- school Campus Bookshelves
- menu_book Bookshelves
- perm_media Learning Objects
- login Login
- how_to_reg Request Instructor Account
- hub Instructor Commons
Margin Size
- Download Page (PDF)
- Download Full Book (PDF)
- Periodic Table
- Physics Constants
- Scientific Calculator
- Reference & Cite
- Tools expand_more
- Readability
selected template will load here
This action is not available.
15.4: Critical Thinking Questions
- Last updated
- Save as PDF
- Page ID 115103
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)
( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\id}{\mathrm{id}}\)
\( \newcommand{\kernel}{\mathrm{null}\,}\)
\( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\)
\( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\)
\( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)
\( \newcommand{\vectorA}[1]{\vec{#1}} % arrow\)
\( \newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow\)
\( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vectorC}[1]{\textbf{#1}} \)
\( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)
\( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)
\( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)
Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this mRNA makes when it is translated?
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.
A fragment of bacterial DNA reads:
3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’
Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.
Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.
Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'
Explain how single nucleotide changes can have vastly different effects on protein function.
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGG U UAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Create higher-order questions on different levels of Bloom's Taxonomy.
Questgen is an online tool for generating higher-order reasoning questions automatically using advanced AI techniques.
A sophisticated AI to generate Higher-Order questions from any text in one click!
Questgen provides a simple one-click solution to generate quizzes that need reasoning and critical thinking skills. You can try out Questgen for free (No credit card needed!). Simply sign-up and you are good to go!
What is Bloom's Taxonomy?
Bloom's Taxonomy is a classification method to classify the learning objectives of students into different levels of complexity ranging from factual retrieval to critical thinking.
The different levels of Bloom's Taxonomy
This is the lowest level of the taxonomy. At this level, you are allowed to take in as much information as possible. It involves listening, reading, memorizing, etc. This level mostly involves the retrieval of factual information as a learning objective.
This level involves you placing these pieces of information into different classes and trying to find similarities, differences, and meeting points. The learning objectives here are comparing, contrasting, summarizing, exemplifying, the content, etc.
At this level, you use this categorized knowledge and try to apply it in your everyday life scenarios, relate it to recent happenings, etc. This helps solidify what you understand and its retention. You try to act out, display, relate, execute, etc.
At the analysis level, you organize, brainstorm, and differentiate all the gathered information while attributing to its results. This is where critical thinking gets involved.
At the evaluation level, you make a well-thought judgment or an interpretation of the information and results at your disposal. You evaluate or give thoughts on the statement, either for it or against it.
At the highest level of Bloom's Taxonomy, you have adequate knowledge of the particular concept and now you can create designs and solutions to the problems yourself.
How does Questgen help generate Higher Order Questions On Blooms Taxonomy?
Using Questgen, you can generate various types of quizzes using AI that cater to different levels of Bloom's Taxonomy in one click:
- Multiple Choice Questions
- True or False Questions
- Higher-Order Questions and Answers
Ready to try out Questgen for free?
It's just a click away!
Copyright © QuestgenAI, Inc. All rights reserved.
[email protected]
AI MCQ Generator
AI FAQ Generator
AI True or False Generator
AI Higher Order Question Generator
AI Fill-in-the-Blank Quiz Generator
AI Bloom's Taxonomy Quiz Generator
AI Bloom's Taxonomy MCQ Generator
AI Similar Question Generator
AI Multiple Answer MCQ Generator
AI Storybook Illustration Generator
AI Matching Quiz Generator
Website URL to Quiz Generator
PDF to Quiz Generator
Image to Quiz Generator
Practice Quizzes in Study Mode
Terms of Service
Privacy Policy
Comparisons
Questgen vs Quillionz
Questgen Features in Depth
Questgen FAQs
Export Formats
Export in AIKEN Format
Export in RESPONDUS Format
What is the Critical Thinking Test?
Critical thinking practice test, take a free practice critical thinking test, practice critical thinking test.
Updated November 16, 2023
The Critical Thinking Test is a comprehensive evaluation designed to assess individuals' cognitive capacities and analytical prowess.
This formal examination, often referred to as the critical thinking assessment, is a benchmark for those aiming to demonstrate their proficiency in discernment and problem-solving.
In addition, this evaluative tool meticulously gauges a range of skills, including logical reasoning, analytical thinking, and the ability to evaluate and synthesize information.
This article will embark on an exploration of the Critical Thinking Test, elucidating its intricacies and elucidating its paramount importance. We will dissect the essential skills it measures and clarify its significance in gauging one's intellectual aptitude.
We will examine examples of critical thinking questions, illuminating the challenging scenarios that candidates encounter prompting them to navigate the complexities of thought with finesse.
Before going ahead to take the critical thinking test, let's delve into the realm of preparation. This segment serves as a crucible for honing the skills assessed in the actual examination, offering candidates a chance to refine their analytical blades before facing the real challenge. Here are some skills that will help you with the critical thinking assessment: Logical Reasoning: The practice test meticulously evaluates your ability to deduce conclusions from given information, assess the validity of arguments, and recognize patterns in logic. Analytical Thinking: Prepare to dissect complex scenarios, identify key components, and synthesize information to draw insightful conclusions—a fundamental aspect of the critical thinking assessment. Problem-Solving Proficiency: Navigate through intricate problems that mirror real-world challenges, honing your capacity to approach issues systematically and derive effective solutions. What to Expect: The Critical Thinking Practice Test is crafted to mirror the format and complexity of the actual examination. Expect a series of scenarios, each accompanied by a set of questions that demand thoughtful analysis and logical deduction. These scenarios span diverse fields, from business and science to everyday scenarios, ensuring a comprehensive evaluation of your critical thinking skills. Examples of Critical Thinking Questions Scenario: In a business context, analyze the potential impacts of a proposed strategy on both short-term profitability and long-term sustainability. Question: What factors would you consider in determining the viability of the proposed strategy, and how might it affect the company's overall success? Scenario: Evaluate conflicting scientific studies on a pressing environmental issue.
Question: Identify the key methodologies and data points in each study. How would you reconcile the disparities to form an informed, unbiased conclusion?
Why Practice Matters
Engaging in the Critical Thinking Practice Test familiarizes you with the test format and cultivates a mindset geared towards agile and astute reasoning. This preparatory phase allows you to refine your cognitive toolkit, ensuring you approach the assessment with confidence and finesse.
We'll navigate through specific examples as we proceed, offering insights into effective strategies for tackling critical thinking questions. Prepare to embark on a journey of intellectual sharpening, where each practice question refines your analytical prowess for the challenges ahead.
This is a practice critical thinking test.
The test consists of three questions .
After you have answered all the questions, you will be shown the correct answers and given full explanations.
Make sure you read and fully understand each question before answering. Work quickly, but don't rush. You cannot afford to make mistakes on a real test .
If you get a question wrong, make sure you find out why and learn how to answer this type of question in the future.
Six friends are seated in a restaurant across a rectangular table. There are three chairs on each side. Adam and Dorky do not have anyone sitting to their right and Clyde and Benjamin do not have anyone sitting to their left. Adam and Benjamin are not sitting on the same side of the table.
If Ethan is not sitting next to Dorky, who is seated immediately to the left of Felix?
You might also be interested in these other PRT articles:
We use cookies to enhance our website for you. Proceed if you agree to this policy or learn more about it.
- Essay Database >
- Essays Samples >
- Essay Types >
- Critical Thinking Example
Genetics Critical Thinkings Samples For Students
72 samples of this type
During studying in college, you will surely have to compose a bunch of Critical Thinkings on Genetics. Lucky you if putting words together and transforming them into meaningful text comes easy to you; if it's not the case, you can save the day by finding a previously written Genetics Critical Thinking example and using it as a template to follow.
This is when you will certainly find WowEssays' free samples database extremely helpful as it includes numerous expertly written works on most various Genetics Critical Thinkings topics. Ideally, you should be able to find a piece that meets your requirements and use it as a template to develop your own Critical Thinking. Alternatively, our qualified essay writers can deliver you an original Genetics Critical Thinking model crafted from scratch according to your individual instructions.
