msc medical research methodology

Browse the Courses

Postgraduate Course Medical Research Methodology

Find out more about our courses.

Meet the people behind our teaching and research

Find out what you need to start your application

Short Duration

Blended form, english language, competitive fees.

• Stand-alone
• Photo Gallery v1

MSc in Medical Research Methodology

INSTITUTION: ARISTOTLE UNIVERSITY OF THESSALONIKI

SCHOOL: FACULTY OF HEALTH SCIENCES

DEPARTMENT: SCHOOL OF MEDICINE

DURATION (semesters): 2

ECTS (total): 75

TUITION: 5000

Scholarship is offered

CITY: THESSALONIKI

NUMBER OF STUDENTS ACCEPTED: 35

STUDENTS SELECTED BY: Application Evaluation - Interview

Part time studying is available

PART TIME DURATION (semesters): 4

OBSERVATION OPTIONS: In Person & From distance

Health and Medicine

Master's website

Secretary's e-mail: [email protected]

PHONE NUMBER: +30 2310 999 333

DESCRIPTION - ACCEPTED STUDENTS CATEGORIES: The MSc in Medical Research Methodology is inextricably linked to the strategic objectives of the Medical School of Thessaloniki and aims to extend the knowledge on the subject of Medical Research Methodology. Graduates of this MSc will be able to work in positions of public and private sectors, which require specialized knowledge on the subject of Medical Research Methodology. It is acknowledged that the teaching of this particular scientific subject is a necessity for an updated medical curriculum vitae. Besides, the possession of this MSc degree constitutes a requirement for admission to doctoral (third cycle) studies or for the engagement in medical research.

KEYWORDS: Methodology, Systematic Reviews, Meta-Analysis, Statistics, Advanced Statistics, How to Write a Paper or a Grant Proposal

Postgraduate Studies of the Greek Universities

• Undergraduate Courses
• Postgraduate Taught Courses
• Professional, Part-time and Evening Courses
• PhDs and Research Masters
• Online Courses
• Micro-credentials
• How to Apply
• Fees & Funding
• Modes of Study
• Scholarships

Choosing a course is one of the most important decisions you'll ever make! View our courses and see what our students and lecturers have to say about the courses you are interested in at the links below.

View Courses

• Accommodation Advisory Service
• Campus Activities
• Student Support

Study Abroad

• International Office
• Mature Students
• Students with Disabilities
• Student Ambassador Programme
• For Parents and Guardians
• Access Student Information
• Life in Galway

University Life

Each year more than 4,000 choose University of Galway as their University of choice. Find out what life at University of Galway is all about here.

Read about life at University of Galway

• News & Events
• Strategy 2020-2025
• Cois Coiribe (Publication)
• University Leadership
• Sustainability - National SDG Champion

About University of Galway

Since 1845, University of Galway has been sharing the highest quality teaching and research with Ireland and the world. Find out what makes our University so special – from our distinguished history to the latest news and campus developments.

About University of Galway

• Adult Learning and Professional Development
• College of Arts, Social Sciences, & Celtic Studies
• College of Business, Public Policy and Law
• College of Medicine, Nursing & Health Sciences
• College of Science and Engineering

Colleges & Schools

University of Galway has earned international recognition as a research-led university with a commitment to top quality teaching across a range of key areas of expertise.

Colleges and Schools

• Research Areas
• Research Office
• Innovation Office
• Researcher Development Centre
• Research Community Portal
• Research centres, institutes, and units

Research & Innovation

University of Galway’s vibrant research community take on some of the most pressing challenges of our times.

• Career Development Centre (for Employers)
• Business Innovation Centre
• Conference & Event Centre

Guiding Breakthrough Research at University of Galway

We explore and facilitate commercial opportunities for the research community at University of Galway, as well as facilitating industry partnership.

• Latest News
• Alumni Services
• Cois Coiribe
• Alumni Awards
• Follow our Social Channels
• Update Your Details
• Upcoming Alumni Events
• Previous Alumni Events

Alumni & Friends

There are 128,000 University of Galway alumni worldwide. Stay connected to your alumni community! Join our social networks and update your details online.

• About Engagement
• Learning with Community
• Community Partnerships
• Research with Communities
• University of Sanctuary

Community Engagement

At University of Galway, we believe that the best learning takes place when you apply what you learn in a real world context. That's why many of our courses include work placements or community projects.

Real Learning

Gateway Pages

• Prospective Students
• Current Students
• Ollscoil na Gaillimhe
• A High Contrast
• Registration
• Office 365 (Email)
• Student Registry Helpdesk
• Fees & Grants
• Exam Timetables
• Academic Skills Hub
• Student Services
• Student Volunteering
• Students' Union
• Financial System (Agresso)
• Academic Records
• Human Resources
• Academic Terms Dates
• Information Solutions & Services (IT Services)
• Buildings & Estates
• Service Desk
• Colleges & Schools

Clinical Research (MSc, full-time and part-time)

Course overview, course outline, why choose this course, course fees.

• Find Out More

The objective of this Master of Science course is to provide training for the next generation of healthcare workers in the clinical research arena. The course aims to provide a platform for achieving greater efficiencies in applying medical discoveries to clinical practice. It is aimed at qualified individuals who wish to become independent clinical investigators or those who wish to seek employment in leadership positions in clinical research teams.

The MSc (Clinical Research) is intended to be a part-time two-year programme of academic study in Clinical Research Methodology. Year 1 will be spent at University of Galway and Year 2 is completed by a combination of distance learning, and on-site modules delivered by University of Galway. A full-time one-year option is available to students who wish to complete the MSc in a full-time capacity.

Special features Course contributors include senior academics and medical professionals from University of Galway, and Saolta University Health Care Group who are actively engaged in clinical research. This programme is closely linked with the HRB Clinical Research Facility, Galway.

Course webinar recording Watch recording from Virtual Postgraduate Open Day, November 2020, here .

HRB fellowship: call for HRB-CRFG Fellowship Applications Please click here for information document. Then please click here to download the form referenced in the information document.

Eligibility criteria

• Offered and accepted a full-time position on the MSc in Clinical Research programme.
• Be available to commit to working 20 hours per week at the HRB-CRFG.

Allied University of Galway courses

• Interested in applying stem cells, gene therapy and tissue engineering to develop new therapies? Click  here  to find out more.
• Cellular manufacturing and therapy and the production of advanced medicinal products is quickly evolving as the future of medicine.To learn more about bioprocessing, click  here .
• Microscopy and imaging of cells and tissue samples is a highly desirable skill for academia and industry alike. Click  here  to learn more.

Applications and Selections

Applications are made online via the University of Galway  Postgraduate Applications System . 

Who Teaches this Course

Requirements and assessment.

Assessment will take the form of formal, end-of-module examinations as well as continuous assessment, evaluation of contribution to group discussions and module projects. Semester One exams take place in December; Semester Two exams take place in April/May. The research thesis is submitted in August.

Entry Requirements

Students must have completed either of the following: 

• An undergraduate degree in medicine
• Other healthcare related undergraduate degree with a minimum of 2nd Class Honours, Grade 1*.
• Biomedical science-related undergraduate degree with a minimum of 2nd Class Honours, Grade 1*. 

Applicants from non-healthcare related degrees will be considered (minimum requirement of 2nd Class Honours, Grade 1*)  on a case-by-case basis at the discretion of the coordinators. 

Applicants with significant relevant experience will also be considered for this programme. 

For applicants where English is a second language, we will adhere to University of Galway guidelines of requiring IELTS scores of 6.5, TOEFL scores of 88 and/or Pearson PTE scores of 61 with no less than 5.5 in any component.  Duolingo test score requirement:  110 overall , no less than 110 in any one component and valid for 2 years.

Those who do not meet the primary entry criteria as described above will be declined entry into the programme.  The remaining applicants will be reviewed in closer detail. 

Significant weight will be placed on:

A) the applicant’s essay describing their motivation for applying for this course and their career aspirations following the successful completion of the MSc, B) the applicant’s referee’s comments, and C) the applicant’s previous academic performance. 

*Or equivalent international qualification

Additional Requirements

Recognition of prior learning (rpl).

Applicants with significant relevant experience will also be considered for this programme.

1 year, full-time 2 years, part-time

Next start date

September 2024

A Level Grades ()

Average intake, qqi/fet fetac entry routes, closing date.

No set closing date. Please see offer rounds website for further information. 

Mode of study

Ects weighting, course code, full-time msc (clinical research).

Full-time or part-time course consisting of 90 ECTS.

Compulsory Modules (Core):

MD510 Fundamentals of Health Research and Evaluation Methods; 10ECTS

MD511 Introduction to Biostatistics I; 10ECTS

MD1602 Introduction to the Ethical and Regulatory Frameworks of Clinical Research; 10ECTS

Additional Modules (Optional):

Semester 1 and 2

MD513 Introduction to Biostatistics II; 10ECTS

MD514 Introduction to Research Methods for Randomized Controlled Trials; 10ECTS

MD515 Systematic Review Methods; 10ECTS

MD1541 Harnessing the Basic Biology of Cancer for Development of Novel Therapeutics; 10 ECTS

MD1603 Clinical Research Site Level Activities; 10 ECTS

MD517 Clinical Research Administration; 10ECTS

EC584 Health Systems and Policy Analysis; 10ECTS

EC572 Health Technology Assessment; 10ECTS

MD518 Observational and Analytical Research Methods; 10ECTS

MD1600 Bio-Ethics; 10ECTS

MD1601 Biobank—Advanced Clinical Application and Clinical Testing; 10ECTS

MD1528 First in Human, Early Phase Clinical Trials; 10ECTS

MD520 Thesis (30 ECTS), completed over the one-year period. Thesis defence will be completed at University of Galway.

Part-time MSc (Clinical Research)  

Students are required to complete three compulsory modules at University of Galway in year 1 of the Masters. A further 3* or 5** modules are selected from additional courses available at University of Galway.

MD1602 Introduction to the Ethical and Regulatory Frameworks of Clinical Research; 10ECTS 

MD1528 First in Human, Early Phase Clinical Trials; 10ECTS 

*Thesis (30 ECTS), completed over the 2-year period. Thesis defence will be completed at University of Galway

** MD519 Independent Study Module (10 ECTS), completed and assessed by University of Galway.

Module details for full-time course Module details for part-time course  

Curriculum information, glossary of terms, year 1 (90 credits), career opportunities.

Clinical Research graduates are expected to progress to become principal investigators or key team members involved in the conduct, management and monitoring of clinical research. Such roles have become a prominent source of jobs in a variety of settings, including universities and colleges, the pharmaceutical industry, non-academic clinical research organisations, hospitals, independent funding agencies and government agencies. Additional opportunities include employment in teaching and consultation settings.

What makes this course unique ...

• The MSc programme provides training for qualified individuals who wish to become independent clinical investigators or an array of clinical research professionals who wish to seek employment in or to lead clinical research teams. The programme is structured such that those in full-time employment are able to undertake the programme part-time.
• The programme content is delivered by experience and active senior researchers, academics and medical professionals from University of Galway and Saolta University Health Care Group via a mixture of face-to-face and online learning.
• MSc programme graduates have multiple employment opportunities as the conduct and oversight of clinical research has become increasingly prominent in a variety of settings, including university/colleges, pharmaceutical industry, non-academic clinical research organizations, hospitals, independent funding agencies and government agencies. Additional opportunities include employment in teaching and consultation.

Who’s Suited to This Course

Learning outcomes, transferable skills employers value, work placement, related student organisations, fees: tuition, fees: student levy, fees: non eu.

Postgraduate students in receipt of a SUSI grant—please note an F4 grant is where SUSI will pay €4,000 towards your tuition (2024/25).  You will be liable for the remainder of the total fee.  A P1 grant is where SUSI will pay tuition up to a maximum of €6,270. SUSI will not cover the student levy of €140.

Postgraduate fee breakdown = Tuition (EU or NON EU) + Student levy as outlined above.

Note to non-EU students: learn about the 24-month Stayback Visa  here . 

Find out More

For general queries, email:.

[email protected]

Dr Sonja Khan HRB Clinical Research Facility E: [email protected] www.crfg.ie  Twitter:  @CrfgHrb LinkedIn: linkedin.com/in/nuig-clinical-research-masters 

Dr Johannes B. Letshwiti |   Consultant Neonatologist

I have a special interest in quality improvement (QI) projects and this is the course I had been looking for as a clinical educator. I wasn't sure at the start whether the course would be able be a good fit for those interested in QI, an important part of modern clinical practice. This course provides you with the right tools to critique journal articles, to interpret results, to set up research and QI projects, and to teach trainees on how to present research articles. It gives you basic and in-depth look at research methodology. The course is delivered in the most efficient way for those doing the course either in part-time or full time capacity. There is huge support from the instructors throughout the course. The course is delivered online with some face-to-face lectures. The latter is important as it provides tutorial rather than just lectures. There is an excellent mix of core and optional modules. The optional modules are tailored to suit your area of interest or expertise. I am in a better place right now as this course has consolidated what most health professionals do not get during their training: research methodology, an essential education piece for all clinicians.

Chiaw Woon Teh |   Research Associate

Clinical research is a competitive and growing field. Being a clinical research professional, a strong academic/medical background isn’t sufficient to conduct good quality clinical research. Some significant research skills and knowledge are essential for competence in conducting research and this is the main reason I started MSc Clinical Research with NUI Galway. It is a comprehensive programme with experienced, dedicated and outstanding lecturers which includes clinicians, regulatory specialists and clinical trial specialists. It gives a great overview of clinical research with the concepts, research ethics and guidelines. This course enhances my skills in information seeking, communicating, methodological skills and data analysis. I was lucky to be offered a placement in the oncology department. It was an eye-opener experience which allowed me to have hands-on experience in the clinical trials. This course has changed my career path from a clinical pharmacist to a clinical research associate and I am glad that I made this decision.

Kai Meen Chen |   Research Associate

This course provides essential knowledge and skills in clinical research areas if you are planning to pursue this field. The teaching method is an adaptive learning platform that included both online & classroom methods. The lecturers in this course are experienced & knowledgeable, they provide full support and guidance. During my academic year, I was honoured to receive the Advanced Therapies Cancer Group Scholarship in Clinical Research Facility Galway (CRFG). This placement allowed me to gain hands-on experience in clinical trials, especially in Haematology and Oncology trials. In the CRFG, I worked as a data manager at the site to complete the patient data in the database, maintain the site file and handle the monitoring visit. This working experience was invaluable and helped me understand the significance of these activities in a clinical trial. I highly recommend this course to those planning to work in clinical research, which would equip you with the basic knowledge to start your career in the academic research or pharma industry. I have no regret studying abroad for this course which is a plus for me to progress to the next level as a project manager.

Aditya Kodumagulla |   Pharm D

MSc. in Clinical Research program have equipped me with good Clinical and essential skills that are most needed if you are willing to start a clinical research industry career. The compulsory and optional modules are designed to complete with great flexibility and provide the basic concept with adequate staff support. My journey to Ireland started with my interest in clinical trials and Medical devices to explore good research career opportunities. However, I was fortunate enough to receive the HRB - Fellowship, which has exposed me to many practical aspects and various clinical and non-clinical pieces of training, that have helped me gain essential skills. Moreover, my student life at NUIG was amazingly packed in attending social, sports and career events which gave me enough exposure, confidence and skill to unleash my potential and supported me to create excellent research possibilities for my upcoming career.

Alice Power |   Quality & Regulatory Affairs Manager

The MSc. in Clinical Research was an overall excellent experience. I gained a thorough understanding of all  aspects to clinical research and since my graduation this has been beneficial to the progression of my career in research administration and management roles. The module choices offered, through both online and classroom learning, were wide enough to allow for selection on the components you might be more interested in while having optimum required core modules. Engagement, support and insight from experienced course lecturers was always available.  I have to say that completion of this MSc. has stood me very well and would highly recommend to anyone considering a clinical research management/administration future.

Dr. Martin O'Halloran |   Techrete Snr Lecturer; Dir, Translational Medical Device Lab

In recent decades, the medical devices sector has become an ever-increasing part of the West of Ireland’s economic landscape. The growth of the sector has been supported by academic initiatives like BioInnovate, CURAM and the HRB’s Clinical Research Facility in Galway (CRFG). The Masters in Clinical Research delivered by the CRFG trains medical devices researchers on the fundamentals of designing, implementing and analysing a clinical trial. Uniquely, since the material is delivered by CRF staff themselves, the course also addresses the practical challenges of clinical research. The course content is very carefully considered and is both challenging and engaging. I couldn’t recommend the course highly enough and would consider such training a must for those engaging in medical device trials.

Dr. Shubham Atal |   MD, MSc

Coming from an academic–research background in medicine/pharmacology, the MSc in Clinical Research was a perfect fit for me in terms of its content, exposure and duration. It aims at facilitating a career progression into various roles in the different domains of clinical research. The availability of compulsory and elective additional modules offers great flexibility and perspective. Moreover, there were opportunities in form of part time paid internships / jobs and volunteer research assistantships to gain hands on experience in clinical research activities in the CRFG. This master’s programme is a great platform for anyone looking to launch or further a career in healthcare research in industry or academia. It helped me greatly to transition into working for a top national institute of medicine in my country as an academic actively involved in clinical research.

John O'Dea |   CEO, Crospon

With the increasing level of translational research and novel medical device design taking place in Ireland, there is a strong need to increase number of trained clinical researchers both within academia and industry. This course has been of great benefit to me in building skills in terms of RCT design and biostatistics in a formal structured manner. The various modes of learning and lecture scheduling have made this a course capable of being managed in the context of a heavy work schedule.

Colm Mc Elwain |   MPharm MPSI

This course has a variety of optional modules, ranging from database development to project management, that gave me great flexibility in how I wanted to steer my own learning experience. The teaching methods used in these modules are flexible, which allows the content to be very student orientated and accessible. I was fortunate to get a place on a research fellowship in HRB’s Clinical Research Facility in Galway (CRFG). This placement was invaluable in allowing me to experience all elements of clinical research in a practical manner. In the CRFG, I worked in database management, quality assurance, quality control and project management on a variety of clinical studies. I was lucky enough to get some great advice from experienced colleagues while I was here. I would recommend the MSc. in Clinical Research to anyone who would like to utilise their skills in the world of clinical research, even if your background isn’t from a clinical setting. The course has an excellent support network and great lecturers that are happy to provide guidance and advice to students.

Shereen Esmael |   BCPS,MSc.,Clinical Research Assistant

I started the course hoping to achieve something extra to aid my main field of Pharmacology, but I finished the course with a decision to shift my career to Clinical Research completely at an age where I should be settling with what I've already got going on. The MSc. in Clinical Research is a very well-organised course that boasts the complete package in terms of teaching all the vital aspects of clinical research, building valuable practical experience, and having suitable schedules for graduate students coming from almost any background, mine of course being Pharmacology. The course also offers a diverse selection of interesting optional modules, in addition to the required modules, that provide a wide range of exciting possibilities for your very own unique experience. I was very fortunate to earn a research scholarship in the CRFG, which proved priceless in getting me prepared for my current clinical research job after the course. I would definitely recommend the MSc. in Clinical Research to anyone hoping to pursue a career as a clinical researcher

Dr Yogesh Acharya |   MD, MSc, FAcadMEd, AFAMEE

Clinical research has become an integral part of modern medicine. The impact of research in the healthcare setting lies beyond individual patients. As science continues to evolve, there is an overwhelming need for evidence-based medicine. MSc in Clinical Research at the National University of Ireland Galway provides a suitable platform for physician and healthcare staff to build a clinical research career. Dedicated faculty members consist of academia, clinicians and industry experts, who offer a practical learning experience. The problem-based active teaching and learning environment addresses the challenges in clinical research and equips students with the knowledge, attitude and competence to excel. As a recent alumnus, I highly recommend this course to those who want to build a clinical research career or consolidate their research aptitude.

NEW for 2023*

MSc Applied Clinical Data Analytics

Tweets by CrfgHrb

Sign up to receive updates

Postgraduate Prospectus 2024 PDF (3.3MB)

MSc in Clinical Research Brochure PDF (1.3 MB)

MCR 20 / 21 Handbook PDF (1.1 MB)

FAQ PDF (256 KB)

Manage Cookies

Some features need cookies to work properly. Cookies also let us (a) remember your preferences, (b) collect anonymous usage statistics, and (c) see how well our online ads are working.

No personal data is stored on these cookies but, under EU law, we still need to ask you this every 6 months. To learn more about our use of cookies, view our Privacy Policy .

Founded in 1845, we've been inspiring students for over 175 years. University of Galway has earned international recognition as a research-led university with a commitment to top quality teaching.

University of Galway, University Road, Galway, Ireland H91 TK33 T. +353 91 524411

Get Directions Send Us an Email

Twitter Instagram Facebook YouTube LinkedIn RSS

© 2023 University of Galway. All Rights Reserved. Server AWS University of Galway is a registered charity. RCN 20002107

• Privacy & Cookies
• Contact & Enquiries
• Accessibility

Global main menu

Health care research methods msc.

Part of: Medicine

This programme will give you the academic background and specialist skills to carry out healthcare and clinical research. If you are a graduate, nurse, medical doctor or other health professional this programme is for you.

• Learn how to take research forward in health services, academic environments, contract research organisations, or pharmaceutical industry environments
• Gain a detailed picture of the complex and inter-related activities of the development cycle, from discovery to successful commercialisation
• Gain an understanding of the regulatory framework governing good clinical research
• Learn to apply the principles that you have learnt to your professional commitments
• Develop skills in gathering, recording and communicating information

Study options

• Full-time September 2024 | 1 year
• Part-time September 2024 | 2 years
• Part-time September 2024 | 2 - 4 years

What you'll study

The modular nature of the programme is designed to fit in with your needs if you are in full-time employment. You will receive the taught element of the modules in three-day blocks approximately every four to six weeks.

You will learn how to design a clinical study and gain insights into practical aspects of early drug development. You will cover ethics and regulation and understand how to manage the data of a study. You will also gain a wider picture of the health management environment and the decision-making within it.

• Nine compulsory modules
• Compulsory 20,000-word dissertation

Short courses

Discover our medicine and dentistry short courses that you can study on campus or online.

