (Cell Signaling Technology Cat# 5321 (also 5321S), RRID: AB_10694490), RIG1 (D1466 Cell Signaling), PKR (Santa Cruz Biotechnology Cat# sc-6282, RRID: AB_628150), RNAseL (Cell Signaling Technology Cat# 27281, RRID:AB_2798941 ), ZBP1 (Novus Cat# NBP1-76854, RRID: AB_11018813). Primary antibodies that, in our study, did not detect the antibody of interest: ADAR1 (Santa Cruz Biotechnology Cat# sc-271854, RRID: AB_10708553), IFNAR1 (Santa Cruz Biotechnology Cat# sc-7391, RRID: AB_2122749, Thermo Fisher Scientific Cat# MA5-43696, RRID: AB_2912628), RIG1 (Santa Cruz Biotechnology Cat# sc-376845, RRID: AB_2732794), ZBP1 (Cell Signaling Technology Cat# 60968, RRID: AB_2799599, AdipoGen Cat# AG-20B-0010 (also AG-20B-0010-C100), RRID: AB_2490191). IR Dye 800CW secondary igG antibodies (LI-COR) were used. Blots were imaged using the Odyssey imaging system and analyzed using ImageStudioLite software (LI-COR).

RNA sequencing

300 000 cells were serum starved for 4 days or grown in the presence of FCS. Cells were washed 3 times with PBS and dissociated using trypsin. Collected cells were washed again and 1 × 10 6 –1.5 × 10 6 were directly resuspended in 800 μl RLT buffer (Roche). Library preparation was performed with the TruSeq polyA stranded RNA prep kit (Illumina) according to the manufacturer protocol. The libraries were analyzed for size and quantity of cDNAs on a 2100 Bioanalyzer using a DNA 7500 chip (Agilent), diluted, and pooled in multiplex sequencing pools. The libraries were sequenced as 51 bp paired-end on a Novaseq 6000 (Illumina) with 20 million reads. Differential expression analysis of the RNAseq data was done with DESeq2 in the statistical programming language R (version 4.0.1) ( 14 ). Further downstream exploration and analyses was done in QIAGEN IPA ( 15 ).

RNA was isolated using the RNAeasy micro kit (QIAGEN). First strand cDNA synthesis was done using SuperScript™ (Thermo Scientific) reverse transcriptase and binding of random hexamer primers. qPCR was performed with 2 ul of 1/5 diluted cDNA using primers specific for CCNB3 and GAPDH using the Lightcycler 480 SYBR green master mix (Roche). Relative expression of CCNB3 was calculated for each primer combination using GAPDH expression of each sample as a loading control for the total cDNA. qPCR primers used for amplification of CCNB3 : Fw-1 5′-CACACCAACATGAAGACACTGACC-3′, Rv-1 5′-CACAGCCTTGAGACTATCGTAAGAAC-3′, Fw-2 5′-TGGGCAAGTCCAGGACCAC-3′, Rv-2 5′-GGGTTGAAACTTGGATCACTGCT-3′, Fw-3 5′-AGGAACACACATGCTCTTGGACT-3′, Rv-3 5′-TGGTACCACGGTAGTAGAGGCTA-3′. qPCR primers used for GAPDH amplification: Fw 5′-ACAACTTTGGTATCGTGGAAGG-3′, Rv 5′-GCCATCACGCCACAGTTTC-3′.

Time-lapse microscopy

Time-lapse microscopy of the FUCCI fluorophores was performed as described before ( 2 ). Images were prepared using the 4 × 4 binning mode. Data was stitched including tile-fusion using 8% overlap and 3% shift. Analysis of individual mitoses was done by manually following single cells using the Zeiss software.

Ex vivo analysis of tumors

NMRI mice ( https://janvier-labs.com/en/fiche_produit/nmri_mouse/ ) were used for xenograft experiments. 2 × 10 6 FUCCI-expressing TBP ARPE cells, either diploid or tetraploid and either with ADAR1 shRNA or NT shRNA, in 200 μl PBS were injected in a single flank. These experiments were carried out after approval of the animal welfare committee of the Netherlands Cancer Institute. Tumor size was measured bi-weekly with a caliper, tumor volume was calculated (length × width × width/2). Most mice (12/20) were sacrificed when the maximal tolerated volume of 1.5 cm 3 was reached. The remaining (8/20) mice were sacrificed earlier because of ulcerating tumors (4/20), secondary tumors (2/20) or rectal prolapse (2/20). All these mice formed visible tumors which were analyzed ex vivo for the presence of tetraploid cells. We manually minced part of the tumor with a razor (Personna™) and enzymatically in DMEM medium with 3 mg/ml collagenase A (Roche), trypsin and 25 μg/ml DNAse I (Sigma) for 30 min at 37 °C ( 16 ). Digested tumor cells were filtered (100 μm) and cultured in DMEM media supplemented with 10% FCS (Capricorn) and 0.1 mg/ml penicillin-streptomycin (Sigma) for 2–4 days depending on the confluency of individual tumors and subsequently subjected to FUCCI FACS experiments to detect the level of tetraploid cells among mKO2-hCDT1 + mAG1-hGem − cells.

Statistical analysis

GraphPad Prism software was used for statistical analysis and the generation of graphs. For survival analysis of animal studies, we used Log-rank tests (Mantel–Cox). One- and two-way ANOVA were used for comparisons of multiple groups. All statistical tests were performed two-tailed and adjusted for multiple testing when appropriate. Sample sizes and specific statistical test used were presented in the legends.

ADAR1 is critical for mitogen-independent proliferation

To identify pathways that are critical for mitogen-independent proliferation of G1/S-checkpoint-defective cells, we performed a genome-wide CRISPR-Cas9 dropout screen. One of the hits of this screen (this unpublished CRISPR screen will be published elsewhere by Van Gemert et al. ) indicated that TBP MEFs critically relied on ADAR1 for proliferation in non-permissive culturing conditions. We created ADAR1 knockout clones and observed minimal or no effect on the doubling time in unperturbed culturing conditions (Figure 1A and Supplementary Figure S1A ). In contrast, upon serum starvation, TBP MEFs critically depended on ADAR1 to maintain proliferative capacity (Figure 1B ). Next to the murine TBP MEFs we also created diploid human retinal epithelial cells (ARPE) with the same genetic background. Like TBP MEFs, TBP ARPE cells ( Supplementary Figure S1B-D ) were able to proliferate in the absence of mitogens and proliferation depended on the intra-S-phase-checkpoint kinase CHK1 ( Supplementary Figure S1E ). Importantly, also for TBP ARPE cells, ADAR1 depletion ( Supplementary Figure S1F ) was lethal only in non-permissive culturing conditions (Figure 1C , D).

ADAR1 depletion is lethal in non-permissive culturing conditions. ( A ) Population doublings (h) of TBP MEFs transduced with non-targeting (NT) or Adar1 sgRNAs clones grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent 6 independent measurements. Error bars indicate standard deviation. ( B ) Representative image of 300.000 serum-starved TBP MEFs from (A) cells cultured for 10 days in 6-well plates. ( C ) Population doublings (h) of TBP ARPE cells transduced with a NT or ADAR1 shRNAs in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent 3 independent measurements. Error bars indicate standard deviation. ( D ) Representative image of 25.000 serum-starved TBP ARPEs from (C) grown for 14 days in 6-well plates. ( E ) Population doublings (h) of NT or ADAR1 knockout TBP MEF reconstituted with linearized pmGFP (vector only), pmGFP-ADAR-p110 or pmGFP-ADAR-p150. Cells were grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent six independent measurements. Error bars indicate standard deviation. ( F ) Fraction of Zombie + TBP MEFs from ( E ) cultured in unperturbed (+10% FCS) or serum-starved culturing conditions for 7 days. Dots represent three individual experiments. Error bars indicate standard deviation. Asterisks represent adjusted P -value of two-sided two-way ANOVA (Šidák multiple comparison test) (**** P -value < 0.0001). ns = non-significant. ( G ) Population doublings (h) of NT or ADAR knockdown TBP ARPE cells reconstituted with linearized pmGFP (vector only), pmGFP-ADAR-p110, pmGFP-ADAR-p150, pmGFP-ADAR-p150-E912A or pmGFP-ADAR-p150-Zα mut grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent 4–7 independent measurements. Error bars indicate standard deviation. ( H ) Representative images of 25.000 serum starved TBP ARPE cells from (G) cultured for 14 days in 6-well plates.

ADAR1 depletion does not aggravate DNA replication stress

We previously showed that mitogen-deprived TBP MEFs had reduced replication fork speed ( 2 , 10 ). Since ADARp110 has been implicated in RNA editing of DNA:RNA hybrids at telomeres we wondered whether ADAR1 depletion aggravates DNA replication stress ( 7 , 17 ). Therefore, we studied replication dynamics using the DNA fiber assay. As expected, TBP ARPE cells transduced with a control (non-targeting; NT) shRNA showed reduced replication fork speed and a trend towards reduced levels of origin firing upon serum deprivation, both indicative of replicative stress ( Supplementary Figure S1G, H ). ADAR1 depleted TBP ARPE cells showed similar changes in replication fork dynamics. In addition, DNA double-stranded break (DSB) formation, measured by the comet assay, was similar in ADAR1-proficient and -depleted cells in non-permissive culturing conditions ( Supplementary Figure S1I ). These results suggest that ADAR1 depletion is synthetic lethal in serum-starved conditions for reasons other than aggravation of DNA replication stress.