Example Of Critical Thinking On Reduction Of Human Chorionic Gonadotropin Beta Subunit Expression By Modified U1
Good the pros of using genetically modified food critical thinking example, good critical thinking about critical analysis: induction of amphiregulin by p53 promotes apoptosis via control.
Don't waste your time searching for a sample.
Get your critical thinking done by professional writers!
Just from $10/page
The Nature And Nurture Debate Critical Thinking Sample
Hamiltons rule: analyzing altruism in competition amongst kin critical thinkings example, intelligence, race, and genetics critical thinking example, genetic tests: are they for you critical thinking example, the causes of criminal behavior critical thinking example, free critical thinking on biology questions, critical thinking on cancer, biology: testing in advance for genetic disease critical thinking examples, introduction, example of cancer critical thinking, the generation of ips cells from somatic cells critical thinking examples, compare and contrast on ips papers, critical thinking on ethical considerations in genetics and genomics, example of nanog method critical thinking, what are we eating a brief, objective analysis of food production and technology critical thinking sample, ethical considerations in genetics and genomics critical thinking, critical thinking on critique of alcohol addiction.
According to the American Medical Association (AMA), alcohol addiction or alcohol dependence is defined as a primary, chronic disease with psychological, genetic, and environmental factors influencing its manifestations and development.
Description
The article on polymorphism of the gene critical thinking examples.
The hypothesis of the research is brilliant in that the role played by genetic factors in peptic ulcer pathogenesis is not clearly understood. This is despite the fact that peptic ulcers have caused many deaths across the globe. However, the research background does not use past studies to indicate that there is a correlation between C3435T polymorphism of the ABCB1 gene and susceptibility to peptic ulcers. Therefore, the research background does not link well with the research hypothesis.
Wright R 1989 Biology Through The Eyes Of Faith New York Harperone Press Critical Thinking Examples
Reflection questions.
Question Number One:-
a) Sexual reproduction is defined as the formation of new organisms following the coming together of two independent gametes. Its main advantages includes the ability to produce wide ranging amounts of genetic diversity and ability to establish variable offspring’s that are different from the original parents, hence having high probability of survival in the changing environments . Other notable advantages include the ability to be reproduce offspring’s that develop from two parents ,hence reduced chances of inheriting deleterious mutations.
Critical thinking on Darwins Theory of Evolution
Example of benefits of genetic engineering versus the potential risks critical thinking, benefits of genetic engineering versus the potential risks.
Introduction and Benefits
Example Of Gattaca Critical Thinking
This paper gives a brief account of the contents of the movie Gattaca. The paper represents a critical analysis of eugenics and genetic engineering as related to the movie. However, the main issue comprehensively discussed is the dangers of such technologies if they were not restricted
Critical Thinking On Breast Cancer The Role Of Genetics
Good critical thinking on treatment vs. enhancement, good example of evaluation of conclusion critical thinking, applying counselling theory and skills to help clients understand information of uncertain significance gleaned from genomic data critical thinking template for faster writing, good critical analysis of a current event critical thinking example, india: genetically modified no more critical thinking, good example of genetic and genomic professional nursing competencies and outcomes indicators critical thinking, example of critical thinking on biology, human development:, distributive justice in healthcare for american substance abusers critical thinking samples.
(Student’s Full Name)
Values and Beliefs Critical Thinking
The theory of biological evolution critical thinking, example of turner syndrome critical thinking, darwin's legacy: variation, natural selection, and the perpetual struggle for existence critical thinking example, critical thinking on philosophy, good critical thinking about technological advances, environmental stress critical thinking to use for practical writing help, borderline personality disorder critical thinking samples, sociology of health, illness, & health care critical thinking example, good example of critical thinking on marketing and consumption: self reflection and analysis of trends., criminal behaviour critical thinking examples, according to law, good global foundation for leadership and character critical thinking example, free human brain and criminology critical thinking example, is gay marriage detrimental to the sanctity of marriage critical thinking examples, example of critical thinking on opinions on marijuana, critical thinking on what is ethnopharmacolgy.
What two classes of drugs does most of ethnopharmacologic research focus on? Ethnopharmacology focuses its major research on antihypertensive agents due to prevalence of hypertension and heart complications among minority populations and psychotropic agents. The study is based on uncovering the differences in how metabolism of the drugs occurs in different ethnicities. It entails discovering the effects of the drugs on patients and how the drugs are taken by the body in terms of the speed of absorption, assimilation, metabolism and excretion (pharmacokinetics).
Free Social Interaction Factors Critical Thinking Sample
Alcoholism: theories and techniques for prevention and rehabilitation critical thinking samples, free critical thinking on the challenge, free critical thinking on sexuality issue: a case of wrong assignment of gender, critical thinking on social work, what is the difference between a biological and social view of race, good example of critical thinking on medical surgical nursing, arguments for abortion critical thinking sample, complementary and alternative medicine for stress and anxiety critical thinkings example, sociology of sports critical thinking example, sample critical thinking on race as a social constructivism, good critical thinking on life span development, discrimination in the workplace critical thinking.
Password recovery email has been sent to [email protected]
Use your new password to log in
You are not register!
By clicking Register, you agree to our Terms of Service and that you have read our Privacy Policy .
Now you can download documents directly to your device!
Check your email! An email with your password has already been sent to you! Now you can download documents directly to your device.
or Use the QR code to Save this Paper to Your Phone
The sample is NOT original!
Short on a deadline?
Don't waste time. Get help with 11% off using code - GETWOWED
No, thanks! I'm fine with missing my deadline
112 Critical Thinking Questions
19. Describe the process that results in the formation of a tetrad.
20. Explain how the random alignment of homologous chromosomes during metaphase I contributes to the variation in gametes produced by meiosis.
21. What is the function of the fused kinetochore found on sister chromatids in prometaphase I?
22. In a comparison of the stages of meiosis to the stages of mitosis, which stages are unique to meiosis and which stages have the same events in both meiosis and mitosis?
23. Why would an individual with a mutation that prevented the formation of recombination nodules be considered less fit than other members of its species?
24. Does crossing over occur during prophase II? From an evolutionary perspective, why is this advantageous?
25. List and briefly describe the three processes that lead to variation in offspring with the same parents.
26. Animals and plants both have diploid and haploid cells. How does the animal life cycle differ from the alternation of generations exhibited by plants?
27. Explain why sexual reproduction is beneficial to a population but can be detrimental to an individual offspring.
28. How does the role of meiosis in gamete production differ between organisms with a diploid-dominant life cycle and organisms with an alternation of generations life cycle?
29. How do organisms with haploid-dominant life cycles ensure continued genetic diversification in offspring without using a meiotic process to make gametes?
Biology Part I Copyright © 2022 by LOUIS: The Louisiana Library Network is licensed under a Creative Commons Attribution 4.0 International License , except where otherwise noted.
Share This Book
19 Short Stories and Questions For Critical Thinking
Apr 2, 2024
There have been rumblings in different online teacher groups recently about replacing novels with short stories and informational articles in middle and high school English classrooms. I have to admit I was shocked when I first read the comments because I am a book lover at heart, but since then, I’ve considered that there are several pros and cons to this approach.
Short stories and other smaller texts can provide a briefer timeline to complete tasks, and this process is helpful when there is already SO MUCH curriculum to cover. Short stories and related activities can also be more engaging for our students because of the exposure to diverse voices and themes! Using short stories and lessons provides students with amazing choices to meet their needs and preferences!
On the other hand, incorporating mainly short stories and other shorter passages means students’ already-pressed attention spans (as a result of social media influences and pervasive sources of technology) are reinforced. Plus, students miss out on the more complex stories within longer pieces of fiction that are, dare I say, life-altering! A novel can provide opportunities for sustained reading and layers for analysis that shorter pieces of literature like short stories and related texts cannot offer.
Ultimately, no matter where you find yourself on the issue, I think we can all agree that short stories and their counterparts can be vital, effective, and helpful in the modern classroom!
Continue reading for 19 Short Stories and Questions For Critical Thinking!!
Need help with Test Prep ? Check out this FREE Pack of 3 Test Prep Activities to help students achieve success on standardized tests!