Compulsory/Core modules

Clinical study design, practical aspects of clinical research and early drug development, ethics and regulation in clinical research, data management: the interpretation of statistics and pharmacokinetics, health and pharmaco-economics, pharmaceutical and healthcare marketing, dissertation, health and the human body, specific topics in clinical trial design and elective project, professional and research skills.

- Concepts of health and illness - Measuring health at local and national levels - Healthcare systems - Critical reviewing literature to establish current knowledge - Development and change in the NHS - Evaluating healthcare improvements through research, audit, or service development - Presenting research, audit, and service development - Developing policies and clinical guidelines - Equality, equity and health policy - The professional in a large organisation - Resource allocation and rationing

• You will receive continuous assessment in your taught modules through essay-style answers, a series of shorter answers or a mixture of both 
• There is no final written examination

You will complete a critical dissertation of approximately 20,000 words.

Your learning will include:

• self-directed learning
• reading lists of books and journal papers.

This programme is also available to study part-time which means that you would take fewer modules per semester. Classes generally take place during the day, so if you intend to study part-time, contact the course convenor to get an idea of when these teaching hours are likely to take place.

You will have an Academic Adviser who will guide you in both academic and pastoral matters throughout your studies.

Dr Dunja Aksentijevic

Dr Dunja Aksentijevic is a Reader at the William Harvey Research Institute, Queen Mary University of London. Dunja graduated from the University of Hull in 2004 with a BSc (Hons First Class) in Biomedical Science and was the recipient of the Faculty of Science Academic Scholarship. She was awarded the University of Hull Frederick Atkinson Prize Scholarship and NHS Renal Research Fund Fellowship for her doctoral studies to examine myocardial insulin resistance in chronic kidney disease. Immediately upon completion of her doctoral thesis in 2008, she joined the group of Prof Stefan Neubauer at..

Where you'll learn

• The William Harvey Research Institute offers state-of-the art core facilities, including a Genome Centre, a flow cytometry and cell sorting station, and in vivo imaging facilities
• A Learning Resources Centre, open around the clock, with 200 networked PCs solely for the use of postgraduate students
• Medical libraries located at the Royal London and St Bart's hospitals and at the main university campus at Mile End
• Access to the Postgraduate Reading Room
• Research access to the British Library

About the Institute

William harvey research institute.

The William Harvey Research Institute (WHRI) places a high value upon training the next generation of researchers. We are part of the Faculty of Medicine and Dentistry at Queen Mary University of London, which is ranked joint seventh in the UK for the quality of our research (REF 2021).

Our primary research focus and excellence lies in our cardiovascular, inflammation and endocrine research themes. In addition, we achieve international excellence in critical care and perioperative medicine research. We aim to combine talents from different disciplines such as genomics, cell biology, and pharmacology, with translational bench-to-patient studies and large-scale clinical trials.

We are currently the largest pharmacological research institute in the UK University sector, and one of the largest in Europe. The Centre employs 530 clinicians and scientists from 45 countries.

• William Harvey Research Institute Twitter

Career paths

This programme will give you the academic background and specialist skills to carry out healthcare and clinical research. 

• 93% of WHRI graduates are in employment or further study (2020/21)
• 88% of WHRI graduates in employment or study are in highly skilled work or graduate study (2020/21)

Fees and funding

Full-time study.

September 2024 | 1 year

• Home: £11,950
• Overseas: £27,250 EU/EEA/Swiss students

Unconditional deposit

Overseas: £2000 Information about deposits

Part-time study

September 2024 | 2 years

• Home: £6,000
• Overseas: £13,650 EU/EEA/Swiss students

September 2024 | 2 - 4 years

Queen Mary alumni can get a £1000, 10% or 20% discount on their fees depending on the programme of study. Find out more about the Alumni Loyalty Award

There are a number of ways you can fund your postgraduate degree.

• Scholarships and bursaries
• Postgraduate loans (UK students)
• Country-specific scholarships for international students

Our Advice and Counselling service offers specialist support on financial issues, which you can access as soon as you apply for a place at Queen Mary. Before you apply, you can access our funding guides and advice on managing your money:

• Advice for UK and EU students
• Advice for international students

Entry requirements

Degree requirements.

A 2:2 or above at undergraduate level in a relevant degree.

Find out more about how to apply for our postgraduate taught courses.

International

Afghanistan We normally consider the following qualifications for entry to our postgraduate taught programmes: Master Degree from a recognised institution. UK 1st class degree: 90%; or GPA 3.7 out of 4.0 UK 2:1 degree: 80%; or GPA 3.0 out of 4.0 UK 2:2 degree: 70%; or GPA 2.4 out of 4.0

Albania We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 7 out of 10

Algeria We normally consider the following qualifications for entry to our postgraduate taught programmes: Licence; Diplome de [subject area]; Diplome d'Etudes Superieures; Diplome de Docteur end Pharmacie; or Diplome de Docteur en Medecine from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Angola We normally consider the following qualifications for entry to our postgraduate taught programmes: Grau de Licenciado/a (minimum 4 years) from selected institutions. UK 1st class degree: 17 out of 20 UK 2:1 degree: 15 out of 20 UK 2:2 degree: 13 out of 20

Argentina We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo/ Grado de Licenciado/ Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 9 out of 10 UK 2:1 degree: 7.5 out of 10 UK 2:2 degree: 6.5 out of 10

Armenia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma from a recognised institution. UK 1st class degree: 87 out of 100 UK 2:1 degree: 75 out of 100 UK 2:2 degree: 61 out of 100

Australia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) or Bachelor Honours degree from a recognised institution. UK 1st class degree: High Distinction; or First Class with Honours UK 2:1 degree: Distinction; or Upper Second Class with Honours UK 2:2 degree: Credit; or Lower Second Class with Honours

Austria We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 1.5 out of 5.0 UK 2:1 degree: 2.5 out of 5.0 UK 2:2 degree: 3.5 out of 5.0

The above relates to grading scale where 1 is the highest and 5 is the lowest.

Azerbaijan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma from a recognised institution. UK 1st class degree: 90%; or GPA 4.7 out of 5 UK 2:1 degree: 80%; or GPA 4 out of 5 UK 2:2 degree: 70%; or GPA 3.5 out of 5

Bahamas We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from the University of West Indies. UK 1st class degree: First Class Honours UK 2:1 degree: Upper Second Class Honours UK 2:2 degree: Lower Second Class Honours

Bahrain We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0; or 90 out of 100 UK 2:1 degree: GPA 3.0 out of 4.0; or 80 out of 100 UK 2:2 degree: GPA 2.3 out of 4.0; or 74 out of 100

Bangladesh We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from selected institutions. UK 1st class degree: GPA 3.2 to 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 to 3.3 out of 4.0 UK 2:2 degree: GPA 2.3 to 2.7 out of 4.0

Offer conditions will vary depending on the institution you are applying from.  For some institutions/degrees we will ask for different grades to above, so this is only a guide. 

Barbados We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from the University of West Indies, Cave Hill or Barbados Community College. UK 1st class degree: First Class Honours*; or GPA 3.7 out of 4.0** UK 2:1 degree: Upper Second Class Honours*; or GPA 3.0 out of 4.0** UK 2:2 degree: Lower Second Class Honours*; or GPA 2.4 out of 4.0**

*relates to: the University of West Indies, Cave Hill.

**relates to: Barbados Community College.

Belarus We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma (minimum 4 years) from a recognised institution. UK 1st class degree: 9 out of 10; or 4.7 out of 5 UK 2:1 degree: 7 out of 10; or 4 out of 5 UK 2:2 degree: 5 out of 10; or 3.5 out of 5

Belgium We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) from a recognised institution. UK 1st class degree: 80% or 16/20*; or 78%** UK 2:1 degree: 70% or 14/20*; or 72%** UK 2:2 degree: 60% or 12/20*; or 65%**

*Flanders (Dutch-speaking)/ Wallonia (French-speaking) **German-speaking

Belize We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from the University of West Indies. UK 1st class degree: First Class Honours UK 2:1 degree: Upper Second Class Honours UK 2:2 degree: Lower Second Class Honours

Benin We normally consider the following qualifications for entry to our postgraduate taught programmes: Maitrise or Masters from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Bolivia We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Bachiller Universitario or Licenciado / Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 85%* or 80%** UK 2:1 degree: 75%* or 70%** UK 2:2 degree: 65%* or 60%**

*relates to: Titulo de Bachiller Universitario

**relates to: Licenciado / Titulo de [subject area] 

Bosnia and Herzegovina We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8.5 out of 10 UK 2:2 degree: 7.5 out of 10

Botswana We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 5 years) or Master Degree from the University of Botswana. UK 1st class degree: 80% UK 2:1 degree: 70% UK 2:2 degree: 60%

Brazil We normally consider the following qualifications for entry to our postgraduate taught programmes: Título de Bacharel / Título de [subject area] or Título de Licenciado/a (minimum 4 years) from a recognised institution. UK 1st class degree: 8.25 out of 10 UK 2:1 degree: 7.5 out of 10 UK 2:2 degree: 6.5 out of 10

The above grades assumes that the grading scale has a pass mark of 5.

Brunei We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours degree from a recognised institution. UK 1st class degree: First Class Honours UK 2:1 degree: Upper Second Class Honours UK 2:2 degree: Lower Second Class Honours

Bulgaria We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 5.75 out of 6.0 UK 2:1 degree: 4.75 out of 6.0 UK 2:2 degree: 4.0 out of 6.0

Burundi We normally consider the following qualifications for entry to our postgraduate taught programmes: Diplome d'Etudes Approfondies from a recognised institution. UK 1st class degree: 85%; or 16 out of 20 UK 2:1 degree: 75%; or 14 out of 20 UK 2:2 degree: 60%; or 12 out of 20

Cambodia We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 80%; or GPA 3.5 out of 4.0 UK 2:1 degree: 70%; or GPA 3.0 out of 4.0 UK 2:2 degree: 60%; or GPA 2.35 out of 4.0

Cameroon We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree; Licence; Diplome d'Etudes Superieures de Commerce; Diplome d'Ingenieur de Conception/ Travaux; Doctorat en Medecine/ Pharmacie; or Maitrise or Master 1 from selected institutions. UK 1st class degree: 16 out of 20; or GPA 3.6 out of 4.0 UK 2:1 degree: 14 out of 20; or GPA 3.0 out of 4.0 UK 2:2 degree: 12 out of 20; or GPA 2.5 out of 4.0

Canada We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Bachelor Honours Degree from a recognised institution. UK 1st class degree: GPA 3.6 out of 4.0 UK 2:1 degree: GPA 3.2 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Chile We normally consider the following qualifications for entry to our postgraduate taught programmes: Grado de Licenciado en [subject area] or Titulo (Professional) de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 6.5 out of 7 UK 2:1 degree: 5.5 out of 7 UK 2:2 degree: 5 out of 7

China We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from selected institutions. UK 1st class degree: 85 to 95% UK 2:1 degree: 75 to 85% UK 2:2 degree: 70 to 80%

Offer conditions will vary depending on the institution you are applying from.  

Colombia We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado en [subject area] or Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 4.60 out of 5.00 UK 2:1 degree: 4.00 out of 5.00 UK 2:2 degree: 3.50 out of 5.00

Congo, Dem. Rep. of We normally consider the following qualifications for entry to our postgraduate taught programmes: Diplome d'Etudes Approfondies or Diplome d'Etudes Speciales from a recognised institution. UK 1st class degree: 16 out of 20; or 90% UK 2:1 degree: 14 out of 20; or 80% UK 2:2 degree: 12 out of 20; or 70%

Congo, Rep. of We normally consider the following qualifications for entry to our postgraduate taught programmes: Diplome d'Etudes Superieures or Maitrise from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Costa Rica We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachiller or Licenciado from a recognised institution. UK 1st class degree: 9 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 7.5 out of 10

Croatia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Advanced Diploma of Higher Education Level VII/1 (Diploma - Visoko obrazovanje) from a recognised institution. UK 1st class degree: 4.5 out of 5 UK 2:1 degree: 4 out of 5 UK 2:2 degree: 3 out of 5

Cuba We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado/ Arquitecto/ Doctor/ Ingeniero from a recognised institution. UK 1st class degree: 4.7 out of 5 UK 2:1 degree: 4 out of 5 UK 2:2 degree: 3.5 out of 5

Cyprus We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 8 out of 10; or GPA 3.7 out of 4.0 UK 2:1 degree: 7.0 out of 10; or GPA 3.0 out of 4.0 UK 2:2 degree: 6.0 out of 10; or GPA 2.5 out of 4.0

Czech Republic We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) from a recognised institution. UK 1st class degree: 1.2 out of 4 UK 2:1 degree: 1.5 out of 4 UK 2:2 degree: 2.5 out of 4

The above relates to grading scale where 1 is the highest and 4 is the lowest.

Denmark We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor degree from a recognised institution. UK 1st class degree: 12 out of 12 (2007 onwards); or 11 out of 13 (before 2007) UK 2:1 degree: 7 out of 12 (2007 onwards); or 8 out of 13 (before 2007) UK 2:2 degree: 4 out of 12 (2007 onwards); or 7 out of 13 (before 2007)

Dominican Republic We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado/ Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 95/100 UK 2:1 degree: 85/100 UK 2:2 degree: 78/100

Ecuador We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado / Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 90%; or 9/10; or 19/20; or GPA 3.7 out of 4.0 UK 2:1 degree: 80%; or 8/10; or 18/20; or GPA 3.0 out of 4.0 UK 2:2 degree: 70%; or 7/10; or 14/20; or GPA 2.4 out of 4.0

Egypt We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions. UK 1st class degree: 85%; or GPA 3.7 out of 4 UK 2:1 degree: 75%; or GPA 3.0 out of 4 UK 2:2 degree: 65%; or GPA 2.5 out of 4

El Salvador We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado/ Titulo de [subject area] (minimum 5 years) from a recognised institution. UK 1st class degree: 8.5 out of 10 UK 2:1 degree: 7.5 out of 10 UK 2:2 degree: 6.5 out of 10

Eritrea We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.4 out of 4.0

Estonia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree; University Specialist's Diploma; or Professional Higher Education Diploma from a recognised institution. UK 1st class degree: 4.5 out of 5 UK 2:1 degree: 3.5 out of 5 UK 2:2 degree: 2 out of 5

The above grades assumes that 1 is the pass mark. 

Eswatini We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 80% UK 2:1 degree: 70% UK 2:2 degree: 60%

Ethiopia We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Fiji We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from one of the following institutions: Fiji National University, the University of Fiji, or the University of South Pacific, Fiji. UK 1st class degree: GPA 4.0 out of 5.0*; or overall grade A with High Distinction pass**; or GPA 4.0 out of 4.5*** UK 2:1 degree: GPA 3.33 out of 5.0*; or overall grade B with Credit pass**; or GPA 3.5 out of 4.5*** UK 2:2 degree: GPA 2.33 out of 5.0*; or overall grade S (Satisfactory)**; or GPA 2.5 out of 4.5***

*relates to Fiji National University

**relate to the University of Fiji

***relates to the University of South Pacific, Fiji

Finland We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree/ Kandidaatti/ Kandidat (minimum 180 ECTS credits) from a recognised institution; or Bachelor degree (Ammattikorkeakoulututkinto/ Yrkeshögskoleexamen) from a recognised University of Applied Sciences. UK 1st class degree: 4.5 out of 5; or 2.8 out of 3 UK 2:1 degree: 3.5 out of 5; or 2 out of 3 UK 2:2 degree: 2.5 out of 5; or 1.4 out of 3

France We normally consider the following qualifications for entry to our postgraduate taught programmes: Licence; Grade de Licence; Diplome d'Ingenieur; or Maitrise from a recognised institution. UK 1st class degree: 14 out of 20 UK 2:1 degree: 12 out of 20 UK 2:2 degree: 11 out of 20

Gambia We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 80%; or GPA 4.0 out of 4.3 UK 2:1 degree: 67%; or GPA 3.3 out of 4.3 UK 2:2 degree: 60%; or GPA 2.7 out of 4.3

Georgia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma (minimum 4 years) from a recognised institution. UK 1st class degree: 91 out of 100; or 4.7 out of 5 UK 2:1 degree: 81 out of 100; or 4 out of 5 UK 2:2 degree: 71 out of 100; or 3.5 out of 5

Germany We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) from a recognised institution. UK 1st class degree: 1.5 out of 5.0 UK 2:1 degree: 2.5 out of 5.0 UK 2:2 degree: 3.5 out of 5.0

Ghana We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: First Class UK 2:1 degree: Second Class (Upper Division) UK 2:2 degree: Second Class (Lower Division)

Greece We normally consider the following qualifications for entry to our postgraduate taught programmes: Degrees from recognised selected institutions in the University sector or Degrees (awarded after 2003) from recognised Technological Educational Institutes. UK 1st class degree: 8 out of 10*; or 9 out of 10** UK 2:1 degree: 7 out of 10*; or 7.5 out of 10** UK 2:2 degree: 6 out of 10*; or 6.8 out of 10**

*Relates to degrees from the University Sector. **Relates to degrees from Technological Educational Institutes.

Grenada We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from the University of West Indies. UK 1st class degree: First Class Honours UK 2:1 degree: Upper Second Class Honours UK 2:2 degree: Lower Second Class Honours

Guatemala We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado / Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 90% UK 2:1 degree: 80% UK 2:2 degree: 70%

The above grades assumes that the pass mark is 61% or less.

Guinea We normally consider the following qualifications for entry to our postgraduate taught programmes: Master; Maitrise; Diplome d'Etudes Superieures; or Diplome d'Etudes Approfondies from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Guyana We normally consider the following qualifications for entry to our postgraduate taught programmes: Graduate Diploma (Postgraduate) or Masters degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.4 out of 4.0

Honduras We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado/a / Grado Academico de Licenciatura (minimum 4 years) from a recognised institution. UK 1st class degree: 90%; or 4.7 out of 5; or GPA 3.7 out of 4.0 UK 2:1 degree: 80%; or 4.0 out of 5; or GPA 3.0 out of 4.0 UK 2:2 degree: 70%; or 3.5 out of 5; or GPA 2.4 out of 4.0

Hong Kong We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours Degree from selected institutions. UK 1st class degree: First Class Honours UK 2:1 degree: Upper Second Class Honours UK 2:2 degree: Lower Second Class Honours

Hungary We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor degree (Alapfokozat) or University Diploma (Egyetemi Oklevel) from a recognised institution. UK 1st class degree: 4.75 out of 5 UK 2:1 degree: 4 out of 5 UK 2:2 degree: 3.5 out of 5

Iceland We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor degree (Baccalaureus or Bakkalarprof) from a recognised institution. UK 1st class degree: 8.25 out of 10 UK 2:1 degree: 7.25 out of 10 UK 2:2 degree: 6.5 out of 10

India We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from selected institutions. UK 1st class degree: 75% to 80% UK 2:1 degree: 60% to 70% UK 2:2 degree: 50% to 60%

Offer conditions will vary depending on the institution you are applying from.  For some institutions/degrees we will ask for different grades to above, so this is only a guide.  

For India, offers may be made on the GPA scale.

We do not consider the Bachelor of Vocation (B. Voc.) for Masters entry.

Indonesia We normally consider the following qualifications for entry to our postgraduate taught programmes: Sarjna I (S1) Bachelor Degree or Diploma IV (D4) (minimum 4 years) from selected degree programmes and institutions. UK 1st class degree: GPA 3.6 to 3.8 out of 4.0 UK 2:1 degree: GPA 3.0 to 3.2 out of 4.0 UK 2:2 degree: GPA 2.67 to 2.8 out of 4.0

Offer conditions will vary depending on the institution you are applying from and the degree that you study.