ADARp150 is essential in mitogen-deprived conditions

The knockout/knockdown of ADAR1 affected both the short (ADARp110) and long isoform (ADARp150) of ADAR1. To study the effects of the two isoforms separately, we performed reconstitution experiments using ADARp110 and ADARp150 cDNA. In both, mouse and human TBP cells, we observed rescue of mitogen-independent proliferation upon reconstitution by ADARp150 but not by ADARp110 (TBP MEFs Figure 1E - F and TBP ARPE in Figure G-H). Both isoforms were found to have extensive overlapping editing sites, as expected given their shared dRBD and deaminase domain ( 18 ). The Zα domain, however, is unique to the ADAR-p150 isoform and allows binding to a left-handed structure of RNA and DNA called Z-RNA/Z-DNA ( 6 ). We created point mutations in the ADARp150 cDNA expression plasmid to inactivate the Zα-domain (N173A/Y177A) or catalytic deaminase-domain (E912A) and expressed these ADARp150 mutants in ADAR1-depleted cells ( 6 , 7 ). In contrast to wild-type (WT) ADARp150 cDNA, reconstitution with these mutants failed to rescue mitogen-independent proliferation (Figure 1H ), suggesting that both the Zα- and deaminase domain of ADARp150 are critical in supporting mitogen-independent proliferation.

ADAR1 depletion does not affect interferon signaling of TBP cells

The consequences of ADAR1 deficiency have been studied in mice modelling the type 1 interferonopathy Aicardi-Goutières syndrome (AGS). Over 60% of AGS cases are caused by an inherited point mutation (p.P193A) in the Zα domain of ADAR1 combined with a defective deaminase domain or ADAR1 -null allele ( 19 , 20 ). In mice, ADAR1 deficiency triggered the integrated stress response (ISR) causing postnatal mortality. This could be rescued by an ISR inhibitor (ISRIB), or knockout of components of this pathway ( 9 ).

We therefore considered the possibility that the ISR was responsible for the massive death of serum-starved ADAR1-deficient TBP ARPE cells. Surprisingly though, in our hands, knockouts of the type 1 IFN receptor ( IFNAR1 ), the RIG1-like receptor (RLR) family members MDA5 ( IFIH1 ), LGP2 ( DHX58 ), RIG-1 ( RIG-1 ), PKR ( EIF2AK2 ) or endoribonuclease RNAseL ( RNASEL ) ( Supplementary Figure S2A-G and I ) did not rescue mitogen-independent proliferation of ADAR1-depleted TBP cells, nor did ISRIB ( Supplementary Figure S2I ). Similarly, disruption of the Z-DNA/Z-RNA binding protein 1 (ZBP1), another mediator of postnatal lethality in AGS mouse models ( 21–24 ), did not rescue lethality in serum-starved, ADAR1 depleted TBP ARPE cells ( Supplementary Figure S2A, H and I ).

Finally, we used total RNA sequencing to assess transcripts and pathways that were differentially expressed upon ADAR1 depletion and ADARp150 reconstitution ( Supplementary Figure S2J ). Unexpectedly, in mitogen-proficient conditions, ADAR1 depletion reduced interferon signaling. Introduction of ADARp150 rescued interferon signaling and stimulated pathways involving RIG1-like receptors and PKR. Reduced interferon signaling upon ADAR1 depletion and rescue by ADARp150, were also seen in the absence of mitogens, albeit both to a lesser extent and accompanied by a slight dampening of the RIG1-like receptors pathway as well as the NF-κB activation and JAK/STAT signalling. Collectively, these analyses make it unlikely that suppression of type 1 interferon signalling explains the requirement for ADARp150 for mitogen-independent proliferation.

ADAR1 depletion results in tetraploidy

The absence of increased IFN signaling upon ADAR1 knockdown prompted us to further characterize ADAR1-depleted TBP cells. Pulse labeling of TBP ARPE cells with the thymidine analogue BrdU revealed that ADAR1-depleted TBP ARPE cells in both, perturbed and unperturbed conditions, contained a significant fraction of cells with tetraploid DNA content (Figure 2A ). To distinguish diploid cells in G2- and tetraploid cells in G1-phase (both 4n and BrdU Neg ), we used FUCCI cell cycle reporters ( 25 ) that allowed us to measure the DNA content of G1 cells in asynchronous cultures (Figure 2B ) ( 26 ). In both, ADAR1-depleted TBP ARPE and TBP MEFs cultured in the presence of mitogens, G1 cells contained significantly more cells with a DNA content larger than 2 n (Figure 2C , D).

$ADAR1 depletion induces tetraploidization of TBP cells. (A) Cell cycle profiling of BrdU pulse-labeled TBP ARPE cells transduced with a NT or ADAR1 shRNA grown in the presence or absence of serum for the indicated days. Propidium iodide was used to detect DNA content. (B) Gating strategy of FUCCI FACS protocol (26) used to quantify the fraction of G1 cells with a DNA content larger than 2n. Cells (1st column) were selected based on side-scatter (SSC) and forward scatter (FSC), single cells were separated by side-scatter-area (SSC-A) and side-scatter-height (SSC-H), cells gated by using mKO2-hCDT1+/mAG1-hGem− cells represent G1 cells and finally DAPI was used to identify G1 cells with a DNA content larger than 2n. (C, D) Percentage of G1 cells with a DNA content larger than 2n in TBP MEF (C) and TBP ARPE (D) cultures transduced with control (NT) (grey) and Adar1 (blue) sgRNA or ADAR1 shRNA, respectively) cultures. Dots represent independent measurements. Error bars indicate the standard deviation. Asterisks represent adjusted P-value of two-sided one way ANOVA test (Dunnett's multiple comparisons test) (**P-value = 0.008, ***P-value = 0.0009, ****P-value < 0.0001).$

ADAR1 depletion induces tetraploidization of TBP cells. ( A ) Cell cycle profiling of BrdU pulse-labeled TBP ARPE cells transduced with a NT or ADAR1 shRNA grown in the presence or absence of serum for the indicated days. Propidium iodide was used to detect DNA content. ( B ) Gating strategy of FUCCI FACS protocol ( 26 ) used to quantify the fraction of G1 cells with a DNA content larger than 2n. Cells (1 st column) were selected based on side-scatter (SSC) and forward scatter (FSC), single cells were separated by side-scatter-area (SSC-A) and side-scatter-height (SSC-H), cells gated by using mKO2-hCDT1 + /mAG1-hGem − cells represent G1 cells and finally DAPI was used to identify G1 cells with a DNA content larger than 2 n . (C, D) Percentage of G1 cells with a DNA content larger than 2n in TBP MEF ( C ) and TBP ARPE ( D ) cultures transduced with control (NT) (grey) and Adar1 (blue) sgRNA or ADAR1 shRNA, respectively) cultures. Dots represent independent measurements. Error bars indicate the standard deviation. Asterisks represent adjusted P -value of two-sided one way ANOVA test (Dunnett's multiple comparisons test) (** P -value = 0.008, *** P -value = 0.0009, **** P -value < 0.0001).

As we are not aware of studies describing a role for ADAR1 in preventing whole genome duplication (WGD), we wondered whether tetraploidization was specific for TBP cells. p53 depletion alone already significantly increased the fraction of cells with a DNA content larger than 2 n in ARPE cells and, to a lesser extent, also in HCT116 cells. ADAR1 depletion aggravated tetraploidization in both cell types, but not in the corresponding ADAR1-proficient cells ( Supplementary Figure S3A–D ). On the other hand, we did not observe tetraploidization in p53KO-MCF7 cells with or without ADAR1 depletion ( Supplementary Figure S3E-F ). These experiments indicate that p53 serves as a powerful safeguard against spontaneous and ADAR1-depletion-induced whole genome duplication, although other (cell-type-specific) protection mechanism likely operate as well.

ADARp150 depletion promotes WGD

We next tested whether reconstitution of ADAR1-depleted cells with wild-type or mutant ADAR1 would affect the formation of tetraploid cells. To this end, we prepared chromosome spreads of all ADAR1-reconstituted cell lines and counted the number of chromosomes (Figure 3A ). Diploid TBP MEFs (mouse origin) are expected to have 40 chromosomes while TBP ARPE (human origin) should contain 46 chromosomes per cell. Although for both cell lines we measured considerable heterogeneity in chromosome counts, most TBP cells had a near-diploid chromosome count (Figure 3B and D ; below horizontal dashed line). However, among ADAR1-depleted TBP MEFs and ARPE cells we found a sizable population with approximately twice the expected chromosome content (Figure 3B and D ; vector only). ADARp150 reconstitution clearly reduced the number of cells with an abnormal karyotype in both TBP cell types (Figure 3B , D ; quantified in Figure 3C , E ), while ADARp110 had no effect. This effect of ADARp150 required its catalytic and Z-RNA/Z-DNA-binding activity as ADAR1-depleted TBP ARPE cells reconstituted with catalytic dead or Zα-domain-defective mutant cDNA remained highly tetraploid (Figure 3F ). Finally, in ADAR1-depleted ifnar1 −/− TBP ARPE cells, which were unable to proliferate in mitogen-independently, we detected high levels tetraploidy, indicating suppression of whole genome duplication by ADARp150 was not mediated by suppression of the ISR ( Supplementary Figure S3G ). These results show that ADARp150 depletion not only restricted mitogen-independent proliferation but also induced tetraploidization of TBP cells.