Table of Contents
19 Short Stories and Questions – Suggestions for Teaching Them
You don’t need to remove all novels to be able to include short stories and smaller passages like vignettes, articles, and narratives; there’s a time and place for all genres! But if you’re thinking about ways to include more short stories and fun activities, check out this list of 19 varied short stories and critical thinking questions as well as suggestions for teaching them in middle school and high school.
1. “The Most Dangerous Game”
“The Most Dangerous Game” is one of my absolute favorite short stories and overall plots to teach! This suspenseful short story by Richard Connell follows the harrowing ordeal of Sanger Rainsford, a skilled hunter who becomes the prey of a deranged aristocrat named General Zaroff. Stranded on Zaroff’s secluded island, Rainsford must outwit the cunning general in a deadly game of survival, where the stakes are life and death.
SUGGESTIONS FOR TEACHING:
- You could focus on the setting (description of time and place) and examine how the setting changes throughout the story.
- Students could learn about the plot (major events in the story) and list the major events and evidence as they read.
- Define foreshadowing (hints for what will happen by the end of the story) and encourage students to hypothesize about what will happen after every page.
- Analyze the character development (how a character changes over time) of Rainsford and highlight his traits/actions as you read along.
CRITICAL THINKING QUESTIONS:
- How does the setting contribute to the tension and suspense in the story?
- How does the author use foreshadowing? How does the author hint at the danger Rainford is facing?
- What inferences can you make about the main character and the changes he undergoes from the beginning to the end of the story?
If you want to teach plot elements and plot analysis , check out this lesson bundle for the story , which includes comprehension quizzes and a variety of activities!
2. “An Occurrence at Owl Creek Bridge”
Ambrose Bierce’s story is a gripping tale set during the American Civil War, where a Southern civilian named Peyton Farquhar faces execution by hanging after attempting to sabotage a Union railroad bridge. As Farquhar falls through the trapdoor, time seems to stretch, and he experiences a surreal moment, only to realize his grim reality.
Integrating historical texts with other short stories and passages like “An Occurrence at Owl Creek Bridge” will make history come more alive and relevant for our students!
- Teach about irony (when the opposite occurs from what is expected) and how it plays a role throughout the story.
- Explain the term characterization (how a character is depicted) by looking at direct and indirect references while reading with your students.
- Discuss the major themes (messages) of the story and how they connect to our modern era within a Socratic Seminar.
- How does the author use characterization to convey Peyton Farquhar’s thoughts, emotions, and motivations?
- What is the purpose of irony in this story? How does its use affect the reader’s interpretation and understanding of events?
- What is the significance in our contemporary/real world of the themes of the story, including reality and fantasy, the passage of time, and the consequences of actions?
Ensure students’ understanding of the story with this set of reading questions that are perfect for state test prep, too !
3. “The Masque of the Red Death”
This chilling tale from Edgar Allan Poe is set in a secluded abbey where Prince Prospero and his wealthy guests attempt to escape a deadly plague known as the Red Death. Despite their isolation efforts, the guests are confronted with their own mortality as a mysterious figure in a blood-red mask appears.
If you have not read any short stories and poems from Poe, this story is a perfect journey into the horror genre!
- The setting (description of time and place) plays a MAJOR role in the story, so following the Prince from room to room and highlighting the imagery (description that connects to the five senses) is very important when reading.
- If you have not introduced mood (emotion intended for the reader to experience), this story is PERFECT for delineating its progression from start to finish.
- As students read, you might guide them through identifying various examples of symbolism (object, person, or place that represents something else); each room, objects within, and the “antagonist” is symbolic in some way!
- How does the author convey the tone of the story? How would you, as the reader, describe the story’s mood?
- What role does the plot structure (focus on the different rooms) play in shaping the reader’s understanding of the story?
- What is the purpose of the symbolism in the story such as the clock and the masked figure?
Check out this EASY-TO-TEACH bundle , you can practice with your students, so they will feel more confident analyzing higher-level language in “The Masque of the Red Death!”
4. “The Cask of Amontillado”
Another chilling tale from Poe is the classic story “The Cask of Amontillado.” This one is set during Carnival in an unnamed Italian city. The plot centers on a man seeking revenge on a ‘friend’ he believes has insulted him. If your students are anything like mine, they will relish the ending particularly!
This is just one more of Poe’s short stories and tales that will capture the mind of every reader!
- As you plan for this short story, be sure to encourage your students to analyze the changing setting (description of time and place); following Fortunato from scene to scene will help your students track what is really going on.
- This story is the perfect moment to teach about dialogue (conversation within someone=internal and/or between someone and someone/thing else=external); Montresor certainly means more than what he SEEMS to say!
- You might also offer a mini-lesson on the 3 types of irony and how each plays a role in the story: verbal (when a person says the opposite of what is really intended), situational (an action occurs that is the opposite from what the reader expects), and dramatic (a character expects a result, but the opposite occurs and the audience can tell what will happen)!
- Describe Montresor. What are his motives and personality?
- What inferences can you make about Montresor’s mindset based on his dialogue?
- What is the purpose of the family’s motto and the carnival atmosphere?
Check out this Short Story Activity & Quiz Bundle for Edgar Allan Poe’s “The Cask of Amontillado,” which contains questions and answers modeled after various reading standardized tests as well as pre-quiz reading comprehension questions, graphic organizers, and a writing activity to get students thinking critically about this classic short story involving REVENGE!
Want 7 more teaching ideas for one of Poe’s epic short stories and questions to go with it? Click below!
5. “To Build a Fire”
This story by Jack London describes the treacherous journey of a man through the harsh Yukon wilderness during extreme cold. Despite warnings and the company of a loyal dog, the man’s arrogance and underestimation of nature’s power lead to a tragic end.
Short stories and ideas related to survival in nature are still relevant today! Who knows when you might get lost on a hike or crashland in no man’s land?
- This story is PERFECT for a bit of literary analysis (examining the impact of various ideas, elements, or themes within a piece of literature); you could hone in on literary devices, characterization, theme, etc.!
- Integrating clips from survival shows will help students see connections to the world and extend their thinking by comparing (recognizing similarities) and contrasting (recognizing differences) varied experiences!
- Write a short narrative about surviving 24 hours in a different setting (description of time and place).
- How does the author use irony? Provide an example and explain.
- What real-world connections can be made between this story and our contemporary life?
- What is the story’s message about preparedness and respecting nature?
Grab these engaging short stories and activities to make teaching this Jack London story stress-free!
6. “The Cactus”
Told from the point of view of a young man at his former lover’s wedding, the narrator retells their story. Like most of O. Henry’s short stories and texts, this one has a twist that involves the titular cactus plant.
The ending will end in a bit of fun for your students!
- Introduce diction (word choice) and its impact within the story by hyperfocusing on specific words within the story . Students can look up definitions, locate synonyms, create their own sentences, replace the words, etc.
- Investigate twist endings (unexpected finish to a story); before reading the end of the story, ask students to guess why the girl “rejected” him. Some students may know the answer before reading it!
- Describe the main characters. What similarities and differences are evident? How does this affect the story’s action?
- What inferences can you make about Trysdale and his feelings about love and marriage?
- What are the real and symbolic meanings of the cactus?
This resource packed with questions and answers, graphic organizers, and writing activities is sure to get your students thinking about this love story driven by misconceptions.
7. “After Twenty Years”
This tale of friendship and betrayal focuses on the reunion of two old friends after twenty years apart on a New York City street corner. As they reminisce, something is revealed that demonstrates the reality of their bond as well as the choices they’ve made in life.
If you have not read O. Henry’s short stories and incorporated character analysis yet, this is your chance! The story is not long and can be completed in one to two class periods!
- Sometimes, we ask students to visualize (create a picture) in their minds, but why not give them the opportunity to use their artistic skills to draw the two characters?
- As students read, annotate for a description of each character; then, students can do a character analysis (investigation of the characters’ similarities and differences).
- What type of irony is used in the story? How does its use affect your interpretation and understanding of the story?
- How does the urban setting contribute to the mood of the story?
- What is the story’s message about friendship and loyalty?
Examine the links between loyalty and duty with this set of resources designed specifically for this O. Henry story.
8. “The Lottery”
“The Lottery” is the quintessential short story for middle school or high school English! Shirley Jackson’s “The Lottery” tells the story of an annual ritual that takes place in a seemingly idyllic town. When the townsfolk gather for the lottery drawing, a shocking turn of events demonstrates the dark side of human nature and their ties to (outdated) traditions.