Iran We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 17.5 to 18.5 out of 20 UK 2:1 degree: 15 to 16 out of 20 UK 2:2 degree: 13.5 to 14 out of 20

Iraq We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from a recognised institution. UK 1st class degree: 85 out of 100 UK 2:1 degree: 75 out of 100 UK 2:2 degree: 60 out of 100

Ireland We normally consider the following qualifications for entry to our postgraduate taught programmes: Honours Bachelor Degree from a recognised institution. UK 1st class degree: First Class Honours UK 2:1 degree: Second Class Honours Grade I UK 2:2 degree: Second Class Honours Grade II

Israel We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 90% UK 2:1 degree: 80% UK 2:2 degree: 65%

Italy We normally consider the following qualifications for entry to our postgraduate taught programmes: Laurea (180 ECTS credits) from a recognised institution. UK 1st class degree: 110 out of 110 UK 2:1 degree: 105 out of 110 UK 2:2 degree: 94 out of 110

Cote D’ivoire (Ivory Coast) We normally consider the following qualifications for entry to our postgraduate taught programmes: Diplome d'Ingenieur; Doctorat en Medicine; Maitrise; Master; Diplome d'Etudes Approfondies; or Diplome d'Etudes Superieures Specialisees from selected institutions. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Jamaica We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from the University of West Indies (UWI) or a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0; or First Class Honours from the UWI UK 2:1 degree: GPA 3.0 out of 4.0; or Upper Second Class Honours from the UWI UK 2:2 degree: GPA 2.4 out of 4.0; or Lower Second Class Honours from the UWI

Japan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions. UK 1st class degree: S overall* or A overall**; or 90%; or GPA 3.70 out of 4.00 UK 2:1 degree: A overall* or B overall**; or 80%; or GPA 3.00 out of 4.00 UK 2:2 degree: B overall* or C overall**; or 70%; or GPA 2.3 out of 4.00

*Overall mark is from the grading scale: S, A, B, C (S is highest mark) **Overall mark is from the grading scale: A, B, C, D (A is highest mark)

Jordan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 85%; or GPA of 3.7 out of 4.0 UK 2:1 degree: 75%; or GPA of 3.0 out of 4.0 UK 2:2 degree: 70%; or GPA of 2.5 out of 4.0

Kazakhstan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma from a recognised institution. UK 1st class degree: 3.8 out of 4.0/4.33; or 4.7 out of 5 UK 2:1 degree: 3.33 out of 4.0/4.33; or 4.0 out of 5 UK 2:2 degree: 2.67 out of 4.0/4.33; or 3.5 out of 5

Kenya We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from a recognised institution. UK 1st class degree: First Class Honours; or GPA 3.6 out of 4.0 UK 2:1 degree: Second Class Honours Upper Division; or GPA 3.0 out of 4.0 UK 2:2 degree: Second Class Honours Lower Division; or GPA 2.4 out of 4.0

Kosovo We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8.5 out of 10 UK 2:2 degree: 7.5 out of 10

Kuwait We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.67 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.67 out of 4.0

Kyrgyzstan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma (minimum 4 years) from a recognised institution. UK 1st class degree: 4.7 out of 5; or GPA 3.7 out of 4 UK 2:1 degree: 4.0 out of 5; or GPA 3.0 out of 4 UK 2:2 degree: 3.5 out of 5; or GPA 2.4 out of 4

Laos We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.4 out of 4.0

Latvia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (awarded after 2002) from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 7.5 out of 10 UK 2:2 degree: 6 out of 10

Lebanon We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree; Licence; or Maitrise from a recognised institution. UK 1st class degree: 90% or Grade A; or GPA 3.7 out of 4.0; or 16 out of 20 (French system) UK 2:1 degree: 80% or Grade B; or GPA 3.0 out of 4.0; or 13 out of 20 (French system) UK 2:2 degree: 70% or Grade C; or GPA 2.5 out of 4.0; or 12 out of 20 (French system)

Lesotho We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours Degree (minimum 5 years total HE study); Masters Degree or Postgraduate Diploma from selected institutions. UK 1st class degree: 80% UK 2:1 degree: 70% UK 2:2 degree: 60%

Liberia We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 90% or GPA 3.7 out of 4.0 UK 2:1 degree: 80% or GPA 3.0 out of 4.0 UK 2:2 degree: 70% or GPA 2.4 out of 4.0

Libya We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions. UK 1st class degree: 85%; or 3.7 out of 4.0 GPA UK 2:1 degree: 75%; or 3.0 out of 4.0 GPA UK 2:2 degree: 65%; or 2.6 out of 4.0 GPA

Liechtenstein We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) from a recognised institution. UK 1st class degree: 5.6 out of 6.0 UK 2:1 degree: 5.0 out of 6.0 UK 2:2 degree: 4.4 out of 6.0

Lithuania We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 180 ECTS credits) from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 7 out of 10

Luxembourg We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Macau We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (Licenciatura) (minimum 4 years) from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Macedonia We normally consider the following qualifications for entry to our postgraduate taught programmes: Diploma of Completed Higher Education - Level VII/1 or Bachelor Degree from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8.5 out of 10 UK 2:2 degree: 7 out of 10

Madagascar We normally consider the following qualifications for entry to our postgraduate taught programmes: Maîtrise; Diplome d'Ingenieur; Diplôme d'Etat de Docteur en Médecine; Diplôme d’Etat de Docteur en Chirurgie Dentaire; Diplôme d'Études Approfondies; Diplôme de Magistère (Première Partie) – also known as Master 1; or Diplôme de Master – also known as Master 2 from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Malawi We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from selected institutions. UK 1st class degree: 80% or GPA 3.7 out of 4.0 UK 2:1 degree: 70% or GPA 3.0 out of 4.0 UK 2:2 degree: 60% or GPA 2.4 out of 4.0

Malaysia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: Class 1; or 3.7 out of 4.0 CGPA UK 2:1 degree: Class 2 division 1; or 3.0 out of 4.0 CGPA UK 2:2 degree: Class 2 division 2; or 2.6 out of 4.0 CGPA

Maldives We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (awarded from 2000) from the Maldives National University. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Malta We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Bachelor Honours Degree from a recognised institution. UK 1st class degree: First Class Honours; or Category I UK 2:1 degree: Upper Second Class Honours; or Category IIA UK 2:2 degree: Lower Second Class Honours; or Category IIB

Mauritius We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: Class I; or 70% UK 2:1 degree: Class II division I; or 60% UK 2:2 degree: Class II division II; or 50%

Offer conditions will vary depending on the grading scale used by your institution.

Mexico We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado/ Titulo (Profesional) de [subject area] from a recognised institution. UK 1st class degree: 9.0 to 9.5 out of 10 UK 2:1 degree: 8.0 to 8.5 out of 10 UK 2:2 degree: 7.0 to 7.5 out of 10

Offer conditions will vary depending on the grading scale your institution uses.

Moldova We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (Diploma de Licenta) from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 6.5 out of 10

Monaco We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Mongolia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from selected institutions. UK 1st class degree: GPA 3.6 out of 4.0; or 90%; or grade A UK 2:1 degree: GPA 3.2 out of 4.0; or 80%; or grade B UK 2:2 degree: GPA 2.8 out of 4.0; or 70%; or grade C

Montenegro We normally consider the following qualifications for entry to our postgraduate taught programmes: Diploma of Completed Academic Undergraduate Studies; Diploma of Professional Undergraduate Studies; or Advanced Diploma of Higher Education from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8.5 out of 10 UK 2:2 degree: 7 out of 10

Morocco We normally consider the following qualifications for entry to our postgraduate taught programmes: Diplome d'Ecoles Nationales de Commerce et de Gestion; Diplome de Docteur Veterinaire; Doctorat en Medecine; Docteur en Medecine Dentaire; Licence; Diplome d'Inegeniuer d'Etat; Diplome de Doctorat en Pharmacie; or Maitrise from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 13 out of 20 UK 2:2 degree: 11 out of 20

Mozambique We normally consider the following qualifications for entry to our postgraduate taught programmes: Grau de Licenciado (minimum 4 years) or Grau de Mestre from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Myanmar We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 80% or GPA of 4.7 out of 5.0 UK 2:1 degree: 70% or GPA of 4.0 out of 5.0 UK 2:2 degree: 60% or GPA of 3.5 out of 5.0

Namibia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours Degree or Professional Bachelor Degree (NQF level 8 qualifications) - these to be awarded after 2008 from a recognised institution. UK 1st class degree: 80% UK 2:1 degree: 70% UK 2:2 degree: 60%

Nepal We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from selected institutions. UK 1st class degree: 80%; or GPA 3.7 out of 4.0 UK 2:1 degree: 65%; or GPA 3.0 out of 4.0 UK 2:2 degree: 55%; or GPA of 2.4 out of 4.0

Bachelor in Nursing Science are not considered equivalent to UK Bachelor degrees.

Netherlands We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 8 out of 10 UK 2:1 degree: 7 out of 10 UK 2:2 degree: 6 out of 10

New Zealand We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) or Bachelor Honours Degree from a recognised institution. UK 1st class degree: A-*; or First Class Honours** UK 2:1 degree: B*; or Second Class (Division 1) Honours** UK 2:2 degree: C+*; or Second Class (Division 2) Honours**

*from a Bachelor degree **from a Bachelor Honours degree

Nigeria We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions. UK 1st class degree: GPA 4.50 out of 5.00; or GPA 6.0 out of 7.0 UK 2:1 degree: GPA 3.50 out of 5.00; or GPA 4.6 out of 7.0 UK 2:2 degree: GPA 2.80 out of 5.00; or GPA 3.0 out of 7.0

Norway We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) from a recognised institution. UK 1st class degree: Overall B grade with at least 75 ECTS (of 180 ECTS min overall) at grade A or above. UK 2:1 degree: Overall B grade UK 2:2 degree: Overall C grade

Oman We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Pakistan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from selected institutions. UK 1st class degree: GPA 3.0 to 3.8 out of 4.0 UK 2:1 degree: GPA 2.6 to 3.6 out of 4.0 UK 2:2 degree: GPA 2.0 to 3.0 out of 4.0

Palestine, State of We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 90% or GPA 3.7 out of 4.0 UK 2:1 degree: 80% or GPA 3.0 out of 4.0 UK 2:2 degree: 70% or GPA 2.4 out of 4.0

Panama We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado / Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 91% UK 2:1 degree: 81% UK 2:2 degree: 71%

Papua New Guinea We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours Degree from a recognised institution. UK 1st class degree: Class I UK 2:1 degree: Class II, division A UK 2:2 degree: Class II, division B

Paraguay We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado / Titulo de [professional title] (minimum 4 years) from a recognised institution. UK 1st class degree: 4.7 out of 5 UK 2:1 degree: 4 out of 5 UK 2:2 degree: 3.5 out fo 5

Peru We normally consider the following qualifications for entry to our postgraduate taught programmes: Grado Academico de Bachiller or Titulo de Licenciado/ Titulo (Professional) de [subject area] from a recognised institution. UK 1st class degree: 17 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Philippines We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions or Juris Doctor; Bachelor of Laws; Doctor of Medicine; Doctor of Dentistry/ Optometry/ Veterinary Medicine; or Masters Degree from recognised institutions. UK 1st class degree: 3.6 out of 4.0; or 94%; or 1.25 out of 5 UK 2:1 degree: 3.0 out of 4.0; or 86%; or 1.75 out of 5 UK 2:2 degree: 2.5 out of 4.0; or 80%; or 2.5 out of 5

The above 'out of 5' scale assumes  1 is highest mark and 3 is the pass mark.

Poland We normally consider the following qualifications for entry to our postgraduate taught programmes: Licencjat or Inzynier (minimum 3 years) - these must be awarded after 2001 from a recognised institution. UK 1st class degree: 4.8 out of 5.0 UK 2:1 degree: 4.5 out of 5.0 UK 2:2 degree: 3.8 out of 5.0

The above grades are based on the 2 to 5 scale, where 3 is the pass mark and 5 is the highest mark.

Portugal We normally consider the following qualifications for entry to our postgraduate taught programmes: Licenciado (minimum 180 ECTS credits) or Diploma de Estudos Superiores Especializados (DESE) from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 14 out of 20 UK 2:2 degree: 12 out of 20

Puerto Rico We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from a recognised institution. UK 1st class degree: 90/100 or GPA 3.7 out of 4.0 UK 2:1 degree: 80/100 or GPA 3.0 out of 4.0 UK 2:2 degree: 70/100 or GPA 2.4 out of 4.0

Qatar We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0; or GPA 4.4 out of 5.0 UK 2:1 degree: GPA 3.0 out of 4.0; or GPA 3.6 out of 5.0 UK 2:2 degree: GPA 2.4 out of 4.0; or GPA 2.8 out of 5.0

Romania We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 180 ECTS credits) from a recognised institution. UK 1st class degree: 9.75 out of 10 UK 2:1 degree: 8.0 out of 10 UK 2:2 degree: 7.0 out of 10

Russia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma from a recognised institution. UK 1st class degree: 4.7 out of 5 UK 2:1 degree: 4.0 out of 5 UK 2:2 degree: 3.5 out of 5

Rwanda We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours Degree (minimum 4 years) from a recognised institution. UK 1st class degree: 85%; or 17 out of 20 UK 2:1 degree: 70%; or 15 out of 20 UK 2:2 degree: 60%; or 13 out of 20

Saudi Arabia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 4.75 out of 5.0; or GPA 3.75 out of 4.0 UK 2:1 degree: GPA 3.75 out of 5.0; or GPA 3.0 out of 4.0 UK 2:2 degree: GPA 3.0 out of 5.0; or GPA 2.4 out of 4.0

Senegal We normally consider the following qualifications for entry to our postgraduate taught programmes: Maîtrise; Master II; Diplôme d'Études Approfondies (DEA); Diplôme d'Études Supérieures Specialisées (DESS); Diplôme d'État de Docteur en Médecine; Diplôme d'Ingénieur; Diplôme de Docteur en Chirurgie Dentaire; or Diplôme de Pharmacien from a recognised institution. UK 1st class degree: 16/20 UK 2:1 degree: 14/20 UK 2:2 degree: 12/20

Serbia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Advanced Diploma of Higher Education from a recognised institution. UK 1st class degree: 9 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 7 out of 10

Sierra Leone We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (Honours) or a Masters degree from a recognised institution. UK 1st class degree: First Class honours; or GPA 4.7 out of 5; or GPA 3.75 out of 4 UK 2:1 degree: Upper Second Class honours; or GPA 4 out of 5; or GPA 3.25 out of 4 UK 2:2 degree: Lower Second Class Honours; or GPA 3.4 out of 5; or GPA 2.75 out of 4

Singapore We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) or Bachelor Honours degree from selected institutions. UK 1st class degree: GPA 4.3 out of 5.0; or GPA 3.6 out of 4.0 UK 2:1 degree: GPA 3.8 out of 5.0; or GPA 3.0 out of 4.0 UK 2:2 degree: GPA 3.3 out of 5.0; or GPA 2.5 out of 4.0

Slovakia We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (180 ECTS credits) (minimum 3 years) from a recognised institution. UK 1st class degree: 93%; or 1 overall (on 1 to 4 scale, where 1 is highest mark) UK 2:1 degree: 86%; or 1.5 overall (on 1 to 4 scale, where 1 is highest mark) UK 2:2 degree: 72%; or 2.5 overall (on 1 to 4 scale, where 1 is highest mark)

Slovenia We normally consider the following qualifications for entry to our postgraduate taught programmes: Univerzitetni Diplomant (180 ECTS credits) (minimum 3 years) from a recognised institution. UK 1st class degree: 9.5 out of 10 UK 2:1 degree: 8 out of 10 UK 2:2 degree: 7 out of 10

Somalia Bachelor degrees from Somalia are not considered for direct entry to our postgraduate taught programmes. Holders of Bachelor degrees from Somali National University can be considered for our Pre-Masters programmes on a case by case basis.

South Africa We normally consider the following qualifications for entry to our postgraduate taught programmes: NQF Level 8 qualifications such as Bachelor Honours degrees or Professional Bachelor degrees from a recognised institution. UK 1st class degree: 75% UK 2:1 degree: 70% UK 2:2 degree: 60%

South Korea We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) from a recognised institution. UK 1st class degree: GPA 4.2 out of 4.5; or GPA 4.0 out of 4.3; or GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.5 out of 4.5; or GPA 3.3 out of 4.3; or GPA 3.2 out of 4.0 UK 2:2 degree: GPA 3.0 out of 4.5; or GPA 2.8 out of 4.3; or GPA 2.5 out of 4.0

Spain We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo Universitario Oficial de Graduado en [subject area] (Grado) or Titulo Universitario Oficial de Licenciado en [subject area] (Licenciatura) from a recognised institution. UK 1st class degree: 8.0 out of 10; or 2.5 out of 4.0 UK 2:1 degree: 7.0 out of 10; or 2.0 out of 4.0 UK 2:2 degree: 6.0 out of 10; or 1.5 out of 4.0

Sri Lanka We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (Special or Honours) or Bachelor Degree (Professional) (minimum 4 years) from a recognised institution. UK 1st class degree: GPA 3.5 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.4 out of 4.0

Sudan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Honours degree from a recognised institution or Bachelor degree in one of the following Professional subjects: Architecture; Dentistry; Engineering; Medicine/Surgery from a recognised institution. UK 1st class degree: 80% UK 2:1 degree: 65% UK 2:2 degree: 60%

Sweden We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (Kandidatexamen) or Professional Bachelor Degree (Yrkesexamenfrom) (180 ECTS credits) from a recognised institution. UK 1st class degree: Overall B grade with at least 75 ECTS at grade A or above (180 ECTS minimum overall); or at least 65% of credits graded at VG overall UK 2:1 degree: Overall B grade (180 ECTS minimum overall); or at least 50% of credits graded at VG overall UK 2:2 degree: Overall C grade (180 ECTS minimum overall); or at least 20% of credits graded at VG overall.

Switzerland We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor degree (180 ECTS credits) from a recognised institution. UK 1st class degree: 5.5 out of 6; or 9 out of 10 UK 2:1 degree: 5 out of 6; or 8 out of 10 UK 2:2 degree: 4.25 out of 6; or 7 out of 10

Syria We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 85% UK 2:1 degree: 75% UK 2:2 degree: 65%

Taiwan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from selected institutions. UK 1st class degree: 85 to 90% UK 2:1 degree: 70 to 75% UK 2:2 degree: 65 to 70%

Tajikistan We normally consider the following qualifications for entry to our postgraduate taught programmes: Specialist Diploma or Masters Degree from a recognised institution. UK 1st class degree: 4.7 out of 5 UK 2:1 degree: 4.0 out of 5 UK 2:2 degree: 3.5 out of 5

Tanzania We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 4.4 out of 5.0 UK 2:1 degree: GPA 3.5 out of 5.0 UK 2:2 degree: GPA 2.7 out of 5.0

Thailand We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.40 to 3.60 out of 4.00 UK 2:1 degree: GPA 3.00 to 3.20 out of 4.00 UK 2:2 degree: GPA 2.40 to 2.60 out of 4.00

Offer conditions will vary depending on the institution you are applying from.

Trinidad and Tobago We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0; or First Class Honours from the University of West Indies UK 2:1 degree: GPA 3.0 out of 4.0; or Upper Second Class Honours from the University of West Indies UK 2:2 degree: GPA 2.4 out of 4.0; or Lower Second Class Honours from the University of West Indies

Tunisia We normally consider the following qualifications for entry to our postgraduate taught programmes: Licence; Diplome National d'Architecture; Maitrise; Diplome National d'Ingeniuer; or Doctorat en Medecine / Veterinaire from a recognised institution. UK 1st class degree: 16 out of 20 UK 2:1 degree: 13 out of 20 UK 2:2 degree: 11 out of 20

Turkey We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.40 to 3.60 out of 4.00 UK 2:1 degree: GPA 2.80 to 3.00 out of 4.00 UK 2:2 degree: GPA 2.30 to 2.50 out of 4.00

Turkish Republic of Northern Cyprus We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.60 out of 4.00 UK 2:1 degree: GPA 3.00 out of 4.00 UK 2:2 degree: GPA 2.50 out of 4.00

Turkmenistan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Diploma of Higher Education (awarded after 2007) from a recognised institution. UK 1st class degree: 4.7 out of 5 UK 2:1 degree: 4.0 out of 5 UK 2:2 degree: 3.5 out of 5

Turks and Caicos Islands We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (accredited by the Council of Community Colleges of Jamaica) from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0; or 80% UK 2:1 degree: GPA 3.3 out of 4.0; or 75% UK 2:2 degree: GPA 2.7 out of 4.0; or 65%

Uganda We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 3 years) from a recognised institution. UK 1st class degree: GPA 4.4 out of 5.0 UK 2:1 degree: GPA 4.0 out of 5.0 UK 2:2 degree: GPA 3.0 out of 5.0

Ukraine We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree or Specialist Diploma from a recognised institution. UK 1st class degree: 10 out of 12; or 4.7 out of 5 UK 2:1 degree: 8 out of 12; or 4.0 out of 5 UK 2:2 degree: 6 out of 12; or 3.5 out of 5

United Arab Emirates We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.0 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

United States of America We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: GPA 3.7 out of 4.0 UK 2:1 degree: GPA 3.2 out of 4.0 UK 2:2 degree: GPA 2.5 out of 4.0

Uruguay We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado/ Titulo de [subject area] (minimum 4 years) from a recognised institution. UK 1st class degree: 10 to 11 out of 12 UK 2:1 degree: 7 to 9 out of 12 UK 2:2 degree: 6 to 7 out of 12

Uzbekistan We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) or Specialist Diploma from a recognised institution. UK 1st class degree: 90%; or 4.7 out of 5 UK 2:1 degree: 80%; or 4.0 out of 5 UK 2:2 degree: 71%; or 3.5 out of 5

Venezuela We normally consider the following qualifications for entry to our postgraduate taught programmes: Titulo de Licenciado/ Titulo de [subject area] from a recognised institution. UK 1st class degree: 81% UK 2:1 degree: 71% UK 2:2 degree: 61%

Non-percentage grading scales, for example scales out of 20, 10, 9 or 5, will have different requirements. 

Vietnam We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree from a recognised institution. UK 1st class degree: 8.0 out of 10; or GPA 3.7 out of 4 UK 2:1 degree: 7.0 out of 10; or GPA 3.0 out of 4 UK 2:2 degree: 5.7 out of 10; or GPA 2.4 out of 4

Yemen We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters (Majister) degree from a recognised institution. UK 1st class degree: 90% UK 2:1 degree: 80% UK 2:2 degree: 65%

Bachelor Degrees from Lebanese International University (in Yemen) can be considered for entry to postgraduate taught programmes - please see Lebanon for guidance on grade requirements for this.

Zambia We normally consider the following qualifications for entry to our postgraduate taught programmes: Masters Degree from a recognised institution. UK 1st class degree: 75%; or GPA 3.7 out of 4.0 UK 2:1 degree: 65%; or GPA 3.0 out of 4.0 UK 2:2 degree: 55%; or GPA 2.4 out of 4.0

Zimbabwe We normally consider the following qualifications for entry to our postgraduate taught programmes: Bachelor Degree (minimum 4 years) or Bachelor Honours degree from a recognised institution. UK 1st class degree: 75% UK 2:1 degree: 65% UK 2:2 degree: 60%

English language requirements

If you got your degree in an English speaking country or if it was taught in English, and you studied within the last five years, you might not need an English language qualification - find out more .

English language entry requirements for programmes within the William Harvey Institute

You may be able to meet the English language requirement for your programme by joining a  summer pre-sessional programme  before starting your degree.

Visas and immigration

Find out how to apply for a student visa .

Postgraduate Admissions

Related courses, health care research methods online msc, health care research methods online pgdip, health care research methods pgdip, clinical research mres.

For students

• Current Students website
• Email web access
• Make a payment
• iExeter (students)
• Programme and module information
• Current staff website
• Room Bookings
• iExeter (staff)
• Finance Helpdesk
• IT Service Desk

Popular links

Accommodation

• Job vacancies
• Temporary workers
• Future Leaders & Innovators Graduate Scheme

New and returning students

• New students website
• Returning Students Guide

Wellbeing, Inclusion and Culture

• Wellbeing services for students
• Wellbeing services for staff
• Equality, Diversity and Inclusion
• Israel, Palestine, and the Middle East

Postgraduate Taught

MSc Health Research Methods

• Postgraduate Taught home
• Healthcare and Medicine
• Health Research Methods MSc

Masters applications for 2023 entry are now closed.

Applications for September 2024 will open on Monday 25 September. Applications are now open for programmes with a January 2024 start. View our programmes »

PgDip Health Research Methods

PgCert Health Research Methods

• Develop the skills and knowledge needed to enact meaningful change as an effective and confident healthcare practitioner.
• Designed for health researchers, academic clinical fellows, nurses, midwives, allied healthcare professionals and public health professionals.
• Also suitable for new graduates seeking a comprehensive grounding in health services research methods to develop your career as a health researcher.
• Study topics such as patient and public involvement, collaborative working, evidence-based practice, complex interventions, health economics, clinical trials and medical statistics.
• Taught by leading international experts and authors in complex interventions research methods.