$ADARp150 depletion causes whole genome duplication. (A) Examples of individual chromosome spreads of non-targeting (NT) and ADAR1 shRNA transduced TBP ARPE cells. (B) Dots represent the number of chromosomes in individual chromosome spreads of NT (grey) and ADAR1 knockout TBP MEF clone reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p110 (light blue) and pmGFP-ADAR-p150 (purple). Cells were grown in unperturbed culturing conditions (+10% FCS). Dashed horizontal line represent a cut-off of n = 49 below which cells are considered (near-)diploid. (C) Quantification of the fraction of cells with a chromosome count larger or equal to 49 in NT (grey) and ADAR1 knockout TBP MEF cultures reconstituted with the indicated vectors. Dots represent independent experiments which were combined in (B). Error bars indicate the standard deviation. Asterisk show statistical adjusted P-value by one-way ANOVA (Kruskal–Wallis test). Comparisons to NT sgRNA: vector only P-value = 0.0295, ADARp110 P-value = 0.0151, ADARp150 P-value = 0.716. (D) Number of chromosomes in individual chromosome spreads of TBP ARPE cells transduced with a NT (grey) and ADAR1 shRNA, reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p110 (light blue), pmGFP-ADAR-p150 (purple). Cells were grown in unperturbed culturing conditions (+10% FCS). Dashed horizontal line represent a cut-off of n = 50 below which cells are considered diploid. (E) Quantification of the fraction of cells with a chromosome count larger or equal to 50 in TBP ARPE cultures transduced with a NT (grey) or ADAR1 shRNA and reconstituted with the indicated vectors. Dots represent independent experiments which were combined in (D). Error bars indicate the standard deviation. Asterisk show adjusted P-value by one-way ANOVA (Kruskal–Wallis test). Comparisons to NT shRNA: vector only P-value = 0.0167, ADARp110 P-value = 0.0498, ADARp150 P-value > 0.999. (F) Number of chromosomes in individual chromosome spreads of TBP ARPE cells transduced with an ADAR1 shRNA reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p150 (purple), pmGFP-ADAR-p150-E912A (dark-green) and pmGFP-ADAR-p150-Zαmut (dark-blue). Cells were grown in unperturbed culturing conditions (+10% FCS). Dots represent the number of counted chromosomes in individual chromosome spreads.$

ADARp150 depletion causes whole genome duplication. ( A ) Examples of individual chromosome spreads of non-targeting (NT) and ADAR1 shRNA transduced TBP ARPE cells. ( B ) Dots represent the number of chromosomes in individual chromosome spreads of NT (grey) and ADAR1 knockout TBP MEF clone reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p110 (light blue) and pmGFP-ADAR-p150 (purple). Cells were grown in unperturbed culturing conditions (+10% FCS). Dashed horizontal line represent a cut-off of n = 49 below which cells are considered (near-)diploid. ( C ) Quantification of the fraction of cells with a chromosome count larger or equal to 49 in NT (grey) and ADAR1 knockout TBP MEF cultures reconstituted with the indicated vectors. Dots represent independent experiments which were combined in (B). Error bars indicate the standard deviation. Asterisk show statistical adjusted P -value by one-way ANOVA (Kruskal–Wallis test). Comparisons to NT sgRNA: vector only P -value = 0.0295, ADARp110 P -value = 0.0151, ADARp150 P -value = 0.716. ( D ) Number of chromosomes in individual chromosome spreads of TBP ARPE cells transduced with a NT (grey) and ADAR1 shRNA, reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p110 (light blue), pmGFP-ADAR-p150 (purple). Cells were grown in unperturbed culturing conditions (+10% FCS). Dashed horizontal line represent a cut-off of n = 50 below which cells are considered diploid. ( E ) Quantification of the fraction of cells with a chromosome count larger or equal to 50 in TBP ARPE cultures transduced with a NT (grey) or ADAR1 shRNA and reconstituted with the indicated vectors. Dots represent independent experiments which were combined in (D). Error bars indicate the standard deviation. Asterisk show adjusted P -value by one-way ANOVA (Kruskal–Wallis test). Comparisons to NT shRNA: vector only P -value = 0.0167, ADARp110 P -value = 0.0498, ADARp150 P -value > 0.999. ( F ) Number of chromosomes in individual chromosome spreads of TBP ARPE cells transduced with an ADAR1 shRNA reconstituted with linearized pmGFP (vector only; blue), pmGFP-ADAR-p150 (purple), pmGFP-ADAR-p150-E912A (dark-green) and pmGFP-ADAR-p150-Zα mut (dark-blue). Cells were grown in unperturbed culturing conditions (+10% FCS). Dots represent the number of counted chromosomes in individual chromosome spreads.

ADAR1 depletion blocks mitogen-independent proliferation of tetraploid cells

Does genome duplication upon ADARp150 loss underly the synthetic lethal interaction we observed between ADAR1 depletion and serum starvation? To test the effect of WGD on mitogen-independent proliferation, we used the flow cytometry-based method described above (Figure 2B ) to sort diploid and tetraploid G1 TBP cells with or without ADAR1 depletion (Figure 4A ). FACS-sorted populations were maintained in unperturbed culturing conditions and showed similar doubling times (Figure 4B ). However, in serum-starved conditions tetraploidy reduced the proliferative ability of control TBP ARPE cells (Figure 4C; compare NT shRNA diploid- and tetraploid-sorted). Furthermore, while during the short 2-week culturing period used here ADAR1 knockdown (Figure 4D ) did not grossly affect the proliferation of sorted diploid TBP cells, ADAR1-depleted tetraploid TBP cells were unable to proliferate upon mitogen deprivation (Figure 4C ). These results indicate that mitogen-independent proliferation is negatively affected by tetraploidy and even completely blocked upon continuing polyploidization in the absence of ADAR1.

$Progressive polyploidization upon ADAR1 depletion causes lethality under mitogen-deprived conditions. (A) DNA content (DAPI) of G1 TBP ARPE cells transduced with non-targeting (NT; grey) or ADAR1 shRNA (blue). The 1st row represents the parental population. The 2nd and 3rd row represent the diploid- and tetraploid-sorted fraction, respectively, that were FACS-sorted from the parental cultures. (B) Population doublings (h) of diploid- (left three bars) and tetraploid-sorted (right three bars) TBP ARPE cells transduced with NT (grey) and ADAR1 shRNA (blue). Cells were grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent six independent measurements. Error bars indicate standard deviation. (C) Representative images of 25 000 diploid- and tetraploid-sorted TBP ARPE cells from (B) after 14 days of serum starved culturing. Plates were stained with crystal violet. (D) Protein levels of ADARp110 and ADARp150 of cultures used in (B) and (C). γ-Tubulin is used as a loading control.$

Progressive polyploidization upon ADAR1 depletion causes lethality under mitogen-deprived conditions. ( A ) DNA content (DAPI) of G1 TBP ARPE cells transduced with non-targeting (NT; grey) or ADAR1 shRNA (blue). The 1st row represents the parental population. The 2nd and 3rd row represent the diploid- and tetraploid-sorted fraction, respectively, that were FACS-sorted from the parental cultures. ( B ) Population doublings (h) of diploid- (left three bars) and tetraploid-sorted (right three bars) TBP ARPE cells transduced with NT (grey) and ADAR1 shRNA (blue). Cells were grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent six independent measurements. Error bars indicate standard deviation. ( C ) Representative images of 25 000 diploid- and tetraploid-sorted TBP ARPE cells from ( B ) after 14 days of serum starved culturing. Plates were stained with crystal violet. ( D ) Protein levels of ADARp110 and ADARp150 of cultures used in (B) and (C). γ-Tubulin is used as a loading control.

Mitotic failures in the absence of ADAR1 activity underlies WGD

The tetraploid cells we observed in the absence of ADARp150 likely resulted from WGD events. To better understand the onset of tetraploidy we cultured diploid-sorted TBP ARPE cells, control and ADAR1 knockdown, over time in unperturbed conditions. It appeared that tetraploidy developed gradually, visibly starting to accumulate after 5–6 weeks, and reaching near-completion in approximately 10 weeks (Figure 5A , B). To visualize WGD events, we followed FUCCI-expressing TBP ARPE cells over time by time-lapse microscopy. The alternation of FUCCI fluorophores in combination with physical separation of individual cells revealed normal mitotic progression and successful cell division in the majority of both control and ADAR1 depleted cells (Figure 5C , Supplementary Video S1 ). However, upon ADAR1 depletion we observed increased levels of failed cell divisions, in up to 2% of all mitoses. Consistent with the accumulation of tetraploid cells, these TBP ARPE cells generally continued the cell cycle and remained viable until the end of the experiment (Figure 5D , E and Supplementary Video S2 – S6 ). These data suggest that the accumulation of tetraploid karyotypes upon ADAR1 depletion likely resulted from a mitotic defect.