- Introduce the terms suspense (uncertainty and/or excitement leading up to a major event) and tension (anxiety or uneasy feelings experienced by characters). While reading, identify evidence that relates to each of these concepts and chat/write about their impact on meaning and plot.
- Teach title (the name of the text) analysis. The title of “The Lottery” is perfect for teaching the impact of the title and audience expectations. Before reading, students may write what they believe the story will be about based on the title. After reading, students can complete a quick write responding to their previous expectations! You can do a text analysis for all short stories and poems!
- What role does the plot structure play in building suspense and tension? (Consider the revelation of the lottery’s ‘prize’ in particular.)
- What social commentary is being made through the story and its characters?
- Describe Mr. Summers, Tessie, and Old Man Warner. What does the story reveal about their role in the community and their feelings about the lottery?
Give yours elf a breath of fresh air with this NO PREP curriculum that integrates test prep within the teaching of literature by using Shirley Jackson’s quintessential story!
9. “The Pedestrian”
This Ray Bradbury story follows a lone walker in a futuristic society in which everyone else is consumed by technology, particularly the television. One evening, the walker encounters a police car that questions his unusual behavior and the end is quite unexpected! (Most of Bradbury’s short stories and texts connect to the future and technology in some way!)
- This story exemplifies Dystopian Literature (texts that include a supposedly perfect future society marred in some way by governmental or societal oppression). Using this story to introduce this type of literature is always fun for students because they will easily make connections to other dystopic short stories and poems!
- Teach about mood (the emotional impact of a story’s description/action). The goal is to get students to deepen their critical thinking skills by recognizing how the mood changes and the purpose for that change!
- How does the author use foreshadowing and suspense to build the mood of the story?
- What is the central theme of the story? How might it connect with our current world?
- What similes and metaphors does Bradbury use to describe the community and its members? What is notable about these comparisons?
With this resource about Bradbury’s “The Pedestrian,” you can just print and teach the lesson and activities with EASE!
10. “The Gift of the Magi”
This 1905 story by O. Henry relays a tale about a couple struggling to make ends meet. Throughout the story, they both figure out gifts to buy one another for Christmas and realize what love truly means!
- Review character traits (how a character is depicted internally and externally). Log the traits of each character within the story and how they are important to the meaning of the story.
- Extend (move beyond the text) critical thinking skills by encouraging students to think and write about other people. If they had $1,000 to spend on someone else, how would they spend the money and why?
- How would you describe Della and Jim, and their relationship?
- What values do the characters have, when you consider their actions and decisions?
- Explain how dramatic irony is used in the story. Is it necessary? Is it effective? Why or why not?
This tale is a great addition to your short stories and questions unit around the winter holidays! Save yourself time at that time of the year with this lesson bundle .
11. “The Monkey’s Paw”
“The Monkey’s Paw” is a classic horror story about the White family who come into possession of a mystical monkey’s paw that grants three wishes. Despite warnings, they use it and then face devastating consequences as a result.
- Teach about the elements of the horror/suspense genre (Ex. Scary movies are typically dark, stormy, surprising, morbid, etc.).
- Create a thematic statement (message relayed by the text in a complete sentence). There is no perfectly created theme (message) unless it is directly stated by the author; however, students can create a theme by supporting their ideas with evidence from the story!
- What is the main theme of the story? Or how does the author communicate the themes of greed or fate? Is one stronger than the other?
- Are Mr. and Mrs. White more alike or different from one another? How do you know?
- Should we be afraid of the unknown? What message does the story share? Do you agree or disagree?
Examine W.W. Jacobs’ classic story with this set of questions and answers along with rigorous reading and writing activities . While it is ideal for a spooky season, the story is valuable for its ability to hook readers any time of year!
12. “Lamb to the Slaughter”
This classic story with a killer plot twist is about a woman who kills her husband and gets away with murder thanks to cooking a leg of lamb!
- You could introduce the plot elements (exposition, rising action, climax, falling action, resolution), encourage students to identify major events to fit each element and write down textual evidence to support their ideas.
- Complete a film analysis (examination of film techniques and their effects) to compare/contrast the short story with the classic Alfred Hitchcock television episode.
- What is Mary Maloney’s state of mind? Does it remain the same or does it change throughout the story? Explain.
- Is the resolution of the story satisfying? Why or why not? Why do you think the author ended it as he did?
- How does irony contribute to the theme of deception in the story? Explain.
Spice up your middle school English or high school English class with this short stories and activities bundle for Dahl’s famous story!
13. “The Tell-Tale Heart”
Poe’s classic psychological thriller is narrated by an unnamed protagonist who insists on their sanity while recounting how they murdered an old man. The narrator is haunted by the sound of the victim’s beating heart, which ultimately drives him to confess to the crime despite not originally being a suspect.
- Teach symbolism (object, person, or place that represents something else) by focusing on the heart and eye . The author used these symbols in various ways!
- Investigate psychology (the study of the human mind) as a part of the story. Determine what is fact and what is fiction within the narrator’s mind.
- What does the story reveal about the human psyche?
- What is the deeper meaning of the two key symbols in the story – the beating heart and the eye of the old man?
- What role do the narrator’s inner thoughts play in the development of the plot?
This Short Story Comprehension Bundle offers quick (and effective!) ways to assess students’ learning and understanding of the story. It’s easy to use and will no doubt save you time too!
14. “The Scarlet Ibis”
Emotional short stories and their counterparts have a place as well in English classrooms! This short story by James Hurst about two brothers is a heartbreaking must-read. Through flashbacks, the unnamed narrator tells the life story of his younger sickly brother William Armstrong, who is nicknamed Doodle. And the end…well, you’ll see.
- Define and explain the purpose of a flashback (referring back to the past within a story). Think about the implications of never thinking back on the past or always thinking about the past.
- Complete a comparison chart between Doodle and the Ibis as you read along. Then, students can create a visual of each after they have ready by using their own evidence!
- What is the meaning of the story’s title and the presence of a scarlet ibis in the story?
- What is the central theme of the story? How do the events of the story support this chosen theme?
- How does the author use personification for the storm? What effect does this have on the story?
This flexible resource features critical thinking questions and answers as well as writing and reading activities for students to explore Hurst’s heartbreaking story.
15. “The Veldt”
This science fiction story by Ray Bradbury was first published as “The World the Children Made” and it is quite fitting as a title! The story focuses on a futuristic world in which a video screen can be controlled and it turns out to be more than simple virtual reality! By the story’s conclusion, the world the children made is the downfall of their parents.
- Compare and contrast “The Veldt” with “The Pedestrian,” two short stories and dystopic texts by Ray Bradbury. Analyze the similarities and differences of both short stories and create a thematic statement that connects to both texts!
- Make connections to our current reality in the 21st century. Locate research about the implications of technology on young people and integrate this information as you discuss this short story.
- How does the author address the theme of technology versus humanity in the story? Do you agree with this commentary? Why or why not?
- How does the nursery reflect the personalities of Wendy and Peter in this story?
- Do you know the story of Peter Pan and his friend Wendy? What connections can you make between it and this story by Ray Bradbury?
Ray Bradbury’s classic short stories and similar passages are the BEST to teach in middle and high school English! With so much to dive into, they are sure to be a hit with your students. Grab this set of activities to extend your students’ engagement with rigorous reading and writing activities about “The Veldt.”
16. “The Necklace”
A woman who longs for a life of luxury and elegance beyond her means faces consequences when she loses a borrowed necklace. Guy de Maupassant’s story ends with a twist that has the reader question the value of material possessions.
- I love comparing this short story with O. Henry’s “The Gift of the Magi.” You might choose to focus on the theme, characterization, setting, etc.
- Summarize (writing about the main idea with details) each chunk of the story as you read with your students. Instead of asking students to write a paragraph, you could ask students to create each summary in only one sentence.
- The story explores vanity, deception, and the consequences of striving for social status. Which theme do you think is the most important? Explain with support from the story.
- Is Mathilde Loisel a likable character? Does this change during the story? Does it matter if the reader likes her? Why or why not?
- What clues does the author provide throughout the story that foreshadow the twist at the story’s end?