Play a vital role in making health services better. Constant changes in healthcare means that highly skilled researchers are in-demand for developing, testing, evaluating and implementing evidence-based healthcare in highly complex situations.

By studying MSc Health Research Methods, you could help solve important problems to deliver better, safer and more accessible healthcare to the population.

Previous topics that students have chosen for independent study include:

• Exploring facilitators and barriers of patients’ trust in clinical pharmacists in Primary Care.
• Improving the physical health monitoring of patients taking Clozepine.
• Intravenous antimicrobial therapy in the home.
• Effectiveness of group psychological interventions in reducing the burden for caregivers of patients with dementia residing in the community.

Apply online

View 2024 Entry

Apply for individual modules 2023/24

Fast Track (current Exeter students)

Accreditation of prior learning (APL)

Open days and visiting us

Get a prospectus

Programme Director: Dr Antonieta Medina-Lara

Web: Enquire online

Phone: +44 (0)1392 72 72 72

This programme is delivered at our St Luke’s Campus, which is home to the University of Exeter Medical School. The campus is a short walk from the Royal Devon and Exeter Hospital and offers a range of research facilities and equipment. Students will be able to access resources used by our  Institute of Health Research.

Top 10 in the UK for our world-leading and internationally excellent Clinical Medicine research

Based on 4* + 3* research in REF 2021

Our Public Health research is 11th in the UK for Research Power

Submitted to UoA2 Public Health, Health Services and Primary Care. REF 2021

Major capital investment in new buildings and state-of-the-art facilities

Vibrant and active research student community supported by excellent pastoral and academic staff 

Entry requirements

Normally a minimum 2.2 Honours degree (or equivalent) in a relevant discipline. Relevant clinical or professional experience may be taken into consideration as evidence of equivalency.  A personal statement, detailing your reasons for seeking to undertake this subject, will be required. 

Please visit our   entry requirements section   for equivalencies from your country and further information on   English language requirements. Please visit our  international equivalency pages  to enable you to see if your existing academic qualifications meet our entry requirements.

International students are normally subject to visa regulations which prevent part-time study. It is recommended that international students apply for the level of the final award you intend to complete i.e. PGCert, PGDip or Masters, due to the associated cost and requirements for a Tier 4 student Visa.

Accreditation of prior learning for Masters courses in Healthcare and Medicine

Accreditation of Prior Learning (APL) is a process whereby students, who have already gained relevant skills and knowledge prior to the start of their course, may be granted a partial credit exemption from their programme instead of unnecessarily repeating work. Find out more about APL .

Entry requirements for international students

Please visit our entry requirements section for equivalencies from your country and further information on English language requirements .

English language requirements

International students need to show they have the required level of English language to study this course. The required test scores for this course fall under Profile B2 . Please visit our English language requirements page to view the required test scores and equivalencies from your country.

Course content

The programme is divided into units of study called ‘modules’ which are assigned a number of ‘credits’. The credit rating of a module is proportional to the total workload, with one credit being nominally equivalent to 10 hours of work, a 15 credit module being equivalent to 150 hours of work and a full Masters degree being equivalent to approximately 1,800 hours of work. Therefore, for applicants who are working full time (or close to full-time), we recommend applying to complete the Masters degree over 2 or 3 years rather than 1 year. To gain a Masters qualification, you will need to complete 180 credits at level 7.

It is also possible to exit with a PGCert after completing 60 credits of taught modules or a PGDip after completing 120 credits of taught modules. The list of modules below shows which are compulsory.

Contact days

Health Research Methods timetable 2023/24

Health Research Methods timetable 2024/25

(Please note: timetables are draft and subject to change)

The last contact day and assessment deadline for the programme will be earlier than the actual end date of your registration with the University, to allow a period of time at the end of your active studies for further support and mitigation, if needed.

The modules we outline here provide examples of what you can expect to learn on this degree course based on recent academic teaching. The precise modules available to you in future years may vary depending on staff availability and research interests, new topics of study, timetabling and student demand.

Full time 1 year

Part time 2 years

Part time 3 years

2024/25 entry

Uk fees per year:.

• MSc :   £11,600 full-time, £5,800pa part-time 2 years, £3,900pa part-time 3 years
• PgDip:  £3,900pa part-time 2 years
• PgCert:    £3,900

Standalone module fees: UK: £1,100 per 15-credit module

International fees per year:

• MSc:   £27,500 full-time,  £13,750pa part-time 2 years,   £9,250 pa part-time 3 years
• PgDip:    £9,250pa part-time 2 years
• PgCert:  £9,250

Standalone module fees: International: £2,500 per 15-credit module Find out more about tuition fees and funding

Fee information

Fees can normally be paid by two termly instalments and may be paid online. You will also be required to pay a tuition fee deposit to secure your offer of a place, unless you qualify for  exemption . For further information about paying fees see our  Student Fees  pages.

Scholarships

For more information on scholarships, please visit our scholarships and bursaries page.

*Selected programmes only. Please see the Terms and Conditions for each scheme for further details.

Find out more about tuition fees and funding »

Funding and scholarships

Uk government postgraduate loan scheme.

Postgraduate loans of up to £12,167 are now available for Masters degrees.   Find out more about eligibility and how to apply.

There are various funding opportunities available including the Medical School's Global excellence scholarships for international fee paying students. For more information visit our   Masters funding page .

Pro Vice Chancellor's NHS Postgraduate Scholarship

The Faculty of Health and Life Sciences is delighted to offer the Pro Vice Chancellor's NHS Postgraduate Scholarship of £5000 to up to four NHS staff who accept a place to study on one of our Masters programmes. Please check your eligibility before applying.

University of Exeter Class of 2022 Progression Scholarship

We are pleased to offer graduating University of Exeter students completing their degree in Summer 2022 and progressing direct to a standalone taught Masters degree (eg MA; MSc; MRes; MFA) or research degree (eg MPhil/PhD) with us a scholarship towards the cost of their tuition fees. These awards are worth 10% of the first year tuition fee for students enrolling on a postgraduate taught or research programme of study in 2022/23, with the exception of the PGCE programme.  Find out more

Teaching and research

Our purpose is to deliver transformative education that will help tackle health challenges of national and global importance.

The taught component of this programme is delivered in the first two terms (one year programme) or five terms (two year programme). During this time you’ll also be helped to develop a dissertation project to be completed in the remaining six months.

Teaching and learning methods

All material is designed for Masters-level and will involve keynote lectures, case studies, seminars and group discussion. Within modules there is considerable scope for you to direct your learning towards fields of particular interest, especially through your choice of dissertation project and in your guided independent study.

Short assessments are tailored to each module, with some assessment taking place in class, and others requiring electronic submission of assignments towards the end of a module.

Advice and support

One-to-one tutorials with module leads are timetabled into each of the four taught modules to ensure that you’ll receive personalised support. The Programme Lead is also available to help you with further guidance and advice.

Associate Professor Rob Anderson

Professor of health services and implementation research.

Dr Julia Frost

Senior lecturer health services research.

Rebecca Whear

Co-lead for the module "systematic reviews for policy and practice".

Rob is module co-lead for  the core module  Fundamentals of Research Design .  He is an applied health services researcher and implementation scientist with a particular interest in the evaluation and synthesis of evidence about health policies and  complex health interventions , such as public health programmes and changes in service organisation and delivery.  

He has  over 20 years' experience as a health services researcher, economic evaluator, and implementation science scholar in both the UK NHS and the Australian health system.  

Julia has been a medical sociologist since 1999. She is a Senior Lecturer in Health Services Research in the Third Gap research group. She undertakes research about health service delivery and patient experience, using qualitative and mixed methods. She is module lead for   Qualitative Methods and Process Evaluations  and co-leads on   Fundamentals of Research Design . She is currently qualitative lead on two NIHR funded studies: SAMUEL: Use of simulation and machine learning to identify key levers for maximising the disability benefit of intravenous thrombolysis in acute stroke pathways; and PARTNERS2: collaborative care for people with severe mental illness.  

Profile page

Rebecca is a Research Fellow and co-lead for the module:  Systematic Reviews for Policy and Practice . She has many years of experience in social and health related research. Latterly, she has mainly focused on systematic reviews but in the past has been involved with small pieces of quantitative and qualitative primary research. Her main areas of interest include improving healthcare for patients and the NHS, the mental health and behaviour of young people, and dementia and dementia care.

This programme is designed for a wide range of participants. It will enable health professionals from a variety of disciplines to gain expertise and become a more effective and confident practitioner. It is suitable for health researchers, academic clinical fellows, nurses, midwives, allied healthcare professionals and public health professionals. It is also suitable for new graduates (e.g. Medical Science, Psychology, Sociology, Geography) who wish to gain a comprehensive grounding in health services research methods as a platform for developing a career as a health researcher. 

Careers support

All University of Exeter students have access to  Career Zone , where you’ll gain access to our wealth of business contacts, support and training as well as the opportunity to meet potential employers at our regular Careers Fairs.

Related courses

Environment and human health msc.

St Luke's Campus

Healthcare Leadership and Management MSc

Clinical education msc, master of public health (mph).

View all Healthcare and Medicine courses

Why Exeter?

Student life

Our campuses

International students

Apply for a Masters

Immigration and visas

Tuition fees and funding

Connect with us

Information for:

• Current students
• New students
• Alumni and supporters

Quick links

Streatham Campus

Penryn Campus

Truro Campus

• Using our site
• Accessibility
• Freedom of Information
• Modern Slavery Act Statement
• Data Protection
• Copyright & disclaimer
• Privacy & cookies

Streatham Campus in Exeter

The majority of students are based at our Streatham Campus in Exeter. The campus is one of the most beautiful in the country and offers a unique environment in which to study, with lakes, parkland, woodland and gardens as well as modern and historical buildings.

Find out more about Streatham Campus.

St Luke's Campus in Exeter

Located on the eastern edge of the city centre, St Luke's is home to Sport and Health Sciences, the Medical School, the Academy of Nursing, the Department of Allied Health Professions, and PGCE students.

Find out more about St Luke's Campus.

Penryn Campus near Falmouth, Cornwall

Our Penryn Campus is located near Falmouth in Cornwall. It is consistently ranked highly for satisfaction: students report having a highly personal experience that is intellectually stretching but great fun, providing plenty of opportunities to quickly get to know everyone.

Find out more about Penryn Campus.

Module details

MSc Clinical Research Methods and Evidence-Based Medicine

This part-time MSc programme gives you the opportunity to complete a personalised and relevant master's-level degree that requires minimal study time away from clinical practice. It makes use of motivated and experienced clinical academics to deliver a programme that will translate to excellent, individualised academic surgical practice. The programme complements your clinical career, will expand your academic skills and offers the flexibility to focus on areas of practice that are relevant to your career plans.

The programme is divided into clinical, research methods and research project modules, all of which are completed on a part-time basis. The clinical component is designed with practical clinical relevance in mind. You will direct your own learning towards topics that you are interested in and are relevant to your career. You will choose one of the following sub-speciality areas of medicine according to the clinical related speciality of specialist doctor and surgical trainees:

• Trauma and Orthopaedic surgery;
• Anaesthetics and intensive care;
• Renal medicine;
• General surgery;
• Obstetrics and Gynaecology;
• Vascular surgery;
• Oncoplastic surgery.

You will be registered on the overarching degree, and then transfer onto the pathway title of your chosen sub-speciality area of medicine.

Learning is assessed through oral presentations, poster presentations and reflective writing, which requires minimal time away from patient care and mirrors the professional activities of a specialist doctor and surgical clinician scientist. The research methods component comprises seminars in techniques of critical appraisal, trial design, data manipulation and analysis. A combination of formative and programme-level assessment will be used to demonstrate what you have learned.

The research project module offers an opportunity to carry out and deliver a high-quality study with academic supervision; the expectation is that this work would be submitted for publication in a peer-reviewed journal.

On demand academic talks

Hear directly from an academic giving you a deeper insight into this programme.

Programme structure

Clinical modules (20 credits each): Within your chosen sub-speciality area of medicine, you will complete four clinical units, each lasting six months (part-time), selecting topics within your field to study in greater depth. The four clinical units are designed to run alongside your clinical training rotations. These will allow you to focus on specific topic areas that are most relevant for your career.

Research Methods (20 credits each): The two compulsory research methods units will train you in research skills that are translatable to clinical practice, and will inform the conduct of your clinical and research project units.

Research Project (60-credit unit): The research project runs alongside the six other units. It enables you to employ the skills learned in the other components of the programme to produce a quality piece of academic writing, which would normally be either a systematic review of a clinical problem, a technique explored during the clinical elements, or a novel piece of work using novel data.

This is a part-time programme requiring weekday attendance in person (at Southmead Hospital) once a month for lectures and seminars. The annual examination day requires attendance on a weekday. Meetings with supervisors are to coincide with attendance for learning activities.

Visit our programme catalogue for full details of the structure and unit content for our MSc in Clinical Research Methods and Evidence-based Medicine.

World-leading research

The University of Bristol is ranked fifth for research in the UK ( Times Higher Education ).

94% of our research assessed as world-leading or internationally excellent.

Entry requirements

A bachelor's degree with honours, or international equivalent, in a medical degree - including MBBS, BMBS, MBChB, MBBCh, MD. We especially welcome applications from clinical trainees, with any specialism, although this is not a requirement.

See international equivalent qualifications on the International Office website.

Read the programme admissions statement for important information on entry requirements, the application process and supporting documents required.

If English is not your first language, you will need to reach the requirements outlined in our  profile level B.

Further information about  English language requirements and profile levels .

Fees and funding

Fees are subject to an annual review. For programmes that last longer than one year, please budget for up to an 8% increase in fees each year.

More about tuition fees, living costs and financial support .

Alumni discount

University of Bristol students and graduates can benefit from a 25% reduction in tuition fees for postgraduate study.  Check your eligibility for an alumni discount.

Funding for 2024/25

Further information on funding for prospective UK and international postgraduate students.

Career prospects

Students participating in this programme will already be enrolled in core or higher surgical training, with the expectation that they will complete their training within orthopaedic surgery and combine this with an academic surgical practice.

How to apply

Apply today via our online application system. For further information, please see the guidance for how to apply on our webpages.

Overseas applicants: 24 July 2024. Home applicants: 9 August 2024.

Please note that due to high demand, some programmes may close earlier than advertised. Early applications are advised to avoid disappointment. Places are limited and allocated on a continuous basis from September 2023 until all places are filled.

Faculty of Health Sciences

Bristol Medical School

Explore more

Explore events, take a virtual tour, make an enquiry.

• Responsibilities
• Printed Material
• Application Forms
• Presentations
• Geographical Distribution
• Active Agreements
• Completed Agreements
• Universities Incoming
• Practical information for incoming students
• International Presence
• Press Releases
• From International Organizations
• From Collaborating Universities
• From the International Relations Department
• Calls for Scholarships
• International Conferences
• Photo Gallery
• Quality Policy

Τμήμα Διεθνών Σχέσεων

Call for applications for the MSc in Medical Research Methodology

The Medical School of Aristotle University of Thessaloniki (AUTh) is launching a Postgraduate Course ( MSc ) in “Medical Research Methodology” for the eighth consecutive year (Government Gazette t.B ‘3456 / 19.08.2020). The purpose of the program is to train a wide range of scientists in cutting-edge methodologies and technologies, which will help them design and conduct research projects, promoting their academic and professional careers. The main features of this MSc, which make it especially attractive, are:

• Short duration: From February to January (12 months), students will have completed a total of 75 credits (ECTS), corresponding to the five (5) compulsory (Introduction to Statistics, Clinical Research Methodology, Basic Research Methodology, How to write a paper or a grant proposal, Introduction to Bioethics-Publication ethics) and in the three (3) selected courses (selected from: Advanced Statistics, Systematic Review and Meta-analysis, Computational Medical Research, Data Mining, Advanced Techniques in Medical Research, Qualitative Research, Clinical Trials), including a thesis (MSc thesis).

• Blended form: Combination of onsite and online learning in order to enable better time management. Only three (3) weeks of physical presence are required (one week in February, one in April and one in June).

• English language: To ensure an international group of distinguished tutors and an international class of fellow students, all modules are held in English.

• Competitive price: Fees are paid in three divided installments, making this MSc an attractive and affordable option for busy professionals.

Potential students include medical doctors, dentists, veterinarians, biologists, molecular biologists, bio-engineers, biochemists, pharmacists, nurses, pharmaceutical industry or health economics professionals.

For further information, please, visit mrm.med.auth.gr and contact MSc secretariat at [email protected] . New application forms for the academic year 2023-2024 for the MSc in Medical Research Methodology are available at the website mrm.med.auth.gr and will be accepted during the period 1/9-31/10/2023. Number of accepted students: 35

In addition, for third consecutive year and in accordance with the relevant Government Gazette (vol. BD 3456 / 19.08.2020), the MSc accepts as “ participating visitors ” (listeners) graduates of Greek or foreign institutions of a related field, who wish to attend up to three (3) individual courses without having been admitted to the MSc. The “participating visitors” receive a certificate of attendance, once they have completed the obligations arising from the requirements of each course. Tuition fees of 600 euros (€) are paid for attending the courses. In case someone chooses to attend three (3) courses, tuition fees amount to 1,500 euros (€). Applications from “participating visitors” are accepted up to two (2) weeks before the start of the respective courses.

Yours sincerely, Kyriakos Anastasiadis Apostolos Tsapas Professor of Cardiothoracic Surgery AUTh Professor of Medicine AUTh Head of Department of Medicine AUTh Director of MSc “Medical Research Methodology”

FACULTY OF HEALTH SCIENCES | DEPARTMENT OF MEDICINE | MSC in MEDICAL RESEARCH METHODOLOGY Phone: (30) 2310 999333 | E-mail: [email protected]

Attachment: MSc Medical Research Methodology

Warwick Medical School

Clinical research (msc), want to make an impact on the world you can change lives with a career in clinical research and meaningfully improve patient care and health outcomes..

Clinical research is vital to enhancing health, lengthening life, and reducing the burdens of illness and disability. For instance, through clinical research we gain insights and answers about the safety and effectiveness of drugs and other therapies. Make a real difference and pursue a career in Clinical Research.

This Masters in Clinical Research is a multi-disciplinary programme aimed at providing you with the requisite academic knowledge to conduct research within your professional scope of practice in pharmaceutical, medical device, clinical or the academic sector. The programme covers clinical research design and methodologies, management of data, ethics, leadership, and is closely aligned to industry needs by focussing on the design and management of clinical trials.

This programme welcomes students from varied professional backgrounds from across the world, including physicians, nurses, dentists, professionals in the pharmaceutical and biotechnology industry, academicians and those who plan to conduct clinical trials.

The course offers state-of-the-art education that can be accessed anytime, anywhere and provide you with a leading edge understanding of Clinical Research.

• Who is the course for?
• Learning outcomes

Course content

• Entry requirements
• Teaching methods
• Assessments
• Student opinions

What is i-heed?

iheed is a medical education technology organisation built by doctors and healthcare professionals for doctors and healthcare professionals. iheed’s mission is to see better healthcare outcomes achieved globally by working in partnership with leading medical universities, postgraduate training bodies, and other global healthcare leaders. iheed has a strong social mission to make the best postgraduate medical education accessible through the power of modern learning methodologies and digital technologies.

Why study the iheed and University of Warwick Masters in Clinical Research Masters/ Postgraduate Diploma / Postgraduate Certificate?

• Obtain a recognised Postgraduate qualification from a top 10 UK university
• Secure local CME accreditation
• Demonstrate knowledge of trial design, delivery and assessment
• Explore theoretical and practical issues in the design and implementation of clinical trials
• Develop skills in handling and presenting clinical trial data
• Critically evaluate key aspects of how clinical trials are reviewed and reported

Postgraduate Certificate (Semester 1)

  Understanding Evidence in Practice – Semester 1 PG Cert (20 CATS)

• Introduction to evidence-based medicine.
• Exploration of study design in clinical and medical research.
• Designing research questions using accepted frameworks.
• Refining research questions through appraisal of literature.
• Assessing strengths / weaknesses and biases of study designs.
• Ethical and regulatory frameworks of clinical research.

  Clinical Research Design – Semester 1 PgCert (20 CATS)

• Application of evidence-based medicine.
• Consideration of research methodologies and study designs (quantitative, qualitative, and mixed
• Bias in research and its link to the internal and external validity standards.
• Understanding reporting guidelines for common study designs.
• Management of participants in research.
• Understanding evaluation and regulation of therapeutic agents in clinical trials.
• Data collection and data management.
• Selection of analysis techniques.
• Qualitative data analysis.
• Quantitative data analysis.
• Describing and summarising data.
• Interpretation of data.

Clinical Research Analysis - Semester 1 PgCert (20 CATS)

Postgraduate Diploma (Semester 2)

  Module 4

  Leadership in Clinical Research – Semester 2 PG Diploma (20 CATS) 

• Effective leadership in a clinical research setting
• Organisational structures in clinical research
• Organisation behaviour and organisation culture.
• Mentorship in clinical research
• Change management in research projects
• Ethical issues in clinical leadership

  Design of Clinical Trials – Semester 2 PG Diploma (20 CATS)

• Clinical Trials: Introduction and ethics in clinical trials
• Clinical Trials: Phases, contexts and ethics
• Study protocols
• Study populations and cohorts
• Clinical Trial Design: Phase I-IV designs
• Treatment allocations

Management of Person-Centred Research – Semester 2 PG Diploma (20 CATS)  

• Ethics, privacy and safety in clinical trials
• Clinical Trial management and conduct
• Measurement of clinical trials and data capture
• Data monitoring and analysis
• Reporting of Results
• Regulatory issues in clinical trials

Masters (Semester 3)

Professional Project in Clinical Research – Semester 3 M.Sc. (60 CATS)

The “Professional Project in Clinical Research” is a 60 CATS module that will enable students to identify,

understand, appraise and plan research related to clinical research. The module will cover the skills needed to identify, appraise and synthesise research evidence and develop an understanding of the implications of research for in a clinical setting. Working independently, and under limited supervision, students will then take responsibility for the direction and management of a project through to completion and submission.