$Mitotic failures in the absence of ADAR1 activity underlies WGD. (A) DNA content (DAPI) of diploid sorted G1 TBP ARPE cells transduced with a non-targeting (NT; grey) and ADAR1 shRNA (blue), cultured over time (rows; weeks). Percentages represent the fraction of G1 cells with 2n (left) or > 2n (right) DNA content. (B) Percentage of TBP ARPE cells in G1 phase transduced with a non-targeting (NT; grey) and ADAR1 shRNA (blue) with a DNA content > 2n cultured over time (weeks) based on the method described in Figure 2C. Cultures were measured on FACS bi-weekly and passed in unperturbed culturing conditions (+10% FCS). (C) Representative example of a FUCCI expressing TBP ARPE cell transduced with a NT shRNA tracked through mitosis using time-lapse microscopy (20× objective, 10-min intervals). Pictures represent key events (arrows and text) over time (rows; hours:minutes). (D) Representative example of a FUCCI expressing TBP ARPE cell transduced with a shRNA targeting ADAR1 that underwent a mitotic failure, tracked using time-lapse microscopy (20× objective, 10-min intervals). Pictures represent key events (arrows and text) over time (rows; hours:minutes). (E) Percentage of successful cell divisions and failed mitotic events as a percentage of all mitosis. Bars indicate TBP ARPE cells transduced with a NT (grey) or ADAR1 shRNA (blue). Sample size: NT shRNA (n = 1704) and ADAR1 shRNAs (n = 1519) individual mitosis divided over three independent experiments (dots). Error bars indicate the standard deviation. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test). Significance levels per category: ‘Cell division’ ***P-value = 0.0005, ‘Failed mitosis’ *P-value < 0.0113, ‘Cell death during mitosis’ ns = non-significant; P-value = 0.2020.$

Mitotic failures in the absence of ADAR1 activity underlies WGD. ( A ) DNA content (DAPI) of diploid sorted G1 TBP ARPE cells transduced with a non-targeting (NT; grey) and ADAR1 shRNA (blue), cultured over time (rows; weeks). Percentages represent the fraction of G1 cells with 2n (left) or > 2n (right) DNA content. ( B ) Percentage of TBP ARPE cells in G1 phase transduced with a non-targeting (NT; grey) and ADAR1 shRNA (blue) with a DNA content > 2 n cultured over time (weeks) based on the method described in Figure 2C . Cultures were measured on FACS bi-weekly and passed in unperturbed culturing conditions (+10% FCS). ( C ) Representative example of a FUCCI expressing TBP ARPE cell transduced with a NT shRNA tracked through mitosis using time-lapse microscopy (20× objective, 10-min intervals). Pictures represent key events (arrows and text) over time (rows; hours:minutes). ( D ) Representative example of a FUCCI expressing TBP ARPE cell transduced with a shRNA targeting ADAR1 that underwent a mitotic failure, tracked using time-lapse microscopy (20× objective, 10-min intervals). Pictures represent key events (arrows and text) over time (rows; hours:minutes). ( E ) Percentage of successful cell divisions and failed mitotic events as a percentage of all mitosis. Bars indicate TBP ARPE cells transduced with a NT (grey) or ADAR1 shRNA (blue). Sample size: NT shRNA ( n = 1704) and ADAR1 shRNAs ( n = 1519) individual mitosis divided over three independent experiments (dots). Error bars indicate the standard deviation. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test). Significance levels per category: ‘Cell division’ *** P -value = 0.0005, ‘Failed mitosis’ * P -value < 0.0113, ‘Cell death during mitosis’ ns = non-significant; P -value = 0.2020.

Tetraploidization upon ADARp150 depletion by induction of Cyclin B3

The editome of ADAR1 includes a wide range of transcripts and pathways whose expression might be affected by A to I editing ( 27 , 28 ). Notably, ADAR1 has been shown to promote expression of transcripts associated with DNA replication and meiotic synapsis ( 29 ). Ingenuity pathway analysis (IPA) of our RNA sequencing data set ( Supplementary Figure S2J ) did not reveal notable changes in selected pathways related to cell cycle control, DNA replication and mitosis upon ADAR1 depletion ( Supplementary Figure S4A ). However, within the ‘mitotic roles of polo-like kinase’ pathway we observed a strong (±95-fold) induction of CCNB3 in ADAR1-depleted cells. CCNB3 encodes Cyclin B3, the third member of the B-type cyclin family. B-type cyclins are induced at the end of G2 phase and by activating cyclin-dependent-kinase-1 (CDK1) drive mitotic initiation and progression ( 30–32 ). Cyclin B3-CDK1 has been shown to activate the anaphase-promoting complex/cyclosome (APC/C) to promote metaphase to anaphase transition ( 33–35 ). Moreover, overexpression of non-degradable Cyclin B3 halts mitotic progression in late anaphase ( 36 ). Aberrant expression of CCNB3 during mitosis could thus underlie the WGD events that we observed upon ADAR1 depletion. First, we confirmed that in our RNA sequencing dataset, despite some minor variations, CCNB3 was the only cyclin whose expression was induced upon ADAR1 depletion and restored upon ADARp150 reconstitution (Figure 6A ). Next, RT-PCR revealed an 8-fold increase of CCNB3 transcripts upon ADAR1 depletion, which was abolished upon ADARp150 reconstitution, confirming that upregulation of CCNB3 was specific to ADARp150 depletion (Figure 6B ). The CCNB3 levels in diploid- and tetraploid-sorted TBP ARPE cells transduced with a NT shRNA (Figure 6C ) did not differ, indicating that ADAR1 depletion rather than tetraploidization underlies the induction of CCNB3 . Next, we sought to functionally test the involvement of Cyclin B3 in tetraploidization upon ADAR1 depletion. To this end, we used ADAR1-depleted TBP ARPE cell cultures that had accumulated approximately 10% tetraploidy (±5 weeks after sorting; Figure 5A , B ) and introduced a NT control shRNA and two independent shRNAs targeting CCNB3 (Figure 6D ). Having successfully prevented the induction of CCNB3 upon ADAR1 depletion we used the approach used in Figure 5A - B to monitor the accumulation of tetraploid TBP cells over time. It is noteworthy that depletion of Cyclin B3 in ADAR1-depleted cells did not affect the population doubling time of these cells (Figure 6E ). Consistent with previous results, ADAR1-depleted TBP ARPE cultures continued to accumulate tetraploid cells. However, preventing CCNB3 upregulation by shRNA suppressed the accumulation of tetraploid karyotypes upon ADAR1 depletion (Figure 6F , G). Collectively, these data indicate that ADARp150 depletion in TBP ARPE cells induced Cyclin B3 expression, resulting in mitotic failures and accumulation of tetraploid karyotypes.

$Tetraploidization in TBP ARPE cells upon ADARp150 depletion occurs through induction of Cyclin B3. (A) Expression levels of the major cyclins in TBP ARPE cells transduced with an ADAR1 shRNA reconstituted with pmGFP (vector only) or pmGFP-ADARp150 compared to TBP ARPE cells transduced with a NT shRNA, cultured as indicated. Data was obtained by total RNA sequencing. Color indicates the log2-fold change. (B) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test) (***P-value 0.0001) (C) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. (D) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test) (****P-value < 0.0001). (E) Population doublings (h) of indicated TBP ARPE cells grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent independent measurements. Error bars indicate standard deviation. (F) Upper plot represents the DNA content (DAPI) of diploid sorted G1 TBP ARPE cells transduced with an ADAR1 shRNA that accumulated 10% tetraploidy. These cells were used to transduce a non-targeting (NT) shRNA (blue; left lower column) or CCNB3 shRNA (red; right lower column) cultured over time (rows; days post-transduction). Percentages represent the fraction of G1 cells with 2n (left) or >2n (right) DNA content. (G) Percentage of TBP ARPE cells in G1 phase transduced with an ADAR1 shRNA (blue), ADAR1 shRNA + non-targeting (NT) shRNA (blue) or an ADAR1 shRNA + CCNB3 shRNA (red) with a DNA content >2n cultured over time (weeks) based on the method described in Figure 2C. Cultures were measured on FACS bi-weekly and passed in unperturbed culturing conditions (+10% FCS).$

Tetraploidization in TBP ARPE cells upon ADARp150 depletion occurs through induction of Cyclin B3. ( A ) Expression levels of the major cyclins in TBP ARPE cells transduced with an ADAR1 shRNA reconstituted with pmGFP (vector only) or pmGFP-ADARp150 compared to TBP ARPE cells transduced with a NT shRNA, cultured as indicated. Data was obtained by total RNA sequencing. Color indicates the log 2 -fold change. ( B ) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test) (*** P -value 0.0001) ( C ) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. ( D ) Relative CCNB3 expression levels of indicated TBP ARPE cells obtained using RT-PCR. Dots represent independent primer pairs specific for CCNB3 cDNA. Asterisks represent adjusted p-value of a two-sided one-way ANOVA test (Šidák multiple comparison test) (**** P -value < 0.0001). ( E ) Population doublings (h) of indicated TBP ARPE cells grown in unperturbed culturing conditions (+10% FCS) and passed before reaching confluency. Dots represent independent measurements. Error bars indicate standard deviation. ( F ) Upper plot represents the DNA content (DAPI) of diploid sorted G1 TBP ARPE cells transduced with an ADAR1 shRNA that accumulated 10% tetraploidy. These cells were used to transduce a non-targeting (NT) shRNA (blue; left lower column) or CCNB3 shRNA (red; right lower column) cultured over time (rows; days post-transduction). Percentages represent the fraction of G1 cells with 2 n (left) or >2 n (right) DNA content. ( G ) Percentage of TBP ARPE cells in G1 phase transduced with an ADAR1 shRNA (blue), ADAR1 shRNA + non-targeting (NT) shRNA (blue) or an ADAR1 shRNA + CCNB3 shRNA (red) with a DNA content >2 n cultured over time (weeks) based on the method described in Figure 2C . Cultures were measured on FACS bi-weekly and passed in unperturbed culturing conditions (+10% FCS).