Focus on the standards with this Short Story Lesson Bundle for “The Necklace” by Guy de Maupassant!
Need help with implementing activities for “The Necklace?” See below!
17. “A Vendetta”
Guy de Maupassant’s late-19th-century story is all about REVENGE. A mother is obsessed with creating a plan to avenge her son’s murder and she then puts the plan into action with a morbid outcome.
- There are so many texts that involve REVENGE! Why not use this concept as a focus for a thematic unit (texts linked to a similar concept and/or message)? You could read “A Poison Tree,” “The Cask of Amontillado,” and “Lamb to the Slaughter” as well as “A Vendetta” with the intention of writing about all 4 for a comparison/contrast paper, presentation, or seminar.
- Analyze the development (how a character changes over time) of the mother and the dog throughout the story; you might annotate for similarities and differences as well as their motivations!
- What comment is the story making about the nature (or need) for justice? Do you agree or disagree? Why or why not?
- What similes and metaphors does the author use to communicate the main character’s feelings about the vendetta?
- How does the author use details to explain the main character’s thoughts, feelings, and motivation?
Add these activities for this lesser-known work to your short story plans. It’s sure to keep things fresh for your short stories and activities unit!
18. “Thank You, Ma’am” (also known as “Thank You, M’am”)
This heartfelt story by Langston Hughes tells the story of Luella, an older woman in the neighborhood, who is nearly robbed by a young man named Roger. In response to Roger, Luella brings him back to her home and treats him with an abundance of kindness, which has a profound effect on Roger.
This tale is at the top of the list for the BEST short stories and passages for upper middle and younger high school students!
- Introduce perspective and/or point of view (how a story is told: 1st, 2nd, 3rd omniscient, 3rd limited, 3rd objective). Students might rewrite the story from another perspective or extend the story using the perspective of one of the main characters.
- Review plot elements with a focus on the exposition (introduction to the characters, setting, and conflict), climax (highest point of interest/turning point of the story), and resolution (how the story is concluded and/or resolved in some way.) You could assign an activity surrounding each concept: visualization of the scene, a journal response to the event, or a short response focused on how the element is important to the overall theme!
- Do you believe in second chances? What does the story say about second chances?
- How might the climax of the story also be seen as the turning point in Roger’s life?
- How would you describe Mrs. Luella Bates Washington Jones? Are her actions expected or unexpected in the story? Consider from Roger’s and the reader’s point of view.
Click to check out all of the details for this BUNDLE with differentiated options , which includes a Test Prep Quiz (with varied options), Venn Diagrams, Graphic Organizers, and Writing Responses!!
19. “Click Clack the Rattle Bag”
This short story by Neil Gaiman is creepy and fun in the best ways possible! The narrator is taking care of his girlfriend’s little brother and walking him to bed when the child asks for a story. Instead of the narrator sharing a story, the boy shares about the Click Clacks who drink their prey and leave behind rattling bodies. The end is too good to be missed!
Short stories and plots like those in “Click Clack the Rattle Bag” will most certainly engage even your most struggling learners!
- We all know that test prep can be tough as many reading passages are, well, boring! Why not accomplish some test prep with your students and incorporate 5 standardized test-related questions ? You could focus on theme, structure, order of events, characterization, etc.!
- Help students make inferences (acknowledging and hypothesizing about the impact of details that are not directly referenced or stated) as the scene moves along. Students can analyze the change in the setting, the little boy himself, the story the boy is telling, and specific phrases from the story.
- What details in the story contribute to its eerie atmosphere or mood? Or what figurative language devices does Neil Gaiman use to create a sense of suspense in the story?
- How does the author use ambiguity in the story? Is it effective or not? Explain.
- What inferences can you make about the relationship between the narrator and the young boy?
This “Click Clack the Rattle Bag” Quiz Pack for middle and high school students uses the Common Core standards and contains questions and answers modeled after various state standardized tests! Make teaching this amazing short story by Neil Gaiman SIMPLE & EASY!
Why should we incorporate more short stories and activities in our teaching?
While I would never advocate replacing all novels with short stories and smaller texts, there is still something to be said about spending quality time with short stories and excerpts.
Including short stories and standards-based activities is an ideal option to improve reading comprehension and develop skills, especially in middle and high school English classes!
SHORT STORIES AND ACTIVITIES RESOURCES:
This Short Stories and Test Prep Questions ULTIMATE BUNDLE with Lessons, Quizzes, and Activities uses the Common Core standards with reading comprehension QUESTIONS and ANSWERS for 18 short stories such as “The Most Dangerous Game,” “The Monkey’s Paw,” “The Tell-Tale Heart,” “After Twenty Years,” “The Gift of the Magi,” “The Veldt,” “The Lottery,” “The Pedestrian,” etc. modeled after various state reading exams.
Make teaching short stories and activities SIMPLE & EASY!
Just PRINT & TEACH with engaging short stories and lessons!!
Need more fun ideas for teaching short stories and corresponding activities? Check out my store Kristin Menke-Integrated ELA Test Prep !
Hi, I’m KRISTIN!
I primarily focus on integrating multiple disciplines and subjects. The goal is to make teaching simplified and effective!
Let's Connect
- Follow Follow
Click below to download “13 Simple Strategies to make test prep a breeze!”
85 Critical Thinking Questions to Carefully Examine Any Information
There might be affiliate links on this page, which means we get a small commission of anything you buy. As an Amazon Associate we earn from qualifying purchases. Please do your own research before making any online purchase.
The ability to think critically will often determine your success in life.
Let’s face it. Every day, we are bombarded by news, social media updates, and an avalanche of information. If you take all of this at face value, it’s easy to be deceived, misled or ripped off.
That’s why it’s important to develop a mindset that focuses on critical thinking . This is a skill that needs to be developed in the classroom. But it’s also a valuable life skill.
With that in mind, the following post will share 85 critical thinking questions you can use to increase your awareness about different problems by carefully examining available information.
Let’s get started…
Table of Contents
What Are Critical Thinking Questions?
Critical thinking questions are inquiries that help you think rationally and clearly by understanding the link between different facts or ideas. These questions create a seemingly endless learning process that lets you critique, evaluate, and develop a depth of knowledge about a given subject. Moreover, you get to reinforce your viewpoints or see things in a new way.
We make decisions every day, whether at work or home. Adopting logical, rational, and practical approaches in addressing various issues requiring critical thinking is essential in decision-making. Therefore, before arriving at a decision, always ask yourself relevant questions and carefully analyze the matter’s pros and cons.
Critical Thinking Questions When in an Argument
When you make an argument using a critical thinking approach, you focus on justified claims that are valid and based on evidence. It helps one establish a strong argument.
- Do I disagree with the other person? Might the person I'm arguing with be misinformed on what they are saying?
- Would I be comfortable saying what I am telling him/her if I was in front of a group of people?
- What would happen if I lose this argument? Is engaging in this argument worth my time and energy? How will I feel if I lose?
- Is there room for ambiguity or misinterpretation? Are we arguing because I didn't make my point explicit? Should I take my time to understand his school of thought?
- Do I need some rest before saying something? Am I arguing because of other reasons other than the issues at hand? Do I need to take some time and cool down?
- Is it more important that I’m right? Am I trying to ask to prove an unnecessary point?
- Is this argument inductive, deductive, or abductive? Is it a weak or strong argument that I need to engage in? Is it compelling or sound?
- Is my opponent sincere? Given that they are wrong, are they willing to admit that they are wrong? Can they depend on available evidence, wherever it leads?
- Are my opponents only trying to shift their burden to me? What is the best way to prove them wrong without making them feel bad?
- Are the people I'm arguing with only interested in winning, or are they trying to pass some information across and help me discover the truth?
Critical Thinking Questions When Reading a Book
When you read a book, you probably ask yourself many “why” questions. Why is this a problem? Why did the character say that? Why is this important? The most challenging part of reading a book is assessing the information you are reading. These questions can help.
- If I learn only two things from this book, what will they be? How will they help me? How will I apply them in my daily life?
- What message are the authors trying to pass across? Are they making suggestions or providing evidence for their arguments?
- Given that almost every book is about solving problems, what is the most prevalent issue that the author is trying to solve?