The module addresses the following areas:

• Literature searching
• Formulating a research question
• Study design
• Writing a research protocol
• Presenting a research protocol

[email protected]

Level - Postgraduate

Study mode: Part-time

MSc (180 CATS):

• PgCert 6 months
• PgDip 12 months
• Masters 24 months

Qualifications: MSc/PGDip/PGCert

Location of Study: University of Warwick

For Further details please visit the website iheed.org

Sponsorships, scholarships and flexible payment options are available. Please speak with one of the iheed education advisors for more information.

Postgraduate taught

MSc Health Research

Equip yourself with the research skills to progress your career in the healthcare sector, or to design, implement and publish research

Year of entry: 2024 (September)

1 year full-time, 2 years part-time

Department of Health Sciences

September 2024 ( semester dates )

Apply for this course

Online Open Day

Join us on Wednesday 5 June 2024 to find out what postgraduate study at York is all about. 

Learn how to apply a range of research methods to current, pressing health issues and how to critically assess published research.

The skills you gain on this course will enable you to pursue a career in research through academia and/or a combination of clinical healthcare practice.

You'll graduate with a multifaceted understanding of health research that is increasingly sought after in healthcare and research environments.

The course is flexible and can be delivered on a full- or part-time basis, attracting people who might also be working alongside their study.

Research excellence

6th in the UK for research power with over 92% of our research rated as world-leading (4*) for impact (Times Higher Education ranking of the latest REF results, 2021)

Expert tuition

​Our experts help improve human health and prevent illness through the analysis and delivery of leading research.

7th in the UK

for Nursing according to the Complete University Guide 2024

Course content

Our course will equip you with a wide range of applied health research skills to enable you to become a proficient and confident researcher. You will be taught by academics who will draw on their experience to provide you with an excellent grounding in health research methods including systematic reviews, randomised controlled trials, epidemiology, health economics, statistics and qualitative methods.

• Dissertation

Core modules

• Epidemiology
• Evidence Synthesis
• Randomised Controlled Trials
• Regression Analysis

Option modules

You will study two option modules. Examples may include:

• Qualitative Research Methods
• Health Economics
• Health Policy: Systems and Society
• Advanced Regression Analysis
• Measurement in Health and Disease

Some option module combinations may not be possible.

The options available to you will be confirmed after you begin your course. For further information please  get in touch.

Our modules may change to reflect the latest academic thinking and expertise of our staff, and in line with Department/School academic planning.

You will be matched with a supervisor with complementary research interests, and together you will design an appropriate project, using the skills and techniques you have been taught in the modules.

You have substantial choice in your area of research, and for part-time students in employment, the project can represent an area that is of interest and value to your employer.

The York approach

Every course at York is built on a distinctive set of learning outcomes. These will give you a clear understanding of what you will be able to accomplish at the end of the course and help you explain what you can offer employers. Our academics identify the knowledge, skills, and experiences you'll need upon graduation and then design the course to get you there.

Students who complete this course will be able to:

• critically evaluate the key methodologies used in applied health research, taking into account quantitative, qualitative and mixed methods approaches
• critically appraise and interpret evidence, analysing the strengths and limitations of published applied health research
• formulate clear health research questions and hypotheses and independently evaluate which methodologies are most appropriate to undertake them (eg clinical trial, case-control study, cohort study or systematic review)
• undertake robust, credible quantitative and qualitative analyses of health related data, using the most appropriate analytic techniques and software packages
• independently formulate, plan and undertake a piece of research in an area related to applied heath, taking into account ethical considerations
• communicate clearly in written format, to a specialist audience, the outcomes of research, presenting complex arguments, carefully weighing evidence in reaching conclusions.

Fees and funding

Annual tuition fees for 2024/25.

Students on a Student Visa are not currently permitted to study part-time at York.

For courses which are longer than one year , the tuition fees quoted are for the first year of study.

• UK (home) fees may increase in subsequent years (up to a maximum of 2%).
• International fees may increase in subsequent years in line with the prevailing Consumer Price Index (CPI) inflation rate (up to a maximum of 10%).

Fees information

UK (home) or international fees?  The level of fee that you will be asked to pay depends on whether you're classed as a UK (home) or international student.  Check your fee status .

Find out more information about tuition fees and how to pay them.

• Postgraduate taught fees and expenses

Additional costs

Additional costs could vary depending on which modules you take. Course books are generally available from the library, but you may wish to purchase your own copies. These typically cost £10-£30 each. Depending on how you work, you may also wish to print out lecture notes or make photocopies. You will be given an allowance of free printing, but you will have to pay for any printing you do beyond this.

Funding information

Discover your funding options to help with tuition fees and living costs.

We'll confirm more funding opportunities for students joining us in 2024/25 throughout the year.

If you've successfully completed an undergraduate degree at York you could be eligible for a  10% Masters fee discount .

Funding opportunities

• UK government Masters loans
• Funding for UK students
• Funding for international students

Departmental funding 

Living costs.

You can use our  living costs guide  to help plan your budget. It covers additional costs that are not included in your tuition fee such as expenses for accommodation and study materials.

Teaching and assessment

You’ll work with world‐leading academics who’ll challenge you to think independently and excel in all that you do. Our approach to teaching will provide you with the knowledge, opportunities, and support you need to grow and succeed in a global workplace.

Teaching format

We use a variety of lectures, seminars, projects, group work and individual work to ensure that you get the most out of your time here.

Much of the teaching on this course takes place in small groups, led by a specialist in the field.

Teaching location

You will be based in the Department of Health Sciences, which is on Campus West. The majority of your teaching will take place within Alcuin College on Campus West.

About our campus

Our beautiful green campus offers a student-friendly setting in which to live and study, within easy reach of the action in the city centre. It's  easy to get around campus  - everything is within walking or pedalling distance, or you can always use the fast and frequent bus service.

Assessment and feedback

You will be assessed throughout the course in a variety of ways, including exams and a range of written assignments.

• Dr Arabella Scantlebury
• [email protected]
• +44 (0)1904 321105

Related courses

• PGCert in Health Research and Statistics

Discover York

Accommodation

We offer a range of campus accommodation to suit you and your budget, from economy to premium.

Student life

Explore campus and city life and hear what our current students have to say about living here.

Lively, full of culture and beautiful, York is regularly voted one of the best places to live and visit in the UK.

Find out more about York. Chat to staff and students and take the tour, on campus or online.

Skip to content

Read the latest news stories about Mailman faculty, research, and events. 

Departments

We integrate an innovative skills-based curriculum, research collaborations, and hands-on field experience to prepare students.

Learn more about our research centers, which focus on critical issues in public health.

Our Faculty

Meet the faculty of the Mailman School of Public Health. 

Become a Student

Life and community, how to apply.

Learn how to apply to the Mailman School of Public Health. 

Master of Science

Clinical research methods.

The Clinical Research Methods (CRM) track in Biostatistics responds to a pressing need for advanced training in clinical research design and analysis. As medical school curricula become increasingly full and apprenticeship prospects wane, pathways to becoming a clinical researcher have narrowed. This program offers talented-but-novice investigators who already have a doctoral degree a chance to master the basic principles and scientific methods essential for conducting human research studies.

The 30-credit program can be completed within one year if initiated during the summer semester. Part-time students must complete the degree in five years. Throughout their course of study, CRM students receive formal, rigorous training in skills that are critical to the design and analysis of research studies involving human subjects.

Admissions Information

Applicants to the program must hold a doctoral degree in a clinical discipline or public health field. Recent applicants have included physicians, nurses, dentists, pharmacists, and other healthcare professionals who desire careers or are actively engaged in clinical research. An applicant's undergraduate training should include a one-semester course in calculus.

Applications are due on April 1st of each calendar year, to begin studies the following summer or fall, and include transcripts from college and graduate school, a curriculum vitae, a personal statement detailing the applicant's reasons for seeking clinical research training, and three letters of reference.

View competencies, course requirements, sample schedules, and more  in our Academics section. 

Search the Columbia Directory  to find current students in the program. 

Paul McCullough, Director of Academic Programs

Graduate Studies

Health research methodology.

The program focuses on developing competency and leadership in research methodology that promotes the integration of health relevant disciplinary perspectives to create rigorous and innovative evaluation strategies and frameworks. This is facilitated by an interdisciplinary educational model that draws on faculty from across the faculties of Health Science, Science, and Social Science.

Faculty of Health Sciences

Program Contact

Degree Options

Health research methodology (msc).

A research intensive program with the goal of equipping the graduates with research methods skills that enable them to “push the boundaries of knowledge” relevant to improving clinical practice (including medical education research), strengthening health systems and enhancing population health.

Areas of Research

• Clinical epidemiology
• Health technology assessment

Students who do not wish to declare a field of specialization should enroll in HRM Classic.

Health Research Methodology (PhD)

• Biostatistics

Health Research Methodology (MD/PhD)

Alyssa vito scholarship in cancer research $.

Established in 2022 by Dr. Alyssa Vito, survivor of triple negative breast cancer and MSc/PhD McMaster alumna. To be awarded by the School of Graduate Studies, on the recommendation of the Graduate Associate Dean, Faculty of Health Sciences, to a graduate student who conducts cancer research with a component of their activities devoted to leadership, community outreach, and patient engagement. Preference will be given to students pursuing research in breast cancer.

Association of Canadian Universities for Northern Studies (ACUNS) Varied values

Varied values

ACUNS established its scholarship program, the Canadian Northern Studies Trust (CNST) in 1982 to advance knowledge and understanding of Canada’s North. The purpose of the CNST is to develop a cadre of scholars and scientists with northern experience and, at the same time, to enhance the educational opportunities available for northern residents.

For a list of scholarships and funding available, as well as eligibility criteria, award values, application details, and deadlines, visit the ACUNS website.

Autism Scholars Award $$$

Deadline Date:

December 1, 2023

With the support of the Ministry of Training, Colleges, and Universities, a scholar awards program in autism has been established to ensure that Ontario attracts and retains pre-eminent scholars. The community of autism scholars fostered by this awards program will excel, according to internationally accepted standards of scientific excellence, in the creation of new knowledge concerning child autism, and its translation into improved health for children, more effective services and products for children with autism, and increase the province’s capacity in diagnosis and assessment of autism and a strengthened treatment system.

One one-year award at the master’s level and up to two one-year awards at the doctoral level will be made by the COU:

• Master’s Award: $18,000 ($6,000 per term beginning September 2024)
• Doctoral Award: $20,000 ($6,666 per term beginning September 2024)

Brian Haynes Student Travel Award $

Established in 2019 by Dr. Brian Haynes and JoAnne E. Haynes. To be awarded to doctoral students enrolled in the Health Research Methodology program in the Faculty of Health Sciences whose peer-reviewed abstracts have been accepted for oral presentation at a national or international conference. To be awarded by the School of Graduate Studies on the recommendation of the Assistant Dean, Health Research Methodology in consultation with an ad-hoc selection committee comprised of members of the Department of Health Research Methods, Evidence and Impact.

Canada Graduate Scholarships – Michael Smith Foreign Study Supplements $$

May 22, 2024

The CGS-MSFSS supports high-calibre Canadian graduate students in building global linkages and international networks through the pursuit of exceptional research experiences abroad. By accessing international scientific research and training, CGS-MSFSS recipients will contribute to strengthening the potential for collaboration between Canadian and foreign institutions.

Please review eligibility and criteria for more information about this travel award.

If you wish to apply, please contact your department graduate administrator.

Canada-U.S. Fulbright Program

The bi-national program is an educational exchange, with a mandate to enhance mutual understanding between the people of Canada and the people of the United States of America. Available to graduate students, faculty, professionals and independent researchers, successful applicants conduct research, lecture, or enroll in formal academic programs in the United States. Fulbright Canada offers various scholarship awards within this program, with further information on the various award opportunities made available through the Canada-US Fulbright Program website.

For eligibility criteria, award values, application details and deadlines, visit the Fulbright website.

CIBC Graduate Bursaries in Breast Cancer $$

The CIBC Graduate Bursaries in Breast Cancer was established in 2004 by CIBC under the McMaster Student Opportunity Fund II initiative in support of CIBC’s belief that all students should have the opportunity to pursue their educational goals. To be granted first to students enrolled in a graduate program in the Faculty of Health Sciences who demonstrate financial need and are conducting thesis research in the field of breast cancer and alternatively to students who are conducting thesis research in the field of women’s health, obstetrics, gynecology or medical oncology. Preference will be given to full-time graduate students who have demonstrated academic excellence.

CIHR Canada Graduate Scholarship – Doctoral $$$$

October 2, 2023

McMaster internal ResearchNet deadline: October 2, 2023, 11:59 p.m.

Applications are prepared and submitted by students in ResearchNet by the internal deadline set by McMaster. You will not be able to submit your application to ResearchNet until all the required tasks are completed, including the letters from your sponsors.

We encourage you to work closely with your supervisor and department on your application. The application you submit to ResearchNet on October 2 will be the final version that will be sent to CIHR if approved by McMaster.

CIHR Postdoctoral Fellowship $$$$

September 27, 2023

Postdoctoral research opportunities funded through CIHR. E-Approval done through the Office of Postdoctoral Affairs.

Fellowships provide support for highly qualified applicants in all areas of health research at the post-PhD degree or post-health professional degree stages to add to their experience by engaging in health research either in Canada or abroad.

Up to $60,000 per annum for up to five years.

Eligibility

At the time of application, the Nominated Principal Applicant must be/have:

• a trainee, with an identified primary supervisor,
• commit 75% of your time in the research fellowship role to the proposal,
• hold or be completing a PhD degree or a regulated health professional degree by the last possible date to take up the fellowship.

General application process

Information and instructions for this year’s competition are available on SharePoint.

Applications are prepared and submitted by individuals on ResearchNet by the internal deadline set by McMaster . Please see the ResearchNet website for information on eligibility requirements, guidelines, how to apply, and information regarding the review process and evaluation.

McMaster Internal RESEARCHNET deadline: 12 p.m. EST, Wednesday, September 27, 2023

Review and Submission

Please note that applications will be returned to applicants for correction or review and final approval before they are submitted to CIHR. It is the applicant’s responsibility to resubmit their application after the internal deadline and before the McMaster final deadline for submission.

It is important to note that it is the applicant’s sole responsibility to follow up with his/her sponsors to ensure that the assessments are submitted online by their sponsors no later than 12 p.m., Monday, September 25, 2023.

McMaster Internal Final Deadline for Submission: 12 p.m., Wednesday, October 4, 2023

• CIHR deadline: October 5, 2023
• Anticipated notice of decision: April 30, 2023
• Funding start date: April 1, 2024

For questions on CIHR funding guidelines, how to apply, contact:

• Email: [email protected]
• Telephone: 613-954-1968
• Toll-Free: 1-888-603-4178

For ResearchNet technical support contact:

• Email: [email protected]
• Telephone: 613-941-9080

This competition is being managed by the Office of Postdoctoral Affairs in the School of Graduate Studies. Applicants are encouraged to contact Catherine Maybrey, coordinator of postdoctoral affairs and research training, at [email protected] for questions regarding deadlines and submissions.

Clarification of Signature Pages

• Only supervisor(s) signatures are required. Printed names should always accompany signatures.
• No institution signatures are required on the pages at the time of application, as McMaster University’s submission on your behalf acts as the institution/institution paid signature.

Scan and upload the signed signature pages, including the routing slip, as one PDF (unprotected and not exceeding 30 MB), in the Print/Upload Signature Pages task in ResearchNet prior to submitting the application

CIHR Strategic Master’s Award $$$

December 14, 2023

The CIHR Strategic Master’s Award program provides financial support to scholars who are engaged in an eligible master’s program in Canada (refer to Eligibility) and that are relevant to specific CIHR priority research areas. This support allows these scholars to concentrate on their studies in their chosen fields.

The CIHR Strategic Master’s Award program is supported by CIHR Institutes and Initiatives with specific priority areas and is administered by CIHR.

CIHR, NSERC and SSHRC Canada Graduate Scholarships – Master’s (CGS-M) $$$

The CGS M Awards Program supports students in all research disciplines and is administered jointly by Canada’s three federal granting agencies: the Canadian Institutes for Health Research (CIHR), the Natural Sciences and Engineering Research Council of Canada (NSERC), and the Social Sciences and Humanities Research Council of Canada (SSHRC). The selection process and post-award administration are carried out at the university level, under the guidance of the three agencies.

For a recorded information session about the Fall 2023 application process, click on the Learn More button.

CSA Group Graduate Scholarship $$

March 31, 2024

The purpose of the CSA Group Graduate Scholarship is to support graduate students in the pursuit of knowledge generation related to standards. Full-time graduate students at the Masters level studying at a publicly funded, accredited Canadian university are eligible to apply.

The research can be conducted in any field (e.g. engineering, social sciences, health sciences) and must include standards as a component of the research. The topic does not need to be related to an area in which CSA Group already has standards. The research may investigate aspects of an existing standard or may explore an area for future standards development.

Dr. J. A. Campbell Young Investigator Award $$

April 30, 2023

The Dr. J. A. Campbell Young Investigator Award of $5,000 for any kind of research into celiac disease and / or gluten sensitivity is available to students and those who have recently completed degrees.

Eligibility criteria, application details and deadlines available on the Canadian Celiac Association website.

Dr. John Thomas Memorial Bursary $

Dr. John Thomas Memorial Bursary was established in 1996 in memory of Dr. John Thomas by family, friends and colleagues. The bursary fund will assist graduate students enrolled in the department of philosophy or the Faculty of Health Sciences who demonstrate financial need. To be awarded by the School of Graduate Studies with preference given to students studying medical or applied ethics.

E.B. Eastburn Fellowship $$$$

March 3, 2025

Under the terms of a bequest to Hamilton Community Foundation by the late Eugene B. Eastburn, a two-year Fellowship will be awarded for full-time postdoctoral studies in engineering or sciences (Natural or Physical sciences, including Health Sciences).

The fellowship will be awarded for 24 months for a total value of $90,000.

Note: The 2025 competition will be announced in late fall 2024.

Fulbright canada student awards $ – $$$.

November 15, 2023

Traditional Fulbright Canada Student awards are intended for Canadian citizens who are graduate students, prospective graduate students, or promising young professionals who wish to study and/or conduct research in the United States. Awards may be held at any university, research centre, think tank, or government agency in the United States.

For eligibility criteria, award values, application details and deadlines, visit the Fulbright Canada website.

GSA Travel Award $

The GSA Travel Assistance Grants are funded from the proceeds of the Graduate Students Association Development Fund, which receives contributions from graduate students and the University. The GSA Travel Assistance Grants fund is administered through the School of Graduate Studies. The GSA Travel Assistance Grants are designed to enable graduate students to travel to undertake research or present at conferences relevant to their field of study. There are a fluctuating number of awards available each semester.

The successful recipients will be determined randomly by selecting one recipient from each faculty (Health Sciences, Engineering, Science, Humanities, Social Sciences, and Business) and the balance of the awards left in a given period will be randomly selected from a list of the remaining applicants from all faculties combined.

Application dates:

• Fall competition for September to December travel: Opens September 1, 2023 and closes October 2, 2023
• Winter competition for January to April travel: Opens January 2, 2024 and closes February 5, 2024
• Summer competition for May to August travel: Opens May 1, 2024 and closes June 3, 2024

H.G. Hilton Master’s Scholarship $$

The H.G. Hilton Master’s Scholarships were established by the income from a bequest in the estate of Hugh G. Hilton, at one time Chief Executive Officer of Stelco and member of the McMaster Board of Governors support a Master’s scholarship. The scholarship is tenable for one year, and is awarded annually to incoming Canadian citizens, permanent residents or, international students from departments which offer full-time Master’s graduate studies. Priority will be given to students intending research in Canadian industry or industrial problems. Other things being equal, preference will be given to deserving children of employees or former employees of Stelco Ltd.

Harvey E. Longboat Graduate Scholarship $$-$$$

March 14, 2024

The Harvey E. Longboat Graduate Scholarship for First Nation, Inuit, and Métis Students was established in 2009 in honour of Harvey E. Longboat, and in recognition of his extraordinary contributions to McMaster University and to the broader community. The School of Graduate Studies, in consultation with the Indigenous Studies program and the Indigenous Education Council, will award the scholarship annually to a First Nation, Inuit, or Métis student(s) who has demonstrated high academic achievement and exceptional promise.

The scholarship is tenable for one year, although previous award winners may re-apply.

Incoming students are eligible to apply.

Health Research Postdoctoral Opportunities

A comprehensive list of funding sources and agencies for postdoctoral fellows in the Faculty of Health Sciences and those doing health-related research can be found in McMaster’s funding database.. On the site, you will find a variety of filters to help you in your search.

Health Sciences Graduate Scholarship for Indigenous Scholars $$

All incoming Indigenous graduate students who are studying in a graduate program located within the Faculty of Health Sciences, are eligible to apply for this award.

Applicants who are completing a FIAP application for a facilitated graduate program, will be automatically considered for this award.

For full eligibility criteria, application details and deadlines, visit the Faculty of Health Sciences website. (Link below.)

Iranian Student Memorial Scholarship $

Established in honour of McMaster Faculty of Engineering PhD students Iman Aghabali and Mehdi Eshaghian, and a former Faculty of Health Science Post-Doctoral Fellow, who lost their lives on the downing of Ukrainian International Airlines Flight PS752. To be awarded by the School of Graduate Studies, on the recommendation of the Associate Deans responsible for graduate studies, to international graduate students from Iran who demonstrate academic excellence.

John Charles Polanyi Prize $$$

In honour of the achievement of John Charles Polanyi, recipient of the 1986 Nobel Prize in Chemistry, the Government of the Province of Ontario has established a fund to provide annually up to five prizes to outstanding researchers in the early stages of their career who are continuing to postdoctoral studies or have recently started a faculty appointment at an Ontario university.

Lyle Makosky Values and Ethics in Sport Fund $

April 30, 2024

This award is through the True Sport Foundation of Canada. Open to applicants who are

• high-performance athletes enrolled at a Canadian university, community college or other post-secondary educational institution.
• post-secondary students active in sport at a non-high-performance level.
• sport practitioners active/working in sport as an official, administrator or high-performance coach.
• educators working in a sport, sports sciences, sport management/administration or other applicable discipline.