Relevance of ADAR1 depletion and WGD for tumor growth in vivo

During tumor evolution, the (transient) lack of blood supply to provide sufficient nutrients and oxygen may reflect the non-permissive culturing conditions that we used in vitro . Likewise, the microenvironment of G1/S-checkpoint-defective incipient tumor cells may cause unscheduled S-phase entry and DNA replication stress. In this scenario, tetraploidy and ADAR1 depletion would hamper tumor growth of TBP cells. To test this hypothesis, we injected diploid- and tetraploid-sorted TBP ARPE cells with or without stable ADAR1 knockdown under the skin of immune-compromised NMRI mice, which lack T-cells, and monitored tumor outgrowth over time. Diploid TBP ARPE reached the ethically tolerated tumor size of 1.5 cm 3 relatively fast, on average after 21 weeks (Figure 7A , upper panel left). In agreement with their in vitro behavior in non-permissive culturing conditions, tetraploid-sorted cells showed delayed tumor outgrowth, reaching the maximally tolerated size after on average 28 weeks (Figure 7A , lower panel left) and thus extending survival (Figure 7B ). ADAR1 knockdown in both tetraploid-sorted and diploid-sorted TBP ARPE cells delayed tumor growth, taking on average 35 weeks and 33 weeks, respectively, to reach the maximum size (Figure 7A , lower panel right, upper panel right, Figure 7B ). The latter seems in contrast to our serum starvation experiments in vitro where ADAR1 depletion did not affect mitogen-independent proliferation of diploid cells (Figure 4C ). However, the in vitro experiments shown in Figure 4C were short term (2 weeks), while upon long-term culturing of diploid ADAR1 knockdown TBP cells, tetraploid cells started to accumulate only after approximately 6 weeks (Figure 5A , B). We therefore envisage that also in vivo ADAR1 depletion caused tetraploidization and that selective pressure against genome-duplicated cells retarded tumor growth. To test this possibility, we cultured all tumor material ex vivo for 2–4 days in the presence of mitogens and, taking advantage of the presence of FUCCI constructs in the injected cells, measured the DNA content in G1 cells by flow cytometry as explained in Figure 2 . As expected, ADAR1-proficient diploid cells remained diploid (Figure 7C , light grey bars). ADAR1-depleted diploid tumors showed variable levels of tetraploid karyotypes, in one case almost reaching 50% (Figure 7C , left panel). The fraction of tetraploid cells in tumors originating from ADAR1-proficient tetraploid-sorted cultures showed a variable but clear reduction, while tetraploidy was almost lost when ADAR1 was depleted (Figure 7C , right panel). These results show that tetraploidization not only conferred a proliferative impediment to TBP cells cultured in serum-deprived conditions in vitro but also when grown as tumors in vivo . The absence of ADAR1 may aggravate this proliferative defect likely because of on-going polyploidization leading to chromosome abundance incompatible with proliferation.

In vivo relevance of ADAR1 depletion and whole genome duplication. ( A ) Individual growth curves of diploid and tetraploid TBP ARPE cells with normal (NT) or reduced ADAR1 expression ( ADAR1 shRNA) injected under the skin of NMRI mice (5 animals per cell line). Dashed line indicates the maximally tolerated tumor size. ( B ) Kaplan–Meier survival curves of mice injected with the indicated cells. Asterisk indicates P -value. Significance levels in comparison to Diploid NT shRNA: Diploid ADAR1 shRNA * P -value = 0.0177, Tetraploid NT shRNA * P -value = 0.0222, Tetraploid ADAR1 shRNA ** P -value 0.0045). ( C ) Percentages of diploid- or tetraploid-sorted TBP ARPE cells with a DNA content larger than 2 n before injection (pre-injection) and after tumor growth in vivo and brief culturing ex vivo ( ex vivo tumors). Grey bars indicate cells with normal ADAR1 expression; blue bars cells with ADAR1 knockdown.

In this study we identified an unexpected consequence of ADAR1 depletion: whole genome duplication. We demonstrated that both the catalytic- and Zα domain of ADARp150 are essential to prevent tetraploidization. Absence of functional ADARp150 induced expression of Cyclin B3 which was causative for an increased frequency of mitotic catastrophe and the accumulation of tetraploid cells. We identified this mitotic requirement for ADARp150 in G1/S-checkpoint defective, apoptosis-resistant, p53 defective cells (TBP cells), cultured in the absence of mitogens and suffering from DNA replication stress. However, also in growth-promoting conditions ADAR1-depleted TBP cells accumulated to near-complete tetraploidy, without showing a discernable proliferative defect. In contrast, in growth-restricting conditions, tetraploidy arising from ADARp150 depletion severely hindered proliferation. But why is division of tetraploid cells hindered in mitogen-deprived conditions, i.e. under conditions of perturbed DNA replication? We envisage that mitogen-deprived cells with higher DNA content may suffer more from replication-induced DNA damage, e.g . because of a higher chance of mitotic catastrophe. This may explain the reduced colony formation of mitogen-deprived, ADAR1-proficient TBP ARPE cells shown in Figure 4C . This effect may be exacerbated by high Cyclin B3 activity in the absence of ADAR1 that could prematurely drive cells with damaged DNA into catastrophic M-phase.

In several isogenic cell lines, ADAR1 deficiency only yielded tetraploid karyotypes upon concomitant p53 inactivation. Presumably, p53 activation by WGD itself or certain types of DNA damage that may promote WGD, results in cell cycle arrest or apoptosis, thereby preventing the accumulation of tetraploid cells ( 37 , 38 ). The requirement for p53 deficiency could explain why a mitotic role of ADAR1 has been underappreciated, albeit not fully ignored.

Earlier studies have found a link between ADAR1 and mitotic progression ( 7 , 39 , 40 ). Shiromoto et al. observed an increase in mitotic abnormalities such as the formation of micro- and multi-nuclei and anaphase bridges upon ADAR1 depletion in HeLa cells, which was associated with an accumulation of R-loops at telomeres due to shortage of ADARp110 activity ( 7 ). In contrast, the mitotic defects in ADAR1-depleted cells we describe here appeared to result from an aberrant induction of Cyclin B3, which was abolished upon re-introduction of ADARp150. None of the other A-, B-, D- or E-type cyclins was induced. B-type cyclins are critical regulators of mitotic entry and are degraded in a timely manner during mitosis ( 41 ). Cyclin B1 is mainly localized in the cytoplasm during interphase and translocates to the nucleus during prophase to promote nuclear envelope breakdown and mitotic entry ( 42 , 43 ). Inactivation of the spindle assembly checkpoint leads to activation of APC/C CDC20 which targets Cyclin B1 for proteolytic destruction at anaphase onset ( 44 ). Cyclin B3 is a late degrading B-type cyclin and is degraded during anaphase ( 35 ). Studies have proposed that Cyclin B3 promotes APC/C CDC20 activity and anaphase initiation ( 33 , 34 ). Aberrant induction of Cyclin B3 could disturb the metaphase to anaphase transition and mitotic exit thus causing the mitotic failures that we observed upon ADARp150 depletion. Indeed, expression of a non-degradable form of Cyclin B3 has been shown to induce mitotic arrest late in anaphase ( 36 ). How ADARp150 affects Cyclin B3 expression and whether this occurs in a particular cell cycle phase remains an open question.

A role of ADARp150 in suppressing IFN signaling in response to endogenous transcripts has been well established ( 45–49 ). Somewhat unexpectedly, we did not observe increased IFN signaling upon ADARp150 depletion. In fact, total RNA sequencing indicated that IFN signaling was reduced upon ADAR1 knockdown. Possibly, TBP ARPE cells have an impairment in IFN signaling, which is supported by the marginal induction of IFNAR1 expression upon treatment with the immunostimulant poly(IC) ( Supplementary Figure S2B ). Alternatively, ADAR1 knockdown may force a new, attenuated level of IFN signaling. Anyway, the lack of IFN signaling upon ADAR1 depletion in the TBP cells we used may have allowed us to find the mitotic defect that underlies ADAR1 dependency of mitogen-starved TBP cells.

ADARp150 depletion and the resulting tetraploidy also significantly delayed tumor outgrowth in vivo . The inability of tetraploid cells to proliferate in vivo as well as in non-permissive culturing conditions in vitro is suggestive for a non-permissive microenvironment that impacts tumor outgrowth. While such environment may be transient and differ spatially within tumors depending on the vascularization, several studies have provided evidence for a growth-inhibiting tumor microenvironment ( 50 , 51 ).