- What is the author’s writing style? What strategy or master plan does the author employ to convey his/her main ideas throughout the book?
- Do I have background information about the book’s topic? If so, how is what the author is saying different from what I already know?
- What didn’t I understand from the book? Should I re-read the book to understand everything the writer is trying to convey?
- Which sections of the book do I love the most, and why? Generally, do I like this book? Should I look for more books that are written by the same author?
- If I had a chance to meet this book’s author, what questions would I ask him/her? What would I tell the writer about the book? Is it a great book worth recommending to your friends and family members?
- Who are the main characters of the book? If there is only one main character, what overarching goal does the character accomplish?
- In what ways did the protagonist change from the start of the book to the end? What caused the changes? Was the protagonist reckless in some ways? Which ways?
Critical Thinking Questions to Spot a Scam
Asking questions when you feel that a fraud or a scam is being presented to you is a good way to stretch your critical thinking muscles. Are you being emailed or messaged by a stranger? Or maybe there are other red flags you are unsure about. If so, ask these questions.
- Does it seem to be too good to be true? Is this stranger pushy or trying to lure me into making a poor decision?
- When trying out online dating: Is my new “friend” professing strong feelings towards me although we’ve only interacted for a few hours?
- Why is a stranger calling me to ask about my Social Security Number (SSN), personal contact information, or bank details while claiming they are from the bank or a phone company?
- When buying products online, why does the seller ask me to pay for goods using an insecure payment option like Bitcoin or money order?
- Does the email I have received have any spelling or grammatical errors? Is the language used overly formal or informal?
- If I do a quick search about the exact words of the email I received, does Google indicate it's a fraud or scam?
- Why should a stranger manipulate me using obvious questions like “Would you want to be rich or poor?” While they already know the answer?
- Is the email asking me to download an attachment? Or click a link to some insecure website?
- Is the person trying to make me feel selfish or guilty for not sending them money, whether for a donation or buying a product?
- Is the stranger portraying a sense of urgency and using pressure tactics? Are they telling me that their family member needs urgent medical attention?
Critical Thinking Questions About Your Life
It can also help to ask yourself a few critical thinking questions about your life. This way, you can gather basic information and uncover solutions to problems you might not have otherwise thought of.
- Where do I wish to be in a few years, probably two, three, or five years? What short-term and long-term goals should I set?
- What have I achieved so far from the time I set my previous goals? What should I be grateful for?
- Do I have any values that guide me in life? If so, what are these values? Am I always true to these values?
- Am I always worried about what people around me think? Can I act independently without the need to meet social expectations?
- What should people say about me at my funeral? Would they talk about how good I made them feel or how rich and flashy I was?
- If I wasn't afraid of anyone or anything, what would I have done? What if I didn't have any fear in me?
- If today was my last day, what extraordinary thing would I do? Can I do it right now?
- What should I do with the things that matter the most to me?
- What things will make the greatest difference in my future life if I take action now?
- How should I react when I feel unwanted by the people I love the most? Should I tell them?
Critical Thinking Questions for a Debate or Discussion
When you are in the middle of a debate or discussion, you need to know that what you are saying is fact, have evidence to support your claim, and position yourself as an expert in what you are saying. Here are some critical thinking questions to ask when you are in a debate or discussion.
- Is there fairness in this discussion? Is the moderator supporting one side? Do they want to make one side look stupid or wrong?
- What is the aim of this discussion? Is there a major problem that needs to be solved? If so, how can I help solve it?
- Who are the people affected by this discussion? If they were here, what would they say?
- Do my views on this discussion matter? If I raise my point, will I be redundant?
- What am I supposed to learn from this debate, and how can I use what I have learned in my daily life?
- Does the audience seem to be biased towards one side? Are they booing one side? What can I do even if it's our opponents being booed?
- Who are the discussion panel members? What views have they held about this kind of discussion or any other related discussions in the past?
- How can I make my point without being ambiguous? Before I speak, should I take down some notes to avoid any confusion during my speech?
- Am I ready to apologize if I make a mistake during the discussion? If so, what are the limits?
- What information does my team, or I need before this discussion?
Critical Thinking Questions About Lying
Admitting when you are wrong, choosing not to cheat, and sharing constructive feedback are all ways to show your honesty. Here are some critical thinking skills to ask regarding lying.
- Will the lie hurt those I am telling, or will it help them? What if being honest might cause my friend unnecessary pain?
- Should I be the one telling this person a lie, or I let someone else do it?
- Will I be the one hurt if I tell this lie? Will my friend feel I am a betrayer? Will it affect our friendship?
- Do they answer my questions in detail, or are they always trying to ignore and dodge the main problem?
- What if I ask these people the same question using different terms and wording? Will they give me the same response?
- Did the tone of my friend suddenly change after I asked him/her this question? Do they sound louder, faster, or slower compared to how they usually speak?
- Does this person have something to gain by lying to me? What is their motive?
- Does this person take a sudden pause or hesitate more than usual when responding to my question?
- When I look at these people's faces, do their facial expressions match what they say?
- Should I believe this person or not? What are my intuitions? Does it look like they are telling the truth?
- Do they blink like other days when I ask them questions? Are they always trying to avoid direct eye contact?
- Why do they seem uncomfortable when it’s just a normal conversation?
Critical Thinking Questions When Presented With a Claim
Critical thinking is much more than just evaluating whether a claim is true or not. It also means a critical thinker reflects on what follows from true claims.
- What does this claim mean, and what are its implications? What if it's a false claim?
- Which of my morals, values, or beliefs do I have to give up to accept this claim?
- Do professionals in this field agree or disagree with the claim that has been made?
- Do they have evidence to back their claim? Which is the most robust evidence to support the claim?
- What argument can I come up with to refute this claim? Or what is the best view that can support this claim?
- Who is the primary source of the claim being made? Is the basis of the claim reliable?
- Is it a claim, or it's just an opinion?
- Is the claim likely to be 100% false, true, or partially true?
- Am I allowed to refute the claim and table my evidence, or is it one-sided?
Critical Thinking Interview Questions
Critical thinking skills are valuable in any industry or field and for almost all roles. During a job interview, you will be asked questions so the potential employer can assess your skills and see how you use logic. Your critical thinking ability is just one vital part that can play into your professional development.
- Is there a time you had to convince someone to use an alternate approach to solve a problem?
- Have you ever had to make a difficult decision quickly?
- How would you handle a situation where your supervisor handled something wrong or made a mistake?
- What is one of the most difficult decisions you have ever had to make at work?
- How would you solve a disagreement between coworkers when approaching a project?
- Can you describe a time when you anticipated a problem ahead of time and took the appropriate steps to stop the problem from becoming an issue?
- If you discover a cheaper way to do something or a better solution to a problem and try to explain it to your supervisor, but they don’t understand, what do you do?
Critical Thinking Questions for Kids
We can’t leave the kids out either. Critical thinking questions for kids get them thinking and talking. It also allows a parent to get to know their child better.
- How many grains of sand do you think are on the beach?
- What would happen if it stopped raining?
- Do you think there is life on other planets?
- Should children be able to set their own bedtimes?
- How would you describe what a tree looks like without saying green or leaves?
- Can you name five different emotions?
- Can you talk for five minutes without uttering “um?”
What Are the Basic Principles of Critical Thinking?
Your critical thinking skills involve gathering complete information, understanding and defining terms, questioning the methods by which we get facts, questioning the conclusions, and looking for hidden assumptions and biases.
Additionally, we can’t expect to find all of the answers, and we need to take the time to examine the big picture of it all.
Here are the basic principles:
- Disposition: Someone with critical thinking skills is often skeptical, open-minded, and practices fair-mindedness. They can look at different viewpoints and change positions if the evidence and reason lead them to do so.
- Criteria: In order to think critically, one must also apply criteria. Certain conditions must be met before someone believes in something. The information needs to be from credible sources.
- Argument: An argument is simply a statement or proposition that is shown with supporting evidence. When you use your critical thinking skills, you identify, evaluate, and construct your argument.
- Reasoning: With critical thinking comes reasoning. You must examine logical relationships among the statements being made.
- Point of View: Critical thinkers can see things from different perspectives and different points of view.
What Are Good Analysis Questions?