All questions should be directed to the True Sport Foundation of Canada.

Visit their website for all details and contact information.

MacDATA Graduate Fellowship $$

March 15, 2021

The advent of large collection of data and ensuing development in data analysis techniques has made collaboration between data scientists and content experts necessary for cutting-edge research. Furthermore, there is a need for trainees to be exposed to both aspects of such research, namely for data science trainees to learn about real life practical projects and for content expert trainees to gain experience in data analysis and management. The aims of the MacDATA Graduate Fellowship Program are:

• To provide trainees with an opportunity to acquire practical and theoretical skills in data science.
• To facilitate exchange of expertise and knowledge in data science across faculties.

Mackenzie King Memorial Scholarships $$-$$$

February 1, 2024

The Mackenzie King Scholarships were set up under the will of the Rt. Hon. W.L. Mackenzie King (1874-1950), who was Prime Minister of Canada 1921-26, 1926-30, and 1935-48.

Two types of the Mackenzie King Scholarship are available to graduates of Canadian universities: the Open Scholarship and the Travelling Scholarship . Both are to support graduate study.

Manulife Life Lessons Scholarship Program $$

March 31, 2023

Manulife has introduced the first Life Lessons Scholarship Program in Canada, for students who’ve experienced the death of a parent or guardian with little to no life insurance. The Scholarship Program helps combat the financial burden of paying for post-secondary education during an emotional time and recognizes the perseverance that so many youth show in such adversity.

The next application call for this scholarship opens on February 1, 2024. Visit the Manulife website for details on that date.

Maple Leaf Centre for Food Security $$$

February 23, 2024

Four scholarships open to master’s and PhD students who are conducting research on determinants, impacts, and policy or program interventions into food insecurity in Canada.

Visit Maple Leaf Centre for Food Insecurity to learn more and apply.

Questions can be directed to [email protected] .

McMaster Graduate General Bursary $

What is a bursary.

A bursary is based solely on financial need. In most cases, information from your OSAP application is used to determine your financial need (some students who don’t receive OSAP can still apply for a bursary).

The McMaster Graduate General Bursary Program application opens mid-August in AwardSpring. Funding is paid out in mid-February.

Who can apply?

Graduate students who demonstrate financial need can apply for the McMaster Graduate General Bursary Program.

Please note: The McMaster Graduate General Bursary Program is not open to international students enrolled in graduate studies, MBA, medicine or physician assistant programs.

Bursary eligibility requirements:

• Be enrolled at McMaster
• Submit a completed application by the bursary deadline
• OSAP students who receive an income update request must complete it by the income update deadline
• Continue to demonstrate financial need throughout the study period
• Indigenous students
• students with OSAP government aid restrictions include:
• academic progress restriction
• income verification restriction
• provincial and/or federal default restriction
• credit check restriction
• students with a disability taking a reduced course load
• students with out-of-province student aid
• part-time students
• students receiving social assistance

McMaster Institute for Research on Aging (MIRA) Postdoctoral Fellowship $$$$

July 15, 2020

Prospective postdoctoral fellows are invited to submit a research plan that focuses on interdisciplinary, impact-driven approaches in the study of optimal aging through one or more of the following research areas:

• the impact of exercise on mobility;
• the interrelationship between psychological function and social function;
• causes and consequences of multimorbidity, frailty, and polypharmacy;
• the role of caregiving, equity, economics and transportation in optimal aging;
• the understanding of the biological mechanisms of diseases of aging;
• evaluating approaches to knowledge translation to improve optimal aging; and
• the use of technology to promote optimal aging and aging in place.

The applicant and principal supervisor are expected to involve at least two other researchers from two different McMaster faculties (outside of the principal supervisor’s faculty) as mentors in the development of an interdisciplinary research plan.

Michael G. DeGroote Fellowship Awards $$$$

November 1, 2019

The DeGroote Fellowship Awards are offered in TWO categories:

• The Michael G. DeGroote Fellowship Award in Basic Biomedical Science. Candidates conducting basic science research will be eligible for the Basic Biomedical Science Fellowship Award
• The Michael G. DeGroote Fellowship Award in Clinical Research. Candidates pursuing clinical research will be eligible for the Clinical Research Fellowship Award.

For eligibility criteria, award values, application details and deadlines, visit the DeGroote Fellowship Awards web page.

Michael Kiley Graduate Scholarship in Antibiotic Resistance $

Established in 2017 by the family of Michael Kiley. To be awarded to a graduate student associated with the Michael G. DeGroote Institute for Infectious Disease Research who has made a significant contribution to antibiotic infection research through a presentation of their research at an annual trainee research symposium. To be awarded annually by the School of Graduate Studies on the recommendation of the executive committee of the Michael G. DeGroote Institute for Infectious Disease Research.

Mildred Gulliver Graduate Scholarship in Infectious Diseases $

The Mildred Gulliver Graduate Scholarship in Infectious Diseases was established in 2009 by the estate of Mildred Kathleen Hodgson Gulliver. To be award to a graduate student connected to the Michael G. DeGroote Institute for Infectious Disease Research who has made a significant contribution to anti-infection research through a presentation of their research. Winners will present at an annual trainee research symposium. The scholarship is non-renewable, and awarded by the School of Graduate Studies on the recommendation of the Executive Committee of the Michael G. DeGroote Institute for Infectious Disease Research.

MIRA and Labarge Scholarships in Aging Research $$$

February 28, 2002

The MIRA and Labarge Scholarship program offers awards at the master’s and PhD level in two distinct streams. The Labarge Mobility Scholarship supports applicants whose research on aging includes a focus on mobility. The MIRA Scholarship in Aging Research supports interdisciplinary aging research in one of MIRA’s identified areas of focus.

The scholarships are open to master’s students beginning a new McMaster graduate degree in the 2022/2023 school year and PhD students entering year one or two of their studies. Interested candidates must develop and submit a research proposal in collaboration with a MIRA supervisor and an interdisciplinary mentor from outside the primary supervisor’s Faculty. MIRA requires confirmation that the supervisor and/or program will commit to matching the minimum level of support for the recipient for the duration of the graduate degree. See call for proposals and application form for more information.

MIRA Graduate Student Travel Awards $

March 15, 2020

The McMaster Institute for Research on Aging funds up to 10 graduate student travel awards per year – five in each round – valued at $500 each for students working with MIRA researchers.  Graduate students travelling to an academic conference to present an accepted abstract in aging research are eligible for up to $500 in travel funding.

For details about this and other funding opportunities, visit MIRA .

Deadlines for 2020: March 15 and September 15

MTEK Sciences Scholarship $

Established by Dr. Edward Mills, Ph.D., Health Sciences (Class of ’06) and Dr. Kristian Thorlund, Ph.D., Health Sciences (Class of ’11). To be awarded by the School of Graduate Studies, upon the recommendation of the Department of Health Research Methods, Evidence, and Impact, to full time master’s or doctoral students in the Department of Health Research Methods, Evidence and Impact who are studying innovative clinical trial design. Preference will be given to students conducting clinical trials that will benefit low income countries.

MURA Academic Scholarship

Established in 2020 the McMaster University Retirees Association (MURA). To be awarded by the School of Graduate Studies to a graduate student researching technological advances related to seniors, and who demonstrates academic excellence.

OGS for Indigenous Graduate Students $$$

Two OGS-I scholarships are awarded to Indigenous graduate students at McMaster University who face significant financial hardship, with particular priority given to women with family responsibilities.

This criteria has been established in consultation with the Indigenous Education Council (IEC) and is adjudicated by a committee chaired through the Indigenous Studies Program.

Ontario Graduate Fellowships $$$

Ontario Graduate Fellowships (OGF) provide funding to full-time students in graduate studies at the masters and doctoral level. It’s a merit-based scholarship for students with an A- or above.

Value: $12,000 ($4,000 per term)

Duration: 1 year

Ontario Graduate Scholarship (OGS) and Queen Elizabeth II Graduate Scholarships in Science and Technology (QEII-GSST) $$$

The Ontario Graduate Scholarship (OGS) and The Queen Elizabeth II Graduate Scholarship in Science and Technology (QEII-GSST) programs provide funding to full-time students at the master’s and doctoral levels. They are merit-based scholarships for students with an A- or above average.

Ontario Graduate Scholarship – International $$$

The Ontario Graduate Scholarship for International Students is by nomination only. Applicants to this award must contact their department for application instructions

Ontario Women’s Health Scholars Award $$$$

Funded by the Ontario Ministry of Health and Long-Term Care, a scholar awards program in women’s health has been established to ensure that Ontario attracts and retains pre-eminent women’s health scholars.

The community of women’s health scholars fostered by this awards program will excel, according to internationally accepted standards of scientific excellence, in the creation of new knowledge about women’s health and its translation into improved health for women, more effective health services and products for women, and a strengthened health care system.

Rainbow Fund $

To be granted to graduate students enrolled in any program who identify as 2SLGBTQIA+ students and demonstrate financial need.

Schlumberger Foundation Faculty of the Future Value varies

Value varies

This fellow is awarded to female students who are citizens of a developing country or emerging economy. Applicants should be preparing for doctoral or postdoctoral research in the in the physical sciences, engineering, technology and related disciplines.

Deadline is usually during the Fall months. For all details – eligibility, value, deadlines, etc. – go to the Schlumberger Foundation website.

Senior Women Academic Administrators of Canada Graduate Student Award of Merit $$

At least three awards, each in the amount of $4000, will be awarded annually to the women graduate students who have demonstrated outstanding leadership in the university or general community while maintaining exemplary academic records.

Women registered in master’s or PhD programs within a designated region. Regions and number of awards rotate each year. SWAAC has designated Ontario as the region for this 2023 competition. There are five awards available for this competition. Each university may nominate one person for the award.

Read about McMaster PhD student Liza-Anastasia DiCecco, who received the 2023 SWAAC Award of Merit .

The Barkleys of Avonmore Scholarship $

The Barkley’s of Avonmore Scholarship was established in 1977 through the generosity of Fred Barkley to assist a student from a developing country to pursue advanced studies at McMaster University.  Each year the Dean of Graduate Studies will identify a worthy graduate student from one of the developing countries to receive the award.

The CHEPA Doctoral Research Scholarship $

Established in 2022 by David Feeny and George Torrance, founding members of the Centre for Health Economics and Policy Analysis (CHEPA). To be awarded by the School of Graduate Studies to doctoral students enrolled in any program, who are conducting research under the supervision of faculty members belonging to CHEPA and who demonstrate academic and research excellence. The scholarship will support PhD students who have successfully completed their comprehensive examinations. Preference will be given to students with research interests that include health-related quality of life, health technology assessment, health economics, health services research, or health policy.

The David L. Sackett Scholarship $$

Established in 2010 by the Department of Health Research Methods, Evicence and Impacts, in honour of Dr. Sackett’s leadership in the fields of clinical epidemiology and evidence-based medicine. To be awarded by the School of Graduate Studies, on the recommendation of the Associate Dean of Graduate Studies (Health Sciences), to doctoral students in the Faculty of Health Sciences who demonstrate outstanding academic achievement. Preference will be given to students enrolled in the Health Research Methodology program.

The Diane and Colin Wood Bursary in Respiratory Health $$

The Diane and Colin Wood Bursary in Respiratory Health was established in 2008 by Diane Wood and Colin Wood, BComm (Class of ’78). To be granted by the School of Graduate Studies, on the recommendation of the director of the Firestone Institute for Respiratory Health, to a graduate student who demonstrates financial need and is conducting research in the area of chronic obstructive pulmonary disease (COPD). Preference will be given to students studying emphysema.

The Doris Noftall Award in Food Allergy Research $$

To be awarded to a graduate student in the Faculty of Health Sciences who has demonstrated an interest in the area of food allergy research. To be awarded annually by the School of Graduate Studies on the recommendation of Dr. Manel Jordana and Dr. Susan Waserman, until such time that they retire or their faculty appointments end. Once both Dr. Jordana and Dr. Waserman’s faculty appointments end, responsibility for recommendations will transfer to the lead faculty in the area of food allergy research within the McMaster Immunology Research Centre.

The Dr. Colin Webber Graduate Scholarship $$

Established in 2013 to honour the memory of Dr. Colin Webber, McMaster University professor, physicist, radiation safety expert, teacher, mentor, and leader in the field of bone research. To be awarded by the School of Graduate Studies to master’s or doctoral students. Preference will be given to students who demonstrate interest in bone research.

Value: Minimum $1,600

The Dr. Jordan Page Harshman Bursary $

The Dr. Jordan Page Harsham Bursary was established in 2011 by the Harshman Fellowships Society to honour Dr. Jordon Page Harshman, past president of the society. To be awarded annually by the School of Graduate Studies, based on the recommendation of the Associate Dean, Health Sciences (Graduate), to a graduate student in the Faculty of Health Sciences who is engaged in medical research and who demonstrates financial need as well as good citizenship, good social responsibility, and leadership in society. Preference will be given to students in the following three areas in descending order: The Michael G. DeGroote institute for Infectious Disease Research, the Farncombe Family Digestive Health Research Institute and the department of clinical epidemiology and biostatistics. Recipients will be provided with a certificate from the Faculty of Health Sciences detailing the purpose and history of this award at McMaster University. Students who are recipients of an Ontario Graduate Scholarship are not eligible for this Bursary.

The E.B. Ryan Scholarship $

The E.B. Ryan Scholarship was established in 1997 using funds raised by a performance of the play Letter from Wingfield Farm, this scholarship is to be awarded to in-course graduate students from the faculties of Social Sciences and Health Sciences conducting research on aging. This award, valued at a maximum of $2,000, is awarded by the School of Graduate Studies on the recommendation of a committee comprised of at least the director and the co-ordinator of the Office of Gerontological Studies.

The Edna Howard Bursary $

Established in 2022 by the family of Edna Howard, this bursary honours the support Edna offered graduate students through her work as a cook at The Phoenix Bar and Grill, owned and operated by the Graduate Students Association. Her food warmed the hearts of the McMaster campus community for many years until her retirement. To be granted by the School of Graduate Studies to full-time students in any program who demonstrate financial need.

The EJ Irvine Annual Graduate Student Award $

The EJ Irvine Annual Graduate Student Award Established in 2022 by the Estate of Daniel Connelly Irvine in memory of the late Dr. Elizabeth Irvine, MSc. (Class of ’86). To be awarded by the School of Graduate Studies on the recommendation of the Director of the Farncombe Family Digestive Health Research Institute and the Director, Division of Gastroenterology in the Department of Medicine. To be awarded to graduate students who demonstrate the best progress in research after year 1 in the Farncombe Family Digestive Health Research Institute.

The Eva Eugenia Lillian Cope Research Scholarship $$$$

The Eva Eugenia Lillian Cope Research Scholarship was established in 2006. To be used for research on allergies and allergic related diseases in the Faculty of Health Sciences, Centre for Gene Therapeutics, Division of Respiratory Diseases and Allergy.

The Fergal P. Mills Graduate Bursary in Health Economics $

Established in 2023 by Dr. Edward Mills, in loving memory of his brother Mr. Fergal P. Mills. To be awarded by the School of Graduate Studies to graduate students enrolled in the Department of Health Research Methods, Evidence and Impact who demonstrate financial need and are conducting research in Health Economics.

The Graduate Students Association Bursary $

The Graduate Students Association Bursary was established in 1999 by the Graduate Students Association at McMaster University under the McMaster Student Opportunity Fund initiative. To be granted to a full-time or part-time graduate student in one of the following faculties: Engineering, Health Sciences, and Humanities, Science, Social Sciences, or the PhD program in Business. The bursary will be awarded annually by the School of Graduate Studies on the recommendation of the Graduate Students Association.

The H. Vincent Elliott Memorial Travel Bursary $

The H.Vincent Elliott Memorial Travel Bursary was established in 2010 by Dr. Susan J.Elliott (MA `97 and PhD`92), esteemed former Dean of the Faculty of Social Sciences, professor of Geography and Earth Sciences, and senior research fellow at the United Nations Institute on Water (UNU-IWEH), Environment and Health, in memory of her father, H.Vincent Elliott. To be granted by the School of Graduate Studies on the recommendation on the program director of ‘Water Without Borders’ to students registered in a Master’s or PhD program will be given to students in financial need.

The Howard P. Whidden Graduate Scholarship $$

The Howard P. Whidden Graduate Scholarship was established in 1987, and is open to non-Canadian students from countries of the British Commonwealth. This prestigious award is open to students who qualify for admission into any graduate program that extends to the doctorate, although the student’s initial registration may be at the Master’s level. The award is once renewable contingent upon satisfactory academic performance. It will be awarded at the discretion of the School of Graduate Studies.

The James F. Harvey and Helen S. Harvey Travel Scholarships $

Established in 1995 with funds from the estate of Helen S. Harvey.  James F. Harvey was a member of the first McMaster graduating class in Hamilton in 1935.  This travel scholarship will enable students to engage in research requiring travel.  To be awarded by the School of Graduate Studies to graduate students who demonstrate academic excellence.

The Jan’s Graduate Scholarship In Stem Cell Research $$$-$$$$

Established in 2012 by the John and Ellie Voortman Charitable Foundation in loving memory of Jan VanBarneveld. To be awarded to a masters or PhD student connected to the McMaster Stem Cell and Cancer Research Institute (SCC-RI) who exemplifies excellence in their research. To be awarded annually by the School of Graduate Studies on the recommendation of the director of SCC-RI.

The Lambda Scholarship Foundation Canada Graduate Award

Established in 2022 by the Lambda Scholarship Foundation Canada. To be awarded by the School of Graduate Studies to a graduate student who is currently enrolled in their first year of any program who identifies as a member of the queer, trans community and is Black, racialized, or Indigenous.

The Late Fergus Mills Scholarship $

Established in 2008 by Dr. Edward Mills in honour of his father, Fergus Mills. To be awarded by the School of Graduate Studies, on the recommendation of the assistant dean of Health Research Methodology, to a student enrolled in a graduate program in Health Sciences who is committed to research which will help people in a developing country. Preference to be given to a student with an academic or research background related to Africa with further preference given to a student enrolled in the Health Research Methodology program.

The Lorne F. Lambier, Q.C., Scholarship $

The Lorne F. Lambier, QC Scholarship was established in 1984. The scholarship is tenable for one year. The scholarship is awarded annually to current Canadian citizens, permanent residents or international students registered in a master’s or doctoral graduate program in Faculties of Health Science and Science whose research is directed toward the understanding and/or cure of cancer.

The Louis Minden Scholarship in Health Sciences $$

Established in 1995 with funds from the estate of Mr. Louis Minden. To be awarded to a graduate student in the Faculty of Health Sciences by the School of Graduate Studies on the recommendation of the Graduate Associate Dean of the Faculty of Health Sciences. This award is once renewable, and preference will be given to a graduate student pursuing research in preventative medicine.

The Mary Ecclestone Nutrtion Scholarship Award $$

Established in 2019 to promote scholarship and graduate training in the field of pediatric nutrition. To be awarded by the School of Graduate Studies, upon the recommendation of a selection committee in the Department of Pediatrics, chaired by the Chair of the Department of Pediatrics, to full time master’s or doctoral students in the Department of Pediatrics who are studying and/or conducting research in pediatric nutrition.

The McMaster Immunology Research Centre Faculty Scholarship $

Established in 2011 by faculty members within the McMaster Immunology Research Centre to support graduate students. To be awarded annually by the School of Graduate Studies, to an outstanding full time M.Sc. or Ph.D. candidate. First preference will be given to a candidate supervised by a graduate faculty supervisor from the McMaster Immunology Research Centre. Second preference will be given to an applicant in the infection and immunity field.      

The Myra Baillie Academic Grant $

Established in 2005 by the Surgical Associates in memory of Myra Baillie. To be granted to a graduate student in any degree program who attains and “A” average and demonstrates financial need. Preference will be given to a female graduate student.

Award Value: 2 awards of $1,000 each

The School of Graduate Studies Grant in Aid for Research Travel $-$$

March 8, 2024

The SGS Grant is intended to be a grant in aid of research; students should not expect the grants to cover the full cost of travel or field work.

The School of Graduate Studies (SGS) Grant is not intended for conference or course work travel .

It is not meant to replace sources of funding already available from the tri-agencies (CIHR, NSERC, and SSHRC), other external granting sources, or internal scholarships and bursaries.

It is not intended to fund the research itself, but the travel to do the research.

Application Date

The application will open in Mosaic on January 8, 2024, and close on March 8, 2024.

The W.E. Rawls Memorial Scholarship $

Established in 1990 by family and friends to honour the valuable  contribution of Dr. Rawls made to cancer research; as Professor in the  Faculty of Health Sciences, founder and coordinator of the McMaster  Research Group, Director of the Molecular Virology and Immunology Programme  and Past President of the National Cancer Institute. Eligible nominees are  students, regardless of departmental affiliation, currently supervised by a graduate faculty member of the Molecular Virology and Immunology Research  program (MVIP).  The award will be made by the School of Graduate Studies on the recommendation of the Chair of the Medical Sciences Graduate  Program.  The selection committee will include the Chair of the Molecular  Immunology, Virology and Inflammation Program Education Committee.

Vanier Canada Graduate Scholarship-Doctoral $$$$

September 6, 2023

The Vanier CGS program aims to attract and retain world-class doctoral students to establish Canada as a global centre of excellence in research and higher learning. Vanier Scholars demonstrate both leadership skills and a high standard of scholarly achievement in graduate studies in the social sciences and humanities, natural sciences and/or engineering and health.

It is valued at $50,000 per year for three years during doctoral studies.

Canadian Citizens, Permanent Residents of Canada, and foreign citizens are eligible to apply for this scholarship.

Wilson Leadership Scholar Award $$-$$$

March 28, 2022

The Wilson Leader Scholarship Award for graduate students is different. Valued at $12,000 in direct funding and up to $2,000 for experiential funding, it’s a leadership development and career launcher program that builds on your studies. It involves about 15 hours/month, including time for synchronous group events between 8:30 a.m. and 4:30 p.m. ET.

Awarded to up to three graduate students annually.

Yates Scholarship $

The Yates Scholarship Fund (up to $500) was established in 1963 by the bequest of William Henry Yates. This fund support upper-level doctoral students with research activities and conference travel when a paper is being delivered. Applicants must have completed their comprehensive exam.