ADAR1 has been proposed as a therapeutic target to enhance the efficacy of immunotherapy ( 52–55 ). Collectively, these studies showed that ablation of ADAR1 results in activation of pattern recognition receptors, thereby activating IFN signaling. The whole genome duplications that we observed upon ADAR1 depletion represent another layer of ADAR1 biology. The relevance of our results for AGS biology and ADAR1 as a target for immunotherapy remains to be determined. ADAR1 has been found overexpressed in several tumor types ( 29 , 56 , 57 ). This has been mostly attributed to the canonical function of ADAR1 as a negative regulator of IFN signaling. Our studies provide another perspective, preventing whole genome duplication.

Raw and normalized read-counts of the RNA-sequencing experiment have been deposited in GEO ( https://www.ncbi.nlm.nih.gov/geo/ ) under accession number GSE262277.

Supplementary Data are available at NAR Online.

We thank members of the Animal Facility, Bioimaging Facility, Flow Cytometry Facility and Genomics Core Facility of the Netherlands Cancer Institute for expert technical support, Dr Job de Lange for providing ARPE cells, members of the Te Riele and Jacobs groups, in particular Iris Glykofridis, Marleen Dekker and Bente Benedict for helpful discussions.

Dutch Cancer Society/KWF Kankerbestrijding [11074]; Netherlands Cancer Institute. Funding for open access charge: Dutch Cancer Society/KWF Kankerbestrijding.

Conflict of interest statement . None declared.

Hanahan D. , Weinberg R.A. Hallmarks of cancer: the next generation . Cell . 2011 ; 144 : 646 – 674 .

Google Scholar

Benedict B. , van Harn T. , Dekker M. , Hermsen S. , Kucukosmanoglu A. , Pieters W. , Delzenne-Goette E. , Dorsman J.C. , Petermann E. , Foijer F. , Te Riele H. Loss of P53 suppresses replication-stress-induced DNA breakage in G1/S checkpoint deficient cells . eLife . 2018 ; 7 : e37868 .

Foijer F. , Wolthuis R.M. , Doodeman V. , Medema R.H. , te Riele H. Mitogen requirement for cell cycle progression in the absence of pocket protein activity . Cancer Cell . 2005 ; 8 : 455 – 466 .

Benedict B. , van Bueren M.A. , van Gemert F.P. , Lieftink C. , Guerrero Llobet S. , van Vugt M.A. , Beijersbergen R.L. , Te Riele H. The RECQL helicase prevents replication fork collapse during replication stress . Life Sci. Alliance . 2020 ; 3 : e202000668 .

Levanon E.Y. , Eisenberg E. , Yelin R. , Nemzer S. , Hallegger M. , Shemesh R. , Fligelman Z.Y. , Shoshan A. , Pollock S.R. , Sztybel D. et al. . Systematic identification of abundant A-to-I editing sites in the Human transcriptome . Nat. Biotechnol. 2004 ; 22 : 1001 – 1005 .

de Reuver R. , Dierick E. , Wiernicki B. , Staes K. , Seys L. , De Meester E. , Muyldermans T. , Botzki A. , Lambrecht B.N. , Van Nieuwerburgh F. et al. . ADAR1 Interaction with Z-RNA promotes editing of endogenous double-stranded RNA and prevents MDA5-dependent immune activation . Cell Rep. 2021 ; 36 : 109500 .

Shiromoto Y. , Sakurai M. , Minakuchi M. , Ariyoshi K. , Nishikura K. ADAR1 RNA editing enzyme regulates R-loop formation and genome stability at telomeres in cancer cells . Nat. Commun. 2021 ; 12 : 1654 .

Rehwinkel J. , Gack M.U. RIG-I-like receptors: their regulation and roles in RNA sensing . Nat. Rev. Immunol. 2020 ; 20 : 537 – 551 .

Maurano M. , Snyder J.M. , Connelly C. , Henao-Mejia J. , Sidrauski C. , Stetson D.B. Protein kinase R and the integrated stress response drive immunopathology caused by mutations in the RNA deaminase ADAR1 . Immunity . 2021 ; 54 : 1948 – 1960 .

Benedict B. , van Schie J.J.M. , Oostra A.B. , Balk J.A. , Wolthuis R.M.F. , Riele H.T. , de Lange J. WAPL-dependent repair of damaged DNA replication forks underlies oncogene-induced loss of sister chromatid cohesion . Dev. Cell . 2020 ; 52 : 683 – 698 .

Doench J.G. , Fusi N. , Sullender M. , Hegde M. , Vaimberg E.W. , Donovan K.F. , Smith I. , Tothova Z. , Wilen C. , Orchard R. et al. . Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 . Nat. Biotechnol. 2016 ; 34 : 184 – 191 .

Olive P.L. , Banath J.P. The comet assay: a method to measure DNA damage in individual cells . Nat. Protoc. 2006 ; 1 : 23 – 29 .

Jackson D.A. , Pombo A. Replicon clusters are stable units of chromosome structure: evidence that nuclear organization contributes to the efficient activation and propagation of S phase in Human cells . J. Cell Biol. 1998 ; 140 : 1285 – 1295 .

Love M.I. , Huber W. , Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol. 2014 ; 15 : 550 .

Krämer A. , Green J. , Pollard J. Jr , Tugendreich S. Causal analysis approaches in ingenuity pathway analysis . Bioinformatics . 2014 ; 30 : 523 – 530 .

Blomberg O.S. , Spagnuolo L. , Garner H. , Voorwerk L. , Isaeva O.I. , van Dyk E. , Bakker N. , Chalabi M. , Klaver C. , Duijst M. et al. . IL-5-producing CD4(+) T cells and eosinophils cooperate to enhance response to immune checkpoint blockade in breast cancer . Cancer Cell . 2023 ; 41 : 106 – 123 .

Jimeno S. , Prados-Carvajal R. , Fernandez-Avila M.J. , Silva S. , Silvestris D.A. , Endara-Coll M. , Rodriguez-Real G. , Domingo-Prim J. , Mejias-Navarro F. , Romero-Franco A. et al. . ADAR-mediated RNA editing of DNA:RNA hybrids is required for DNA double strand break repair . Nat. Commun. 2021 ; 12 : 5512 .

Kim J.I. , Nakahama T. , Yamasaki R. , Costa Cruz P.H. , Vongpipatana T. , Inoue M. , Kanou N. , Xing Y. , Todo H. , Shibuya T. et al. . RNA editing at a limited number of sites is sufficient to prevent MDA5 activation in the mouse brain . PLoS Genet. 2021 ; 17 : e1009516 .

Crow Y.J. , Chase D.S. , Lowenstein Schmidt J. , Szynkiewicz M. , Forte G.M. , Gornall H.L. , Oojageer A. , Anderson B. , Pizzino A. , Helman G. et al. . Characterization of Human disease phenotypes associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR, and IFIH1 . Am. J. Med. Genet. A . 2015 ; 167A : 296 – 312 .

Rice G.I. , Kasher P.R. , Forte G.M.A. , Mannion N.M. , Greenwood S.M. , Szynkiewicz M. , Dickerson J.E. , Bhaskar S.S. , Zampini M. , Briggs T.A. et al. . Mutations in ADAR1 cause Aicardi-Goutières syndrome associated with a type I interferon signature . Nat. Genet. 2012 ; 44 : 1243 – 1248 .

Jiao H. , Wachsmuth L. , Wolf S. , Lohmann J. , Nagata M. , Kaya G.G. , Oikonomou N. , Kondylis V. , Rogg M. , Diebold M. et al. . ADAR1 Averts fatal type I interferon induction by ZBP1 . Nature . 2022 ; 607 : 776 – 783 .

Minton K. ZBP1 Induces immunopathology caused by loss of ADAR1-mediated RNA editing . Nat. Rev. Immunol. 2022 ; 22 : 531 .

Hubbard N.W. , Ames J.M. , Maurano M. , Chu L.H. , Somfleth K.Y. , Gokhale N.S. , Werner M. , Snyder J.M. , Lichauco K. , Savan R. et al. . ADAR1 Mutation causes ZBP1-dependent immunopathology . Nature . 2022 ; 607 : 769 – 775 .

de Reuver R. , Verdonck S. , Dierick E. , Nemegeer J. , Hessmann E. , Ahmad S. , Jans M. , Blancke G. , Van Nieuwerburgh F. , Botzki A. et al. . ADAR1 Prevents autoinflammation by suppressing spontaneous ZBP1 activation . Nature . 2022 ; 607 : 784 – 789 .

Zielke N. , Edgar B.A. FUCCI sensors: powerful new tools for analysis of cell proliferation . WIREs Dev. Biol. 2015 ; 4 : 469 – 487 .

Gemble S. , Wardenaar R. , Keuper K. , Srivastava N. , Nano M. , Mace A.S. , Tijhuis A.E. , Bernhard S.V. , Spierings D.C.J. , Simon A. et al. . Genetic instability from a single S phase after whole-genome duplication . Nature . 2022 ; 604 : 146 – 151 .

Baker A.R. , Miliotis C. , Ramirez-Moya J. , Marc T. , Vlachos I.S. , Santisteban P. , Slack F.J. Transcriptome profiling of ADAR1 targets in triple-negative breast cancer cells reveals mechanisms for regulating growth and invasion . Mol. Cancer Res. 2022 ; 20 : 960 – 971 .