Analysis is a part of critical thinking that allows you to examine something carefully. Someone with analytical skills can examine the information presented, understand what that information means, and then properly explain that information to others. Analysis in critical thinking provides more clarity on the information you process.
When analyzing, you may ask yourself, “how do I know this,” how would I solve this problem,” and “why does it matter?”
Why Is Critical Thinking an Important Skill?
Critical thinking skills allow you to express thoughts, ideas, and beliefs in a better way. It also leads to improved communication while allowing others to understand you better. Critical thinking fosters creativity and encourages out-of-the-box thinking. This is a skill that can be applied to many different areas of your life.
For example, knowing the answers to critical thinking questions for a job interview will better prepare you for the interview. Many employers, during questioning, are likely to ask you critical thinking questions to assess if you have the ability to evaluate information effectively so you can make more informed decisions.
Final Thoughts on Critical Thinking Questions
Although it's common to get torn between making two or more choices, nobody wants to make the wrong decision. The only thing you can do to avoid this is use critical thinking questions to examine your situation. The answers to these questions will help you make informed decisions and help you comprehend crucial matters in your life.
Want to learn more about critical thinking and decision-making using a real-life example? Here is how Jeff Bezos uses critical thinking to make some of the most challenging life decisions.
Finally, if you want to ask better questions, then watch this short, 20-minute course to learn how to have a great conversation with virtually anyone .
Critical Thinking Questions
Discuss why thoughts, feelings, or behaviors that are merely atypical or unusual would not necessarily signify the presence of a psychological disorder. Provide an example.
Describe the DSM-5. What is it, what kind of information does it contain, and why is it important to the study and treatment of psychological disorders?
The International Classification of Diseases (ICD) and the DSM differ in various ways. What are some of the differences in these two classification systems?
Why is the perspective one uses in explaining a psychological disorder important?
Describe how cognitive theories of the etiology of anxiety disorders differ from learning theories.
Discuss the common elements of each of the three disorders covered in this section: obsessive-compulsive disorder, body dysmorphic disorder, and hoarding disorder.
List some of the risk factors associated with the development of PTSD following a traumatic event.
Describe several of the factors associated with suicide.
Why is research following individuals who show prodromal symptoms of schizophrenia so important?
The prevalence of most psychological disorders has increased since the 1980s. However, as discussed in this section, scientific publications regarding dissociative amnesia peaked in the mid-1990s but then declined steeply through 2003. In addition, no fictional or nonfictional description of individuals showing dissociative amnesia following a trauma exists prior to 1800. How would you explain this phenomenon?
Imagine that a child has a genetic vulnerability to antisocial personality disorder. How might this child’s environment shape the likelihood of developing this personality disorder?
Compare the factors that are important in the development of ADHD with those that are important in the development of autism spectrum disorder.
As an Amazon Associate we earn from qualifying purchases.
This book may not be used in the training of large language models or otherwise be ingested into large language models or generative AI offerings without OpenStax's permission.
Want to cite, share, or modify this book? This book uses the Creative Commons Attribution License and you must attribute OpenStax.
Access for free at https://openstax.org/books/psychology/pages/1-introduction
- Authors: Rose M. Spielman, Kathryn Dumper, William Jenkins, Arlene Lacombe, Marilyn Lovett, Marion Perlmutter
- Publisher/website: OpenStax
- Book title: Psychology
- Publication date: Dec 8, 2014
- Location: Houston, Texas
- Book URL: https://openstax.org/books/psychology/pages/1-introduction
- Section URL: https://openstax.org/books/psychology/pages/15-critical-thinking-questions
© Feb 9, 2022 OpenStax. Textbook content produced by OpenStax is licensed under a Creative Commons Attribution License . The OpenStax name, OpenStax logo, OpenStax book covers, OpenStax CNX name, and OpenStax CNX logo are not subject to the Creative Commons license and may not be reproduced without the prior and express written consent of Rice University.
Explore CRI’s 2023 Cancer Research Impact
Immune to Cancer: The CRI Blog
Answering More Questions on Genomics and Genetic Testing in Cancer Care
Last month, the Cancer Research Institute (CRI) invited Corrie Painter, PhD, and Eliezer Van Allen, MD, to discuss new advances in genetics and genomics in cancer patient care . These colleagues at the Broad Institute of MIT and Harvard offer a unique set of patient, scientific, and medical perspectives on what genes reveal about cancer risk and behavior. Both an angiosarcoma survivor and scientist, Dr. Painter leads patient-driven research projects to accelerate the discovery of new therapies. As both a computational biologist and medical oncologist, Dr. Van Allen has specific expertise in the analysis and interpretation of genomic data in treatment decisions.
During a special Cancer Immunotherapy Month live webinar , Drs. Painter and Van Allen fielded questions from cancer patients around the world—more than could be addressed within the hour. CRI spoke with Drs. Painter and Van Allen after the webinar to address a number of questions from our community.
Question: Why is there discordance between liquid biopsy results from the same person run at different labs?
Drs. Painter and Van Allen: There are a few reasons that one may see different results between different labs. First, the samples themselves may actually be different. Not every cancer cell has the exact same set of mutations. So when you draw blood that has DNA from cancer cells mixed in with the plasma, different days may show DNA from different groups of cells that have different mutations. Second, the way the tests are designed and interpreted is not the same between different companies. There is variability in how these tests are developed which may lead to differences in what they show.
Question: If genomic testing does not identify any mutations for which there are available targeted therapies, is there any value in evaluating drugs that target other genes on that pathway?
Drs. Painter and Van Allen: This is a great question. The short answer is we don’t know, though there are studies underway that are attempting to address these concepts and determine whether it might help to consider drug targets in terms of pathway actions (rather than directly on the genes).
Question: I have epithelioid hemangioendothelioma sarcoma. I had over 500 mutations screened with UCSF500 genomic panel and no mutations were found. What should I do now?
Drs. Painter and Van Allen: If you are interested in more expanded testing, there are commercial vendors that offer larger sequencing (e.g., whole exome, whole genome, whole transcriptome sequencing).
Question: Is anyone looking at folks who have Lynch syndrome or LiFraumeni who don't get cancer?
Drs. Painter and Van Allen: This is an important area of research. At Count Me In , we are gearing up to send questionnaires to several thousand cancer patients in order to understand their family history of cancer as well as familial disorders. We are hoping to develop research questions around people with hereditary disorders such as these.
Question: How is a gene fusion/translocation similar to or dissimilar to a genetic mutation?
Drs. Painter and Van Allen: A gene fusion is a rearrangement of the DNA between two genes, whereas a genetic mutation is a change in the DNA within one gene. Using the words “End Cancer” for an analogy, a fusion would be a fusion of the words to get something like “Encer” or “Caned” or any other combination of the two words. A mutation would be a change within one of the words “Eld Cancer,” for example. In both cases, the meaning of the word(s) can change.
Question: Will the genomic DNA change from one organ to another in case of metastasis? If the cancer metastasized from breast to lung, is one genomic testing sufficient?
Drs. Painter and Van Allen: So far we have learned that the genomic DNA does indeed change as tumors metastasize from the original organ to another site, although whether one needs to test both sites is unclear (and often not feasible for practical reasons). This may be where liquid biopsies (blood-based testing) may help, as this would in theory sample all of these sites at the same time, though studies are still needed to understand this phenomenon.
Question: For primary and metastatic tumors, cancer is usually defined by the organ in which it is discovered. Do you think that, one day, we will start defining cancers by genomic cell type rather than originating organ?
Drs. Painter and Van Allen: We aspire to exactly this goal!
Question: Can mitochondrial DNA play a role in cancer immunotherapy?
Drs. Painter and Van Allen: Great question. We don’t yet know, but studies are underway looking at this specifically.
Question: Can tracking longitudinal changes in tumor mutational burden be used to track response to therapy?
Drs. Painter and Van Allen: We and others are now investigating how we can track changes in genomics over time can help understand responses in real time.
Corrie Painter, PhD, an angiosarcoma survivor and former CRI Fellow, is associate director of operations and scientific outreach in the Cancer Program of the Broad Institute of MIT and Harvard. Dr. Painter also serves as the associate director of Count Me In , which launches patient-driven research projects across multiple cancer types, including the Angiosarcoma Project .