Related News

{Link Label}

Mcmaster’s dash team to the rescue for data analysis and software help.

McMaster celebrates seven new Vanier Scholars

Nominations open for 25th Annual Graduate Student Recognition Awards

Five grad students receive Wilson Leadership Scholar Award

McMaster ranked #1 for graduate student research intensity

Celebrating our newest Vanier Scholars and Banting Fellow!

Winter term will be online: Provost’s letter

830,000 print books from Library’s collection now digitally available to faculty, students

Tell your research story in the 2020 three minute thesis competition.

MIRA awards Mac researchers more than $500,000 for work in mobility and aging

Clinical Trials MSc

Distance learning programme

Clinical trials are essential in discovering whether new healthcare interventions improve outcomes for patients and the public. This distance learning programme will provide an excellent grounding in clinical trials and enhance the knowledge and understanding of those already working in the field. This is an expanding area that offers many exciting career opportunities.

UK tuition fees (2024/25)

Overseas tuition fees (2024/25), programme starts, applications accepted.

Applications open

• Entry requirements

Normally a minimum of an upper second-class UK Bachelor's degree in a healthcare or life science related subject (including pharmacy) or an overseas qualification of an equivalent standard. Clinicians are required to have a degree (for example, an MBBS).

The English language level for this programme is: Level 2

UCL Pre-Master's and Pre-sessional English courses are for international students who are aiming to study for a postgraduate degree at UCL. The courses will develop your academic English and academic skills required to succeed at postgraduate level.

Further information can be found on our English language requirements page.

Equivalent qualifications

Country-specific information, including details of when UCL representatives are visiting your part of the world, can be obtained from the International Students website .

International applicants can find out the equivalent qualification for their country by selecting from the list below. Please note that the equivalency will correspond to the broad UK degree classification stated on this page (e.g. upper second-class). Where a specific overall percentage is required in the UK qualification, the international equivalency will be higher than that stated below. Please contact Graduate Admissions should you require further advice.

About this degree

Clinical trials are essential in discovering whether new healthcare interventions improve outcomes for patients and the public. This is an expanding field that offers exciting career opportunities.

This online programme will provide an excellent grounding in clinical trials to those new to the field. It will enhance the knowledge and understanding of those already working in clinical trials.

Assessment and learning activities facilitate the development of key skills for careers or further study in the field, from analysis of scientific papers, the ability to critically challenge current research, to academic writing and oral presentation skills.

If you wish to gain a Master's award, you will undertake an independent research project, gaining experience of project design, literature review, analysis, and interpretation.

Who this course is for

The programme is aimed at graduates from healthcare, life sciences or other related disciplines and health professionals who are interested in a career in clinical trials. It is also aimed at professionals working in the field who wish to develop their knowledge and skills.

What this course will give you

The Institute of Clinical Trials and Methodology (ICTM) at UCL is a global leader in the field with over 450 researchers (including clinicians, statisticians, trials managers) working within it. You will meet and be taught by many of these researchers.

You will learn the scientific, methodological, and practical issues involved in the design, conduct, analysis, and reporting of clinical trials. You will learn about all types of trials, from early to late phase trials, and from simple to complex interventions. You will develop your communication skills through activities carried out both individually and in groups.  

The foundation of your career

Clinical trials is an expanding and highly competitive field of research yet employers find it challenging to recruit people with the appropriate skills and knowledge. This programme has been designed in consultation with employers from academia, the pharmaceutical industry and the NHS. It will give graduates the critical thinking, problem-solving and practical skills that employers seek in this multidisciplinary, collaborative field. You may also use this qualification as a springboard for further study at doctoral level. Future career prospects will be enhanced on completion of this programme. You will be equipped with the knowledge and skills to become a key team member in the design, conduct, analysis, and reporting of high-quality clinical trials.

Although I was already working in the field for 2 years, having career switched from organic chemistry, the MSc provided a strong theoretical and academic background that I was lacking in clinical and medical research. In addition, the degree also focuses on the 'nuts-and-bolts' involved in running a trial so being able to bounce off practical questions to colleagues on the course and tutors was equally invaluable. David Clinical Trials MSc Read more

Employability

Potential career opportunities include working on a range of trials from set up to final reporting.

Skills gained from the core programme will create exciting opportunities to work both in clinical trials and data management, regulation of clinical trials and medical writing.

Career destinations will include academic trials units, the pharmaceutical industry, contract research organisations, hospitals and government organisations.

You will be invited to the Institute’s Monday lunchtime seminars (1-2 pm UK time) which are hosted online on MS Teams. These seminars run throughout the academic year and feature invited speakers presenting on topics related to clinical trials / other research and initiatives relevant to staff and students in the Institute.  Students also have the opportunity to work with staff to set up an ICTM journal club – we will welcome volunteers to lead on this initiative each year. In 2023/24, we aim to set up UCL’s first Society for Online Students, giving online students the opportunity to network and make connections. 

Teaching and learning

As this is a distance learning programme, teaching will be delivered online in real-time and complimented with pre-recorded sessions. The students are expected to supplement these with self-study.

You will be assessed by a variety of methods including:

• Unseen written examinations
• Oral presentations
• Written assignments (for example, essays, abstracts, background section of a protocol, critical analysis of published work, practical problem solving, communicating appropriately with different audiences).

There are 7 core taught modules within this programme. The assessments will consist of a variety of formative assessments across the programme to facilitate learning outcomes within a module. These are aimed to help you prepare for the module’s summative assessment or to help develop key transferable skills.

Most of the taught modules are based on one summative assessment, while some have two summative assessments worth 50% each.

Assessments are based on real-world examples and activities that you would perform or need to be aware of if you work in clinical trials.

The overall contact and self-directed study hours are 150 hours for a typical 15-credit module (which includes 3 hours live online seminars per week).

A Postgraduate Diploma, consisting of seven core modules (120 credits) and available for full-time, part-time or flexible study is offered. A Postgraduate Certificate consisting of three or four modules (60 credits) and available for full-time, part-time and flexible study is offered.

Full-time students are expected to attend full-day online classes both on Tuesdays & Thursdays.

Part-time students have the flexibility to decide which modules they wish to undertake in that particular term/academic year, with classes either being on Tuesdays or Thursdays depending on your module selection. 

We encourage the students to take the Thursday modules in the first year and Tuesday modules in the second year.

Modular/flexible students have the flexibility to decide which modules they wish to undertake in that particular term/academic year. The choice of studying modules on Tuesdays or Thursdays will depend on the student's other commitments. The programme will need to be completed within the 5-year timeframe. 

Compulsory modules

Please note that the list of modules given here is indicative. This information is published a long time in advance of enrolment and module content and availability are subject to change. Modules that are in use for the current academic year are linked for further information. Where no link is present, further information is not yet available.

Students undertake modules to the value of 180 credits. Upon successful completion of 180 credits, you will be awarded an MSc in Clinical Trials. Upon successful completion of 120 credits, you will be awarded a PG Dip in Clinical Trials. Upon successful completion of 60 credits, you will be awarded a PG Cert in Clinical Trials.

Accessibility

Details of the accessibility of UCL buildings can be obtained from AccessAble accessable.co.uk . Further information can also be obtained from the UCL Student Support and Wellbeing team .

4 March 2024 — 28 June 2024

Online - Open day

Book a virtual 1-2-1 about Clinical Trials MSc

10:00 — 18:00

Book a 15-minute appointment with a member of the Clinical Trials MSc team. They will be happy to answer any questions you might have about the programme, careers or studying at UCL.

Book a virtual 1-2-1 about Statistics for Clinical Trials MSc

09:00 — 19:00

Book a 15-minute appointment with a member of the Statistics for Clinical Trials MSc team. They will be happy to answer any questions you might have about the programme, careers or studying at UCL.

Fees and funding

Fees for this course.

The tuition fees shown are for the year indicated above. Fees for subsequent years may increase or otherwise vary. Where the programme is offered on a flexible/modular basis, fees are charged pro-rata to the appropriate full-time Master's fee taken in an academic session. Further information on fee status, fee increases and the fee schedule can be viewed on the UCL Students website: ucl.ac.uk/students/fees .

Additional costs

There are no additional costs for this programme.

For more information on additional costs for prospective students please go to our estimated cost of essential expenditure at Accommodation and living costs .

Funding your studies

For a comprehensive list of the funding opportunities available at UCL, including funding relevant to your nationality, please visit the Scholarships and Funding website .

Students are advised to apply as early as possible due to competition for places. Those applying for scholarship funding (particularly overseas applicants) should take note of application deadlines.

There is an application processing fee for this programme of £90 for online applications and £115 for paper applications. Further information can be found at Application fees .

When we access your application we would like to learn:

• why you want to study Clinical Trials at graduate level
• why you want to study Clinical Trials at UCL
• what particularly attracts you to the chosen programme
• how your academic and professional background meets the demands of this challenging programme
• where you would like to go professionally with your degree

Together with essential academic requirements, the personal statement is your opportunity to illustrate whether your reasons for applying to this programme match what the programme will deliver.

Applications will be considered in gathered fields. For more information, please contact the ICTM administrator.

Please note that you may submit applications for a maximum of two graduate programmes (or one application for the Law LLM) in any application cycle.

Choose your programme

Please read the Application Guidance before proceeding with your application.

Year of entry: 2024-2025

Got questions get in touch.

Institute of Clinical Trials and Methodology

[email protected]

UCL is regulated by the Office for Students .

Prospective Students Graduate

• Graduate degrees
• Taught degrees
• Taught Degrees
• Applying for Graduate Taught Study at UCL
• Research degrees
• Research Degrees
• Funded Research Opportunities
• Doctoral School
• Funded Doctoral Training Programmes
• Applying for Graduate Research Study at UCL
• Teacher training
• Teacher Training
• Early Years PGCE programmes
• Primary PGCE programmes
• Secondary PGCE programmes
• Further Education PGCE programme
• How to apply
• The IOE approach
• Teacher training in the heart of London
• Why choose UCL?
• Entrepreneurship
• Inspiring facilities and resources
• Careers and employability
• Your global alumni community
• Your wellbeing
• Postgraduate Students' Association
• Your life in London
• Accommodation
• Funding your Master's

Case Study Research Method in Psychology

Saul Mcleod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul Mcleod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

Learn about our Editorial Process

Olivia Guy-Evans, MSc

Associate Editor for Simply Psychology

BSc (Hons) Psychology, MSc Psychology of Education

Olivia Guy-Evans is a writer and associate editor for Simply Psychology. She has previously worked in healthcare and educational sectors.

On This Page:

Case studies are in-depth investigations of a person, group, event, or community. Typically, data is gathered from various sources using several methods (e.g., observations & interviews).

The case study research method originated in clinical medicine (the case history, i.e., the patient’s personal history). In psychology, case studies are often confined to the study of a particular individual.

The information is mainly biographical and relates to events in the individual’s past (i.e., retrospective), as well as to significant events that are currently occurring in his or her everyday life.

The case study is not a research method, but researchers select methods of data collection and analysis that will generate material suitable for case studies.

Freud (1909a, 1909b) conducted very detailed investigations into the private lives of his patients in an attempt to both understand and help them overcome their illnesses.

This makes it clear that the case study is a method that should only be used by a psychologist, therapist, or psychiatrist, i.e., someone with a professional qualification.

There is an ethical issue of competence. Only someone qualified to diagnose and treat a person can conduct a formal case study relating to atypical (i.e., abnormal) behavior or atypical development.

 Famous Case Studies

• Anna O – One of the most famous case studies, documenting psychoanalyst Josef Breuer’s treatment of “Anna O” (real name Bertha Pappenheim) for hysteria in the late 1800s using early psychoanalytic theory.
• Little Hans – A child psychoanalysis case study published by Sigmund Freud in 1909 analyzing his five-year-old patient Herbert Graf’s house phobia as related to the Oedipus complex.
• Bruce/Brenda – Gender identity case of the boy (Bruce) whose botched circumcision led psychologist John Money to advise gender reassignment and raise him as a girl (Brenda) in the 1960s.
• Genie Wiley – Linguistics/psychological development case of the victim of extreme isolation abuse who was studied in 1970s California for effects of early language deprivation on acquiring speech later in life.
• Phineas Gage – One of the most famous neuropsychology case studies analyzes personality changes in railroad worker Phineas Gage after an 1848 brain injury involving a tamping iron piercing his skull.

Clinical Case Studies

• Studying the effectiveness of psychotherapy approaches with an individual patient
• Assessing and treating mental illnesses like depression, anxiety disorders, PTSD
• Neuropsychological cases investigating brain injuries or disorders

Child Psychology Case Studies

• Studying psychological development from birth through adolescence
• Cases of learning disabilities, autism spectrum disorders, ADHD
• Effects of trauma, abuse, deprivation on development

Types of Case Studies

• Explanatory case studies : Used to explore causation in order to find underlying principles. Helpful for doing qualitative analysis to explain presumed causal links.
• Exploratory case studies : Used to explore situations where an intervention being evaluated has no clear set of outcomes. It helps define questions and hypotheses for future research.
• Descriptive case studies : Describe an intervention or phenomenon and the real-life context in which it occurred. It is helpful for illustrating certain topics within an evaluation.
• Multiple-case studies : Used to explore differences between cases and replicate findings across cases. Helpful for comparing and contrasting specific cases.
• Intrinsic : Used to gain a better understanding of a particular case. Helpful for capturing the complexity of a single case.
• Collective : Used to explore a general phenomenon using multiple case studies. Helpful for jointly studying a group of cases in order to inquire into the phenomenon.

Where Do You Find Data for a Case Study?

There are several places to find data for a case study. The key is to gather data from multiple sources to get a complete picture of the case and corroborate facts or findings through triangulation of evidence. Most of this information is likely qualitative (i.e., verbal description rather than measurement), but the psychologist might also collect numerical data.

1. Primary sources

• Interviews – Interviewing key people related to the case to get their perspectives and insights. The interview is an extremely effective procedure for obtaining information about an individual, and it may be used to collect comments from the person’s friends, parents, employer, workmates, and others who have a good knowledge of the person, as well as to obtain facts from the person him or herself.
• Observations – Observing behaviors, interactions, processes, etc., related to the case as they unfold in real-time.
• Documents & Records – Reviewing private documents, diaries, public records, correspondence, meeting minutes, etc., relevant to the case.

2. Secondary sources

• News/Media – News coverage of events related to the case study.
• Academic articles – Journal articles, dissertations etc. that discuss the case.
• Government reports – Official data and records related to the case context.
• Books/films – Books, documentaries or films discussing the case.

3. Archival records

Searching historical archives, museum collections and databases to find relevant documents, visual/audio records related to the case history and context.

Public archives like newspapers, organizational records, photographic collections could all include potentially relevant pieces of information to shed light on attitudes, cultural perspectives, common practices and historical contexts related to psychology.

4. Organizational records

Organizational records offer the advantage of often having large datasets collected over time that can reveal or confirm psychological insights.

Of course, privacy and ethical concerns regarding confidential data must be navigated carefully.

However, with proper protocols, organizational records can provide invaluable context and empirical depth to qualitative case studies exploring the intersection of psychology and organizations.

• Organizational/industrial psychology research : Organizational records like employee surveys, turnover/retention data, policies, incident reports etc. may provide insight into topics like job satisfaction, workplace culture and dynamics, leadership issues, employee behaviors etc.
• Clinical psychology : Therapists/hospitals may grant access to anonymized medical records to study aspects like assessments, diagnoses, treatment plans etc. This could shed light on clinical practices.
• School psychology : Studies could utilize anonymized student records like test scores, grades, disciplinary issues, and counseling referrals to study child development, learning barriers, effectiveness of support programs, and more.

How do I Write a Case Study in Psychology?

Follow specified case study guidelines provided by a journal or your psychology tutor. General components of clinical case studies include: background, symptoms, assessments, diagnosis, treatment, and outcomes. Interpreting the information means the researcher decides what to include or leave out. A good case study should always clarify which information is the factual description and which is an inference or the researcher’s opinion.

1. Introduction

• Provide background on the case context and why it is of interest, presenting background information like demographics, relevant history, and presenting problem.
• Compare briefly to similar published cases if applicable. Clearly state the focus/importance of the case.

2. Case Presentation

• Describe the presenting problem in detail, including symptoms, duration,and impact on daily life.
• Include client demographics like age and gender, information about social relationships, and mental health history.
• Describe all physical, emotional, and/or sensory symptoms reported by the client.
• Use patient quotes to describe the initial complaint verbatim. Follow with full-sentence summaries of relevant history details gathered, including key components that led to a working diagnosis.
• Summarize clinical exam results, namely orthopedic/neurological tests, imaging, lab tests, etc. Note actual results rather than subjective conclusions. Provide images if clearly reproducible/anonymized.
• Clearly state the working diagnosis or clinical impression before transitioning to management.

3. Management and Outcome

• Indicate the total duration of care and number of treatments given over what timeframe. Use specific names/descriptions for any therapies/interventions applied.
• Present the results of the intervention,including any quantitative or qualitative data collected.
• For outcomes, utilize visual analog scales for pain, medication usage logs, etc., if possible. Include patient self-reports of improvement/worsening of symptoms. Note the reason for discharge/end of care.

4. Discussion

• Analyze the case, exploring contributing factors, limitations of the study, and connections to existing research.
• Analyze the effectiveness of the intervention,considering factors like participant adherence, limitations of the study, and potential alternative explanations for the results.
• Identify any questions raised in the case analysis and relate insights to established theories and current research if applicable. Avoid definitive claims about physiological explanations.
• Offer clinical implications, and suggest future research directions.

5. Additional Items

• Thank specific assistants for writing support only. No patient acknowledgments.
• References should directly support any key claims or quotes included.
• Use tables/figures/images only if substantially informative. Include permissions and legends/explanatory notes.
• Provides detailed (rich qualitative) information.
• Provides insight for further research.
• Permitting investigation of otherwise impractical (or unethical) situations.

Case studies allow a researcher to investigate a topic in far more detail than might be possible if they were trying to deal with a large number of research participants (nomothetic approach) with the aim of ‘averaging’.

Because of their in-depth, multi-sided approach, case studies often shed light on aspects of human thinking and behavior that would be unethical or impractical to study in other ways.

Research that only looks into the measurable aspects of human behavior is not likely to give us insights into the subjective dimension of experience, which is important to psychoanalytic and humanistic psychologists.

Case studies are often used in exploratory research. They can help us generate new ideas (that might be tested by other methods). They are an important way of illustrating theories and can help show how different aspects of a person’s life are related to each other.

The method is, therefore, important for psychologists who adopt a holistic point of view (i.e., humanistic psychologists ).

Limitations

• Lacking scientific rigor and providing little basis for generalization of results to the wider population.
• Researchers’ own subjective feelings may influence the case study (researcher bias).
• Difficult to replicate.
• Time-consuming and expensive.
• The volume of data, together with the time restrictions in place, impacted the depth of analysis that was possible within the available resources.

Because a case study deals with only one person/event/group, we can never be sure if the case study investigated is representative of the wider body of “similar” instances. This means the conclusions drawn from a particular case may not be transferable to other settings.

Because case studies are based on the analysis of qualitative (i.e., descriptive) data , a lot depends on the psychologist’s interpretation of the information she has acquired.

This means that there is a lot of scope for Anna O , and it could be that the subjective opinions of the psychologist intrude in the assessment of what the data means.

For example, Freud has been criticized for producing case studies in which the information was sometimes distorted to fit particular behavioral theories (e.g., Little Hans ).

This is also true of Money’s interpretation of the Bruce/Brenda case study (Diamond, 1997) when he ignored evidence that went against his theory.

Breuer, J., & Freud, S. (1895).  Studies on hysteria . Standard Edition 2: London.

Curtiss, S. (1981). Genie: The case of a modern wild child .

Diamond, M., & Sigmundson, K. (1997). Sex Reassignment at Birth: Long-term Review and Clinical Implications. Archives of Pediatrics & Adolescent Medicine , 151(3), 298-304

Freud, S. (1909a). Analysis of a phobia of a five year old boy. In The Pelican Freud Library (1977), Vol 8, Case Histories 1, pages 169-306

Freud, S. (1909b). Bemerkungen über einen Fall von Zwangsneurose (Der “Rattenmann”). Jb. psychoanal. psychopathol. Forsch ., I, p. 357-421; GW, VII, p. 379-463; Notes upon a case of obsessional neurosis, SE , 10: 151-318.

Harlow J. M. (1848). Passage of an iron rod through the head.  Boston Medical and Surgical Journal, 39 , 389–393.

Harlow, J. M. (1868).  Recovery from the Passage of an Iron Bar through the Head .  Publications of the Massachusetts Medical Society. 2  (3), 327-347.

Money, J., & Ehrhardt, A. A. (1972).  Man & Woman, Boy & Girl : The Differentiation and Dimorphism of Gender Identity from Conception to Maturity. Baltimore, Maryland: Johns Hopkins University Press.

Money, J., & Tucker, P. (1975). Sexual signatures: On being a man or a woman.

Further Information

• Case Study Approach
• Case Study Method
• Enhancing the Quality of Case Studies in Health Services Research
• “We do things together” A case study of “couplehood” in dementia
• Using mixed methods for evaluating an integrative approach to cancer care: a case study

Related Articles

Research Methodology

Qualitative Data Coding

What Is a Focus Group?

Cross-Cultural Research Methodology In Psychology

What Is Internal Validity In Research?

Research Methodology , Statistics

What Is Face Validity In Research? Importance & How To Measure

Criterion Validity: Definition & Examples

• Open access
• Published: 23 May 2024

Enhanced immunosuppressive capability of mesenchymal stem cell-derived small extracellular vesicles with high expression of CD73 in experimental autoimmune uveitis

• Yanan Duan 1   na1 ,
• Xiteng Chen 1   na1 ,
• Hui Shao 2 ,
• Yongtao Li 1 ,
• Zhihui Zhang 1 ,
• Huan Li 1 ,
• Chuan Zhao 1 ,
• Hong Xiao 1 ,
• Jiawei Wang 1 &
• Xiaomin Zhang   ORCID: orcid.org/0000-0003-4898-4152 1  

Stem Cell Research & Therapy volume  15 , Article number:  149 ( 2024 ) Cite this article

Metrics details

Autoimmune uveitis is an inflammatory disease triggered by an aberrant immune response. Mesenchymal stem cell-derived small extracellular vesicles (MSC-sEVs) are emerging as potential therapeutic agents for this condition. CD73, an ectoenzyme present on MSC-sEVs, is involved in mitigating inflammation by converting extracellular adenosine monophosphate into adenosine. We hypothesize that the inhibitory effect of MSC-sEVs on experimental autoimmune uveitis (EAU) could be partially attributed to the surface expression of CD73.