Szymczak F. , Cohen-Fultheim R. , Thomaidou S. , de Brachene A.C. , Castela A. , Colli M. , Marchetti P. , Levanon E. , Eizirik D. , Zaldumbide A. ADAR1-Dependent editing regulates Human beta cell transcriptome diversity during inflammation . Front. Endocrinol. (Lausanne) . 2022 ; 13 : 1058345 .

Sagredo E.A. , Sagredo A.I. , Blanco A. , Rojas De Santiago P. , Rivas S. , Assar R. , Perez P. , Marcelain K. , Armisen R. ADAR1 Transcriptome editing promotes breast cancer progression through the regulation of cell cycle and DNA damage response . Biochim. Biophys. Acta. Mol. Cell Res. 2020 ; 1867 : 118716 .

Lara-Gonzalez P. , Moyle M.W. , Budrewicz J. , Mendoza-Lopez J. , Oegema K. , Desai A. The G2-to-M transition is ensured by a dual mechanism that protects cyclin B from degradation by Cdc20-activated APC/C . Dev. Cell . 2019 ; 51 : 313 – 325 .

Clute P. , Pines J. Temporal and spatial control of Cyclin B1 destruction in Metaphase . Nat. Cell Biol. 1999 ; 1 : 82 – 87 .

Lindqvist A. , Zon W.v. , Rosenthal C.K. , Wolthuis R.M.F. Cyclin B1–Cdk1 activation continues after centrosome separation to control mitotic progression . PLoS Biol. 2007 ; 5 : e123 .

Garrido D. , Bourouh M. , Bonneil É. , Thibault P. , Swan A. , Archambault V. Cyclin B3 activates the anaphase-promoting complex/cyclosome in meiosis and mitosis . PLoS Genet. 2020 ; 16 : e1009184 .

Li Y. , Wang L. , Zhang L. , He Z. , Feng G. , Sun H. , Wang J. , Li Z. , Liu C. , Han J. et al. . Cyclin B3 is required for metaphase to anaphase transition in oocyte meiosis I . J. Cell Biol. 2019 ; 218 : 1553 – 1563 .

Yuan K. , O’Farrell P.H. Cyclin B3 is a mitotic Cyclin that promotes the metaphase-anaphase transition . Curr. Biol. 2015 ; 25 : 811 – 816 .

Nguyen T.B. , Manova K. , Capodieci P. , Lindon C. , Bottega S. , Wang X.-Y. , Refik-Rogers J. , Pines J. , Wolgemuth D.J. , Koff A. Characterization and expression of mammalian cyclin B3, a prepachytene meiotic cyclin * . J. Biol. Chem. 2002 ; 277 : 41960 – 41969 .

Bielski C.M. , Zehir A. , Penson A.V. , Donoghue M.T.A. , Chatila W. , Armenia J. , Chang M.T. , Schram A.M. , Jonsson P. , Bandlamudi C. et al. . Genome doubling shapes the evolution and prognosis of advanced cancers . Nat. Genet. 2018 ; 50 : 1189 – 1195 .

Andreassen P.R. , Lohez O.D. , Lacroix F.B. , Margolis R.L. Tetraploid State induces P53-dependent arrest of nontransformed mammalian cells in G1 . Mol. Biol. Cell . 2001 ; 12 : 1315 – 1328 .

Kim J.S. , He X. , Liu J. , Duan Z. , Kim T. , Gerard J. , Kim B. , Pillai M.M. , Lane W.S. , Noble W.S. et al. . Systematic proteomics of endogenous Human cohesin reveals an interaction with diverse splicing factors and RNA-binding proteins required for mitotic progression . J. Biol. Chem. 2019 ; 294 : 8760 – 8772 .

Schweidenback C.T. , Emerman A.B. , Jambhekar A. , Blower M.D. Evidence for multiple, distinct ADAR-containing complexes in Xenopus Laevis . RNA . 2015 ; 21 : 279 – 295 .

Chang D.C. , Xu N. , Luo K.Q. Degradation of cyclin B is required for the onset of anaphase in mammalian cells . J. Biol. Chem. 2003 ; 278 : 37865 – 37873 .

Müllers E. , Silva Cascales H. , Jaiswal H. , Saurin A.T. , Lindqvist A. Nuclear translocation of cyclin B1 marks the restriction point for terminal cell cycle exit in G2 phase . Cell Cycle . 2014 ; 13 : 2733 – 2743 .

Krenning L. , Feringa F.M. , Shaltiel I.A. , van den Berg J. , Medema R.H. Transient activation of P53 in G2 phase is sufficient to induce senescence . Mol. Cell . 2014 ; 55 : 59 – 72 .

Hayward D. , Alfonso-Pérez T. , Gruneberg U. Orchestration of the spindle assembly checkpoint by CDK1-cyclin B1 . FEBS Lett. 2019 ; 593 : 2889 – 2907 .

Hartner J.C. , Walkley C.R. , Lu J. , Orkin S.H. ADAR1 Is essential for the maintenance of hematopoiesis and suppression of interferon signaling . Nat. Immunol. 2009 ; 10 : 109 – 115 .

Stok J.E. , Vega Quiroz M.E. , van der Veen A.G. Self RNA sensing by RIG-I-like receptors in viral infection and sterile inflammation . J. Immunol. 2020 ; 205 : 883 – 891 .

Eisenberg E. , Levanon E.Y. A-to-I RNA editing - immune protector and transcriptome diversifier . Nat. Rev. Genet. 2018 ; 19 : 473 – 490 .

Stok J.E. , Oosenbrug T. , Ter Haar L.R. , Gravekamp D. , Bromley C.P. , Zelenay S. , Reis e Sousa C. , van der Veen A.G. RNA sensing via the RIG-I-like receptor LGP2 is essential for the induction of a type I IFN response in ADAR1 deficiency . EMBO J. 2022 ; 41 : e109760 .

Ahmad S. , Mu X. , Yang F. , Greenwald E. , Park J.W. , Jacob E. , Zhang C.-Z. , Hur S. Breaching self-tolerance to Alu duplex RNA underlies MDA5-mediated inflammation . Cell . 2018 ; 172 : 797 – 810 .

Vaziri-Gohar A. , Cassel J. , Mohammed F.S. , Zarei M. , Hue J.J. , Hajihassani O. , Graor H.J. , Srikanth Y.V.V. , Karim S.A. , Abbas A. et al. . Limited nutrient availability in the tumor microenvironment renders pancreatic tumors sensitive to allosteric IDH1 inhibitors . Nat Cancer . 2022 ; 3 : 852 – 865 .

Helmlinger G. , Yuan F. , Dellian M. , Jain R.K. Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation . Nat. Med. 1997 ; 3 : 177 – 182 .

Zhang T. , Yin C. , Fedorov A. , Qiao L. , Bao H. , Beknazarov N. , Wang S. , Gautam A. , Williams R.M. , Crawford J.C. et al. . ADAR1 Masks the cancer immunotherapeutic promise of ZBP1-driven necroptosis . Nature . 2022 ; 606 : 594 – 602 .

Liu H. , Golji J. , Brodeur L.K. , Chung F.S. , Chen J.T. , deBeaumont R.S. , Bullock C.P. , Jones M.D. , Kerr G. , Li L. et al. . Tumor-derived IFN triggers chronic pathway agonism and sensitivity to ADAR loss . Nat. Med. 2019 ; 25 : 95 – 102 .

Mehdipour P. , Marhon S.A. , Ettayebi I. , Chakravarthy A. , Hosseini A. , Wang Y. , de Castro F.A. , Loo Yau H. , Ishak C. , Abelson S. et al. . Epigenetic therapy induces transcription of inverted SINEs and ADAR1 dependency . Nature . 2020 ; 588 : 169 – 173 .

Gannon H.S. , Zou T. , Kiessling M.K. , Gao G.F. , Cai D. , Choi P.S. , Ivan A.P. , Buchumenski I. , Berger A.C. , Goldstein J.T. et al. . Identification of ADAR1 adenosine deaminase dependency in a subset of cancer cells . Nat. Commun. 2018 ; 9 : 5450 .

Sharpnack M.F. , Chen B. , Aran D. , Kosti I. , Sharpnack D.D. , Carbone D.P. , Mallick P. , Huang K. Global transcriptome analysis of RNA abundance regulation by ADAR in lung adenocarcinoma . EBioMedicine . 2018 ; 27 : 167 – 175 .

Jiang Q. , Crews L.A. , Barrett C.L. , Chun H.J. , Court A.C. , Isquith J.M. , Zipeto M.A. , Goff D.J. , Minden M. , Sadarangani A. et al. . ADAR1 promotes malignant progenitor reprogramming in chronic myeloid leukemia . Proc. Natl. Acad. Sci. U.S.A. 2013 ; 110 : 1041 – 1046 .

Email alerts

Citing articles via.