Eliezer Van Allen, MD, is an assistant professor of medicine at Harvard Medical School, a clinician at Dana-Farber/Partners Cancer Care, and an associate member at the Broad Institute of MIT and Harvard. His research focuses on computational cancer genomics, the application of new molecular profiling technologies to advance precision cancer medicine, and studying resistance to cancer therapeutics.
CRI's "Cancer Immunotherapy and You" patient education webinar series is produced by the Cancer Research Institute and was hosted by Arthur Brodsky, PhD Sponsorship for this webinar was generously provided by Bristol-Myers Squibb, Alkermes, and Foundation Medicine. Sponsorship does not influence editorial decisions or content. Browse our Cancer Immunotherapy and You Webinar Series playlist on YouTube or visit the Webinars page on our website to see other webinars in this series.
Image by Gerd Altmann from Pixabay
Let's spread the word about Immunotherapy! Click to share this page with your community.
This website uses tracking technologies, such as cookies, to provide a better user experience. If you continue to use this site, then you acknowledge our use of tracking technologies. For additional information, review our Privacy Policy .
Critical thinking definition
Critical thinking, as described by Oxford Languages, is the objective analysis and evaluation of an issue in order to form a judgement.
Active and skillful approach, evaluation, assessment, synthesis, and/or evaluation of information obtained from, or made by, observation, knowledge, reflection, acumen or conversation, as a guide to belief and action, requires the critical thinking process, which is why it's often used in education and academics.
Some even may view it as a backbone of modern thought.
However, it's a skill, and skills must be trained and encouraged to be used at its full potential.
People turn up to various approaches in improving their critical thinking, like:
- Developing technical and problem-solving skills
- Engaging in more active listening
- Actively questioning their assumptions and beliefs
- Seeking out more diversity of thought
- Opening up their curiosity in an intellectual way etc.
Is critical thinking useful in writing?
Critical thinking can help in planning your paper and making it more concise, but it's not obvious at first. We carefully pinpointed some the questions you should ask yourself when boosting critical thinking in writing:
- What information should be included?
- Which information resources should the author look to?
- What degree of technical knowledge should the report assume its audience has?
- What is the most effective way to show information?
- How should the report be organized?
- How should it be designed?
- What tone and level of language difficulty should the document have?
Usage of critical thinking comes down not only to the outline of your paper, it also begs the question: How can we use critical thinking solving problems in our writing's topic?
Let's say, you have a Powerpoint on how critical thinking can reduce poverty in the United States. You'll primarily have to define critical thinking for the viewers, as well as use a lot of critical thinking questions and synonyms to get them to be familiar with your methods and start the thinking process behind it.
Are there any services that can help me use more critical thinking?
We understand that it's difficult to learn how to use critical thinking more effectively in just one article, but our service is here to help.
We are a team specializing in writing essays and other assignments for college students and all other types of customers who need a helping hand in its making. We cover a great range of topics, offer perfect quality work, always deliver on time and aim to leave our customers completely satisfied with what they ordered.
The ordering process is fully online, and it goes as follows:
- Select the topic and the deadline of your essay.
- Provide us with any details, requirements, statements that should be emphasized or particular parts of the essay writing process you struggle with.
- Leave the email address, where your completed order will be sent to.
- Select your prefered payment type, sit back and relax!
With lots of experience on the market, professionally degreed essay writers , online 24/7 customer support and incredibly low prices, you won't find a service offering a better deal than ours.
IMAGES
VIDEO
COMMENTS
3.1.8: Critical Thinking Questions. 19. Describe the process that results in the formation of a tetrad. 20. Explain how the random alignment of homologous chromosomes during metaphase I contributes to the variation in gametes produced by meiosis. 21.
Critical Thinking Questions; 41 Osmotic Regulation and Excretion. Introduction; 41.1 Osmoregulation and Osmotic Balance; 41.2 The Kidneys and Osmoregulatory Organs; 41.3 Excretion Systems; 41.4 Nitrogenous Wastes; 41.5 Hormonal Control of Osmoregulatory Functions; Key Terms; Chapter Summary;
Describe the feeding mechanism of sponges and identify how it is different from other animals. 23. Compare the structural differences between Porifera and Cnidaria. 24. Speculate as to what advantage (s) a complete digestive system has over an incomplete digestive system? 25. Describe a potential advantage and disadvantage of the cuticle of ...
20. A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect. 21. Describe how transcription in prokaryotic ...
16.4: Critical Thinking Questions. 23. Name two differences between prokaryotic and eukaryotic cells and how these differences benefit multicellular organisms. 24. Describe how controlling gene expression will alter the overall protein levels in the cell. 25.
15.4: Critical Thinking Questions Last updated; Save as PDF Page ID 115103
A sophisticated AI to generate Higher-Order questions from any text in one click! Questgen provides a simple one-click solution to generate quizzes that need reasoning and critical thinking skills. You can try out Questgen for free (No credit card needed!). Simply sign-up and you are good to go!
A list of student-submitted discussion questions for Gene Expression. Click Create Assignment to assign this modality to your LMS. We have a new and improved read on this topic. Click here to view We have moved all content for this concept to for better organization. Please update your bookmarks accordingly.
PRT Critical Thinking Test: question 1 of 3. Six friends are seated in a restaurant across a rectangular table. There are three chairs on each side. Adam and Dorky do not have anyone sitting to their right and Clyde and Benjamin do not have anyone sitting to their left. Adam and Benjamin are not sitting on the same side of the table.
Review Questions; Critical Thinking Questions; Test Prep for AP® Courses; Science Practice Challenge Questions; 22 Prokaryotes: Bacteria and Archaea. Introduction; 22.1 Prokaryotic Diversity; 22.2 Structure of Prokaryotes; 22.3 Prokaryotic Metabolism; 22.4 Bacterial Diseases in Humans; 22.5 Beneficial Prokaryotes;
The Ultimate Cheat Sheet For Digital Thinking by Global Digital Citizen Foundation is an excellent starting point for the 'how' behind teaching critical thinking by outlining which questions to ask. It offers 48 critical thinking questions useful for any content area or even grade level with a little re-working/re-wording. Enjoy the list!
Example Of Cancer Critical Thinking. The lung cancer is of primary concern among western population in the western world by virtue of exaggerated rate of smoker compared to non smokers. The pathology of lung cancer comprises of genomic instability resulting in abnormalities over a long span.
112. Critical Thinking Questions. 19. Describe the process that results in the formation of a tetrad. 20. Explain how the random alignment of homologous chromosomes during metaphase I contributes to the variation in gametes produced by meiosis. 21. What is the function of the fused kinetochore found on sister chromatids in prometaphase I?
Table of Contents. 19 Short Stories and Questions - Suggestions for Teaching Them. 1. "The Most Dangerous Game". 2. "An Occurrence at Owl Creek Bridge". 3. "The Masque of the Red Death". 4.
Your critical thinking skills involve gathering complete information, understanding and defining terms, questioning the methods by which we get facts, questioning the conclusions, and looking for hidden assumptions and biases. Additionally, we can't expect to find all of the answers, and we need to take the time to examine the big picture of ...
Describe how cognitive theories of the etiology of anxiety disorders differ from learning theories. 28. Discuss the common elements of each of the three disorders covered in this section: obsessive-compulsive disorder, body dysmorphic disorder, and hoarding disorder. 29. List some of the risk factors associated with the development of PTSD ...
Want to create or adapt books like this? Learn more about how Pressbooks supports open publishing practices. Critical Thinking Questions. 28 . Compare and contrast a human somatic
Question: How is a gene fusion/translocation similar to or dissimilar to a genetic mutation? Drs. Painter and Van Allen: A gene fusion is a rearrangement of the DNA between two genes, whereas a genetic mutation is a change in the DNA within one gene. Using the words "End Cancer" for an analogy, a fusion would be a fusion of the words to get ...
Share via: Critical thinking, as described by Oxford Languages, is the objective analysis and evaluation of an issue in order to form a judgement. Active and skillful approach, evaluation, assessment, synthesis, and/or evaluation of information obtained from, or made by, observation, knowledge, reflection, acumen or conversation, as a guide to ...