Editorial Board

Affiliations

Online ISSN 1362-4962
Print ISSN 0305-1048
About Oxford Academic
Publish journals with us
University press partners
What we publish
New features
Open access
Institutional account management
Rights and permissions
Get help with access
Accessibility
Advertising
Media enquiries
Oxford University Press
Oxford Languages
University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

Cookie settings
Cookie policy
Privacy policy
Legal notice

This Feature Is Available To Subscribers Only

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

IMAGES

I was doing some 1.4.4 painting hunting, and found a tribute to a
Duplication by unequal crossing over. This conventional view of
what is difference between duplication and replication
What It Is & How It Works
Duplication
Duplication matrix S ∈ R τ(I −τ +1)×I . In the case where there are I

COMMENTS

What does it mean when items say, "research 1 more to duplicate"?
You only need one of it to duplicate it. You're playing in journey mode. If you hit "c" and go to the research tab (the gears), you can drag items to the empty box and research the item. This destroys the item. When fully researched (depending on how many it's telling you you need) you can then go to the duplication tab (the yellow/blue/red ...
How to research and duplicate items in Terraria
Screengrab via Terraria. When the research menu is open, just drop an item into the empty box and hit "Research.". The item will be consumed during the process, but if you have researched ...
How to Research and Duplicate Items in Terraria 1.4 Journey Mode
To duplicate items in Journey mode you must first gather enough of the item you wish to duplicate so you can complete its research. Both of these options can be found under the Power Menu on the inventory screen. To make the process clearer here's an example for you: Find/Build 100 Torches. Place Torches in Research (requires 100).
Research completion :: Terraria General Discussions
I think the presence of the message "Research # more to unlock duplication" serves as an adequate indication of whether an item has already been researched - however a list of what's remaining to be discovered would be useful. #3. AngeLiq. May 25, 2020 @ 2:39pm lets hope some dude over in the modding community fulfills this for us (or relogic ...
How to use Journey Mode's Research and Duplication and still play
Once you have researched them, you have to buy them back. The sell price of items in Terraria is 1/5 of the buying price. This means you can multiply the sell price that you can see by 5 to get what the buying price would be. I trash the gold required to buy the item, and then take it out of the duplication menu.
Journey Mode/Research list
Discussions are now available on the Terraria Wiki.; Miss the old Hydra Skin? Try out our Hydralize gadget! Visit the preferences page while logged in and turn on the gadget.
Game Mechanics
1: making shift-rightclick insert one of an item into your inventory (similar to how right click allows you to get 1 of an item and shift-click allows you to get a stack inserted in your inventory) 2: adding a "clear all researched" and "restock" buttons to the duplication menu. the restock option would work exactly like the restock option does ...
How to duplicate items in Terraria 1.4
Every item will have different amounts needed to research. Consumables typically need 100 items, whereas accessories and weapons only need 1. Server duplication glitch. The classic server duplication glitch isn't unique to just Terraria. It involves exploiting a server and autosave to duplicate any items you loaded in with.
Duplication
Duplication (also known as duping) is a process by which the player creates multiple copies of an item using an exploit or glitch. Using any of these methods may rapidly make the game less enjoyable and can possibly corrupt the game if it is overused— use these methods at your own risk. Many players of Terraria do not support duplication when playing single player but will use it for PvP ...
Make the "Research X to unlock duplication" text appear anywhere
View community ranking In the Top 1% of largest communities on Reddit. Make the "Research X to unlock duplication" text appear anywhere instead of only the inventory/storage/shops . Quality of life to more easily tell if you have or haven't researched something already, especially when browsing through crafting. ...
How to Duplicate in Terraria
Open the Modded Terraria Server with Scalacube. Then, join a server. Make a chest and fill it with the items you want to duplicate. Type "save" into the server panel. Go to the chest and take the stuff after it has finished saving. Cut your connection to the server. Enter "exit-nosave" into the server terminal.
[Mod] Research N' Duplication [rnd]
Inspired directly by Terraria's recent 1.4 update, this mod offers an "earned creative" mode to survival players. When active, you can use a specific amount of an item for research. Once an item is fully researched, it is permanently unlocked in the duplication menu, letting you create an infinite amount of that item.
How to research and duplicate items in Terraria
To duplicate an item, click on the icon with the three colored blocks above the research power menu. This will give you access to an inventory menu with all of the items you can duplicate. This menu also features a search bar to make things easier once you have filled the menu in the late game. Just click and drag any item from the duplication ...
Steam Workshop::Upgraded Research
Description. Upgraded Research is a mod that aims to make the Research system from Journey mode better to use, with several useful functions ported from my "Research from 1.4" mod. It adds: - Auto-craft research, so as long as you research an item and a crafting station, you will learn all items possible to craft with that crafting station and ...
Journey Mode
Even with a powerful fishing rod and the crate potion, that's a lot to ask. I'm fishing in Journey Mode, and to me it feels like it takes too many crates to unlock duplication. 10 crates to duplicate any given crate. I've already gotten the wooden/iron/gold crates done, but maybe knock the biome-specific crates down to 3 or 5 to duplicate?
Research N' Duplicate
Once an item is fully researched, it is permanently unlocked in the duplication menu, letting you create an infinite amount of that item. You can choose how to fill out your duplication menu and only see types of items you actually use, but more importantly, you have to play the game in a somewhat normal fasion in order to unlock duplication.
Researching doesn't unlock duplication : r/Terraria
View community ranking In the Top 1% of largest communities on Reddit Researching doesn't unlock duplication When I research the required amount of items (such as 100 wood) it doesn't unlock duplicating for said item.
Research 1 Helm Trait to Unlock
Yes. To craft a set item, you need to research a specific number of traits on it first (doesn't matter which ones). The requirements for every set are different, ranging from 2 to 8. Seducer needs 3. Imperial Trading Company (PC EU) #2. AngryWolf.
Dear Re-Logic, trying to unlock duplication of every item in
Dear Re-Logic, trying to unlock duplication of every item in Terraria is an amazing meta-game, but is almost impossible without better organization of the item dupe menu. Having more tabs for specific categories as well as a progress bar (like the bestiary) would be a godsend!
Research? :: RimWorld General Discussions
Looked on the WIKI but its not listed what research needs to be completed in order to unlock the MEAT HOOK? ... Looked on the WIKI but its not listed what research needs to be completed in order to unlock the MEAT HOOK? < > Showing 1-2 of 2 comments ... More discussions. 6 no option to add the black hive faction midgame (alpha animals) ...
ADARp150 counteracts whole genome duplication
After fixation using 3:1 methanol:glacial acetic acid slides were incubated in 2.5 M HCl for 1 h and 15 min. Rat-anti-BrdU (Novus Cat# NB 500-169, RRID: AB_341913, 1:500) and mouse-anti-BrdU (BD Biosciences Cat# 340649, RRID: AB_400443, 1:750) were used to detect CldU and IdU, respectively. After washing, the primary antibodies were fixed using ...

How to research and duplicate items in Terraria

How to Research and Duplicate Items in Terraria 1.4 Journey Mode

How do You Research and Duplicate Items

Thoughts on our how to Research and Duplicate items in Terraria 1.4 Journey Mode guide? Drop them in The Pit below.

6 responses

Leave a Reply Cancel reply

Terraria Wiki

Journey Mode/Research list

Game Mechanics Improved duplication/research quality-of-life

antrobot1234

justinbrick

Official Terrarian

How to duplicate items in Terraria 1.4

How to duplicate in Journey Mode

Server duplication glitch

Boulder glitch

Duplication

Duplication on Mobile [ ]

Chest Duplication [ ]

World Duplication [ ]

Two-Player Duplication [ ]

Single-Player Chest Duplication [ ]

Duplication on PC [ ]

Multiplayer [ ]

Multiplayer Optional [ ]

Ice Rod [ ]

Mechanisms [ ]

Liquid Duplication [ ]

Pumps Method [ ]

Blocks Method ( very simple ) [ ]

Infinite Water Shaft [ ]

"Doubler" Duplication [ ]

Duplication on the Console Version [ ]

Without Chests [ ]

Any Item [ ]

Magic Mirror [ ]

Gallery [ ]

Make Your Own Terraria Server

Method 1: Using a Modded Terraria Server

Method 2: Using the Research Power Menu

Method 3: Using a Local Server

Method 4: Using a Duplication Glitch

Method 5: Using Journey Mode

Final Thoughts

Game Server Hosting

Minecraft Hosting

Minetest Forums

[Mod] Research N' Duplication [rnd]

Re: [Mod] Research N' Duplication [rnd]

Who is online

How to research and duplicate items in Terraria

About the author

Davy Davison

More Stories by Davy Davison

Research N' Duplicate

The Elder Scrolls Online

Research 1 Helm Trait to Unlock

Get the Reddit app

Dear Re-Logic, trying to unlock duplication of every item in Terraria is an amazing meta-game, but is almost impossible without better organization of the item dupe menu. Having more tabs for specific categories as well as a progress bar (like the bestiary) would be a godsend!

Enter the 6-digit code from your authenticator app

Enter a 6-digit backup code

Reset your password

Check your inbox

Choose a Reddit account to continue

Article Contents

Generating cell lines

Cell culture

Flow cytometry

Chromosome spreads

Neutral comet assay

DNA fiber assay

Immunoblotting

RNA sequencing

Time-lapse microscopy

Ex vivo analysis of tumors

Statistical analysis

ADAR1 is critical for mitogen-independent proliferation

ADAR1 depletion does not aggravate DNA replication stress

ADARp150 is essential in mitogen-deprived conditions

ADAR1 depletion does not affect interferon signaling of TBP cells