To investigate novel therapeutic approaches for autoimmune uveitis, we performed lentiviral transduction to overexpress CD73 on the surface of MSC-sEVs, yielding CD73-enriched MSC-sEVs (sEVs-CD73). Mice with interphotoreceptor retinoid-binding protein (IRBP)-induced EAU were grouped randomly and treated with 50 µg MSC-sEVs, vector infected MSC-sEVs, sEVs-CD73 or PBS via single tail vein injection. We evaluated the clinical and histological features of the induced mice and analyzed the proportion and functional capabilities of T helper cells. Furthermore, T-cells were co-cultured with various MSC-sEVs in vitro, and we quantified the resulting inflammatory response to assess the potential therapeutic benefits of sEVs-CD73.

Compared to MSC-sEVs, sEVs-CD73 significantly alleviates EAU, leading to reduced inflammation and diminished tissue damage. Treatment with sEVs-CD73 results in a decreased proportion of Th1 cells in the spleen, draining lymph nodes, and eyes, accompanied by an increased proportion of regulatory T-cells (Treg cells). In vitro assays further reveal that sEVs-CD73 inhibits T-cell proliferation, suppresses Th1 cells differentiation, and enhances Treg cells proportion.

Over-expression of CD73 on MSC-sEVs enhances their immunosuppressive effects in EAU, indicating that sEVs-CD73 has the potential as an efficient immunotherapeutic agent for autoimmune uveitis.

Autoimmune uveitis is a complex and heterogenous inflammation that manifests with diverse symptoms, including blurred vision, photophobia and pain [ 1 , 2 ]. Several therapeutic modalities, such as glucocorticoids (GCs) and immunosuppressive agents, are employed to address the intricacies of this condition. Predominantly, GCs stand as the primary choice in clinical uveitis treatment. However, their protracted usage is encumbered by drawbacks, which encompass adverse effects like cataracts, glaucoma, and systemic repercussions [ 3 , 4 , 5 ]. Other methodologies also exhibit certain limitations. Consequently, ongoing researches into novel therapies aspire to not only heighten treatment efficacy but also mitigate adverse effects, ultimately refining the comprehensive management of uveitis.

In recent years, some studies have assessed both the efficacy and safety of mesenchymal stem cells (MSCs) in addressing experimental autoimmune uveitis (EAU) in animal models [ 6 , 7 , 8 ]. MSCs, widely recognized for their regenerative and immunomodulatory functions, have been utilized in various neurological and immune disorders, including autoimmune diseases [ 9 , 10 ]. Recent studies also indicate their significant role in COVID-19 patients, particularly in virus-host interaction, drug testing, tissue regeneration, and immune modulation [ 11 ]. Nonetheless, MSC-based therapy not only presents challenges in cell product preservation and transport, but also elevates the risks associated with vessel obstruction, malignant transformation, and allogenic immunological rejection [ 12 , 13 , 14 , 15 ]. To mitigate these obstacles, attention has turned to their secretions, small extracellular vesicles (sEVs). Following the recommendations of Minimal information for studies of extracellular vesicles (MISEV) [ 16 ], we define extracellular vesicles with diameters less than 200 nm as sEVs, rather than exosomes or ectosomes. These nano-sized vesicles play a pivotal role in shuttling nutrient substances to mediate recipient cell functions, mirroring the impact of their parent cells [ 17 , 18 , 19 ]. The lipid bilayer membrane structure of sEVs could protect their cargo from degradation. Consequently, they have been extensively harnessed as ideal drug carriers and strategically modified for therapeutic interventions in various immune disorders. Furthermore, the utilization of MSC-derived sEVs (MSC-sEVs) holds promise for therapeutic agent applications, as they offer improved safety and stability compared to their parent MSCs. Nevertheless, the current immunosuppressive potency of MSC-sEVs falls short for clinical implementation, and ongoing research endeavors are dedicated to optimizing the use of MSC-sEVs by exploring their immunomodulatory mechanism [ 19 ].

CD73, also known as ecto-5’-nucleotidase (5’-NT, eN, eNT, NT5E), plays a pivotal role in purinergic signaling [ 20 ]. It facilitates the conversion of extracellular pro-inflammatory adenosine triphosphate (ATP) into anti-inflammatory adenosine [ 21 ]. Adenosine acts on various immune cells by binding to adenosine receptors on the cell surface (A1, A2A, A2B, and A3) [ 22 ], influencing cellular function through modulation of intracellular cAMP levels. While adenosine receptors A1AR and A3AR reduce cAMP levels, A2AR and A2BAR elevate intracellular cAMP levels, leading to activation of protein kinase A (PKA) pathways and inhibition of NF-κB and JAK-STAT signaling pathways [ 23 ], thereby suppressing inflammation in lymphocyte-mediated immune responses [ 24 , 25 , 26 ]. As the activity of CD73 is irreversible, ongoing research on CD73 holds promise, particularly in its potential to modulate immune responses via adenosine production. Research on CD73 is currently predominantly focused on tumor immunology. CD73-produced adenosine suppresses anti-tumor immune responses and blocking CD73 shows potential as a cancer treatment strategy [ 27 ]. However, the intricacies of CD73 in immune regulation highlight its significance in autoimmune diseases. Chen et al. first reported that the surface CD73 of MSCs can catalyze the production of adenosine, which, upon binding to the A2A adenosine receptor, inhibits the proliferation of Th1 cells [ 28 ]. Lee et al. demonstrated that human bone marrow-derived MSCs exhibit robust immunosuppressive capabilities by modulating Th17 cell responses through the CD39-CD73-mediated pathway [ 29 ]. Further research has indicated that MSCs can indirectly dampen inflammation by increasing the proportion of regulatory T-cells (Treg cells) through the adenosine pathways [ 30 ]. These findings proposed a potential mechanism by which MSCs exert their immunomodulatory effects on EAU. Notably, Schneider et al. showed that the AMPase activity of CD73 is predominantly provided by CD8 + T-cells, particularly in EVs [ 31 ]. Considering that CD73 is also expressed on MSC-sEVs, attention has shifted to exploring the relationship between MSC-sEVs and the CD39-CD73-adenosine signaling pathway. Kerkela et al. reported that MSC-sEVs can catalyze the production of adenosine through their surface marker CD73, thereby inhibiting T cell proliferation [ 32 ]. Crain et al. further investigated that MSC-sEVs can suppress the proliferation of CD4 + T-cells in a concentration-dependent manner, and this effect can be mitigated by the addition of A2A receptor antagonists [ 33 ]. These findings suggested that the adenosine signaling pathway may play crucial roles in the immune suppression mediated by MSC-sEVs. Consequently, we hypothesized that overexpressing CD73 could enhance the immunosuppressive potential of MSC-sEVs by regulating the Th1/Th17/Treg cell balance. Building upon this premise, our team successfully constructed MSC-sEVs overexpressing CD73 (sEVs-CD73) through lentiviral transduction. We then evaluated the immunosuppressive efficacy of sEVs-CD73 in experimental autoimmune uveitis (EAU) models.

Materials and methods

Experimental design.

All experiments were carried out in compliance with ARRIVE guidelines 2.0. Mice were randomly assigned to cages using a computer-generated randomization process. All measurements were standardized to ensure consistency and accuracy.

We used a total of 120 mice in our study. Each experimental and control group comprised 6 mice, based on our previous experience. Detailed information regarding the allocation of mice to specific experimental conditions is provided in the Materials and methods section. All female C57BL/6 mice (7–8 weeks old), purchased from GemPharmatech Co., Ltd. (China), were housed under specific pathogen-free (SPF) conditions. All mice were included in the experiment only after being confirmed to be free of any fundus or systemic diseases. Animal care and experimentation were conducted in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement. In this study, tribromoethanol was used for anesthetizing mice, and cervical dislocation was employed for euthanizing the mice. All animal procedures were approved by the Animal Care and Use Committee of Tianjin Medical University Eye Hospital (TMUEC).

Culture and identification of mesenchymal stem cells

Human umbilical cord-derived MSCs were provided by Beijing Beilai Biological Co., Ltd. (China), and MSC isolation and culture were performed as previously described [ 34 ]. Various methods are available for the identification of MSCs, including flow cytometry and differentiation assays. According to International Society for Cell & Gene Therapy (ISCT), MSCs were identified by their capacity to express specific cell surface markers (CD73, CD90), and lack expression of hematopoietic lineage markers (CD34, CD45) [ 35 ]. Additionally, their ability to differentiate into adipocytes, chondrocytes, and osteocytes under defined conditions was demonstrated by staining in vitro.

Production and transduction of Lentiviruses

Lentiviral vectors overexpressing CD73 and empty plasmids (pCDH-CMV-MCS-EF1-copGFP) (Hanbio Biotechnology, China) were packaged into human embryonic kidney 293 T cells (HEK-293 T) following the manufacturer’s instructions. The packaging plasmids and envelope plasmids were also involved in the transfection process. Lentiviral particles were harvested from the culture at 48 and 72 h post-transfection and subsequently concentrated by ultracentrifugation at 72,000×g for 2 h. The viral titer was assessed using the serial dilution method, as outlined in previous studies [ 36 ].

Transfection and supernatant collection

When reaching approximately 60% confluency at passage 2, MSCs were exposed to a viral particle mixture with a multiplicity of infection (MOI) of 50 and 8 µg/ml polybrene (Sigma-Aldrich, USA) in the culture medium. Subsequently, we obtained normal MSCs (MSC-N), vector-infected MSCs (MSC-V), and CD73-overexpressed MSCs (MSC-CD73). The conditioned medium from the third to fifth passage was collected for the production of MSC-sEVs. MSCs were cultured with complete DMEM/F-12 (Gibco, USA) media containing 10% fetal bovine serum (FBS) (Gibco) and 100 U/mL penicillin and streptomycin (Gibco). Before use, FBS and DMEM/F-12 were diluted at a ratio of 1:4 and centrifuged at 11,000×g overnight at 4 °C. This procedure aimed to reduce potential experimental confounds associated with sEVs present in FBS.

Quantitative real-time PCR (qRT-PCR)

The quantitative real-time PCR (qRT-PCR) was conducted to assess mRNA expression levels of different MSCs (MSC-N, MSC-V, MSC-CD73). Total RNA extraction was performed using the TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. Subsequently, cDNA was synthesized utilizing the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA). Each PCR reaction was set up in 384-well plates, comprising FastStart SYBR Green Master (Roche, Switzerland), cDNA, and 0.25 μm forward and reverse primers. The relative mRNA expression levels of the target genes were determined using the 2 −ΔΔCT method, with GAPDH serving as an internal standard [ 37 ]. The primer sequences used were as follows: CD73 forward: CCAGTACCAGGGCACTATCTG, reverse: TGGCTCGATCAGTCCTTCCA; GAPDH forward: AGGTCGGTGTGAACGGATTTG, reverse: GGGGTCGTTGATGGCAACA.

Collection of mesenchymal stem cell-derived small extracellular vesicles

The supernatant from both uninfected and infected MSCs was collected after 48 h of incubation and separated by ultracentrifugation to obtain each group of MSC-sEVs. The separation process involved centrifugation at 200×g for 10 min at 4 °C, followed by centrifugation at 2000×g for 20 min at 4 °C, and then at 10,000×g for 30 min at 4 °C. Subsequently, the resulting supernatant underwent two additional rounds of centrifugation at 110,000×g for 70 min at 4 °C to achieve a high concentration of MSC-sEVs [ 38 ]. All ultracentrifugation steps were performed using an Optima XLA/I centrifuge equipped with an An-45Ti rotor (Beckman-Coulter, USA). The final pellets were resuspended in sterile PBS (Gibco), and the concentration was measured using a BCA protein assay kit (Solarbio, China).

Identification of mesenchymal stem cell-derived small Extracellular vesicles

To accurately characterize and distinguish different types of MSC-sEVs, various techniques were employed in this study. Samples were quickly fixed with 50 µl 4% paraformaldehyde (Sigma-Aldrich) for 5 min and applied to carbon copper grids. Negative staining was then performed using 2% uranyl acetate solution (Sigma-Aldrich). After drying, MSC-sEVs were directly visualized using transmission electron microscopy (TEM). Additionally, nanoparticle tracking analysis (NTA) was used to measure the size and concentration of MSC-sEVs in a liquid medium. The particle size was analyzed using Nanosight (version 3.3). For identification of various protein markers associated with different MSC-sEVs, Western blot was used. The isolated MSC-sEVs were lysed to release their protein content, which was then separated by polyacrylamide gel electrophoresis (SDS-PAGE) based on size and charge. The separated proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Sigma-Aldrich) and incubated with a 5% non-fat dried milk to prevent non-specific binding of the antibody. The membrane was then probed with antibodies specific to MSC-sEVs-associated proteins, including CD63 (Abcam), TSG-101 (Abcam), CD73 (Abcam) and β-actin (Abcam). Additionally, the expression of CD73 on the surface of MSC-sEVs was also identified using ELISA kits, following the manufacturer’s instructions (R&D Systems).

Induction and treatment of experimental autoimmune uveitis

EAU in C57BL/6 mice was induced by immunization with an emulsion comprising equal volumes of complete Freund’s adjuvant (CFA, Sigma Aldrich) and 5 mg/mL desiccated Mycobacterium tuberculosis (TB, Sigma-Aldrich), as well as 300 µg interphotoreceptor retinoid-binding protein 651 − 670 (IRBP 651 − 670 , LAQGAYRTAVDLESLASQLT) (Shanghai Hanhong, China) in PBS. This emulsion was then applied to four spots on the tail base and flank. In addition, mice were intraperitoneally administered 500 ng pertussis toxin (PTX) (List Biological Laboratories, USA) on the day of immunization and 24 h post-immunization. Immunized mice were randomly assigned to different groups using a computer-generated random number sequence. The groups included PBS, MSC-sEVs (sEVs-N), vector-infected MSC-sEVs (sEVs-V), and sEVs-CD73. On day 11 post immunization, different groups of mice were injected via tail vein with 50 µg diverse MSC-sEVs respectively or equal volume of PBS.

Clinical and histological assessment of experimental autoimmune uveitis

EAU mice were examined every other day by head-mounted indirect fundoscopy from day 9 to day 21 post-immunization. On the 17th day post-immunization, mice were euthanized, and their eye tissues were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned (4 μm), and stained with hematoxylin and eosin (H&E). The histopathological changes of retina were examined and scored. The incidence and severity of inflammation were assessed according to the criteria of Caspi [ 39 ].

Optical coherence tomography

On the 17th day post-immunization, a total of six mice per group were anesthetized, and the pupils were dilated with 0.1% tropicamide. The mice were then placed in a prone position, and a corneal contact lens was used to stabilize the eye. Spectralis optical coherence tomography (OCT) (Heidelberg, Germany) was used to scan the retina, and the images were scored based on the criteria previously established by Gadjanski and colleagues [ 40 ].

Flow Cytometry detection of inflammatory cells

Mice were sacrificed on day 17 after immunization and their eyeballs, spleens (SP) and lymph nodes (LNs) were separated and ground. To prepare single lymphocyte suspension, the spleen was lysed with red blood cell lysis buffer (Sigma), while the eyeball tissue was digested with 1 mg/ml of collagenase D (Sigma-Aldrich) for 1 h. The resulting cell suspension was filtered through a 70-µm filter and then centrifuged. Part of these cells were incubated in a 96-well plate with 50 ng/mL phorbol 12-myristate 13-acetate (Sigma), 1 µg/mL ionomycin (Sigma), and 1 µg/mL brefeldin A (Abcam, USA). After incubation of 4.5 h, these cells were utilized to assess the ratio of Th1 and Th17 cells, while the remaining cells were prepared into single cell suspensions to determine the proportion of Treg cells.

The cells were incubated with Brilliant Violet™ 711 anti-mouse CD4 antibody for 30 min at 4 °C, followed by fixation and permeabilization according to the manufacturer’s instructions. Subsequently, FITC anti-mouse IFN-γ and PE anti-mouse IL-17 A antibodies were used to stain Th1 and Th17 cells, respectively. For Treg cells, the cells were stained with FITC anti-CD25 and PE anti-FOXP3 antibodies. The proportion of IFN-γ, IL-17 A, CD25, and FOXP-3 was then assessed using a FACSCalibur flow cytometer (BD Biosciences, USA) and analyzed with FlowJo software (USA). The laser for Brilliant Violet™ 711 was set at 405 nm, while for PE and FITC, it was set at 488 nm. The fluorescence channels corresponded to 710/50 (BV711), 575/25 (PE), and 530/30 (FITC), respectively. All antibodies were purchased from BioLegend.

Assay of T-cell proliferation in vitro by Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE)

The 96-well plates were precoated with 10 µg/mL anti-mouse CD3 mAb (BioLegend) and 5 µg/mL anti-mouse CD28 mAb (BioLegend) to stimulate CD4 + T-cells. The total CD4 + T-cells were isolated from spleens of naive mice by positive CD4 + T-cell isolation kit (Miltenyi Biotec, USA). The cells were then labeled with 1 µM carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen) for 10 min and co-cultured with MSC-sEVs at a concentration of 10 µg/ml. After 72 h of incubation, the CFSE fluorescence intensity was measured by FACS and analyzed by FlowJo.

T-cell differentiation assays in vitro

Naive CD4 + T-cells from spleens of naive mice were isolated using a positive isolation kit (Miltenyi Biotec). These purified cells were seeded at a density of 2 × 10 5 cells/well in 96-well plates pre-coated with anti-CD3/CD28 and then cultured under Th1, Th17, and Treg differentiation conditions, respectively. After cultivation, the corresponding antibody was stained. Th1, Th17 and Treg cell populations were analyzed by flow cytometry.

For Th1 polarization, cells were cultured in RPMI-1640 cell culture medium (Gibco) (supplemented with IL-12 at 20 ng/mL and anti-IL-4 at 10 µg/mL). For Th17 polarization, cells were cultured in RPMI-1640 cell culture medium (supplemented with IL-6 at 20 ng/mL, anti-IL-4 at 10 µg/mL, anti-IFN-γ at 10 µg/mL, and TGF-β1 at 2ng/mL). For Treg polarization, cells were cultured in RPMI-1640 cell culture medium (supplemented with TGF-β1 at 5 ng/mL and IL-2 at 20 ng/mL). After 5 days of culture, the cells were collected and analyzed using FACS. Recombinant cytokines were purchased from R&D Systems (Minneapolis, USA), while antibodies against these cytokines were purchased from BD Biosciences.

Quantification of adenosine levels using high performance liquid chromatography (HPLC)

Naive T-cells were cultured in RPMI-1640 cell culture medium supplemented with anti-CD3 and anti-CD28. After three days of culture, 50 µL cell supernatant was collected and transferred to a 1.5 ml EP tube. Subsequently, 50 µL of methanol was added, followed by thorough vortex mixing. Then, 100 µL of acetonitrile was added, vortexed for 30 s, and centrifuged at 12,000 rpm for 10 min at 4℃. The supernatant was collected for mass spectrometry detection. The subsequent performance liquid chromatography (HPLC) procedures were conducted using the ACQUITY UPLC I-Class/Xevo TQ-XS (Waters, USA). A series of adenosine standards ranging from 200 pg/ml to 20,000 pg/ml were prepared and stored at 4℃. A standard curve was constructed using the average peak area as the x-axis and adenosine concentration as the y-axis, with the regression equation calculated. The chromatographic column used was Waters BEH C18 (2.1*100 mm, 1.7 μm), maintained at 30℃.

Statistical analysis

The data obtained from all experiments were expressed as mean ± standard deviation (mean ± SD). In contrast, the one-way analysis of variance (one-way ANOVA) was utilized determine the statistical significance. These data were analyzed using the software GraphPad Prism 9.4 (GraphPad Software, USA). The criterion for statistical significance was set at P  < 0.05.

Identification of mesenchymal stem cells

The microscopic examination revealed the spindle-shaped morphology of MSCs adhering to the culture flask walls (Fig.  1 C). Furthermore, under specific differentiation conditions, MSCs demonstrated their ability to differentiate into osteocytes, chondrocytes, and adipocytes (Supplementary figure S1 ). Additionally, the flow cytometry identification of surface markers on MSCs can be referenced based on our previous findings [ 41 ].

Transfection of lentivirus into mesenchymal stem cells

To obtain a high expression lentivirus vector of CD73, we packaged the constructed plasmid into HEK-293T cells and measured the titer of the resulting supernatant after concentration. We found that the transfected HEK-293 T cells exhibited high green fluorescent protein (GFP) fluorescence expression under a fluorescence microscope. The titer of the CD73-overexpressed lentivirus reached 7 × 10 7 TU/ml, while that of the control vector was 2 × 10 9 TU/ml (Fig.  1 A, B). The MSCs were then transduced with the virus, and high fluorescence expression was observed under a fluorescence microscope 48 h post-transfection (Fig.  1 C).

Lentiviral titration assays and transduction. ( A-B ) Lentivirus titration assays depicted the over-expression of CD73 and empty vector controls, with viral titers reaching approximately 7 × 10 7 TU/ml and 2 × 10 9 TU/ml, respectively. ( C ) Bright field (BF) and dark field images revealed targeted gene expression 48 h post-lentiviral infection of MSCs. The high expression of GFP confirmed the successful transduction of the lentivirus.

Identification of mesenchymal stem cell-derived small extracellular vesicles

Firstly, we analyzed the size and morphology of sEVs purified from the conditioned medium of MSCs using Nanosight and Transmission electron microscopy (TEM). Nanosight analysis revealed that the average diameters of sEVs-N, sEVs-V, and sEVs-CD73 were 152 nm, 189 nm, and 183 nm, respectively, consistent with our definition of sEVs (Fig.  2 A). TEM images revealed that sEVs-N, sEVs-V, and sEVs-CD73 exhibited uniform size, circular shape, and double-layered membrane vesicular structures, consistent with the typical characteristics of sEVs (Fig.  2 B). Additionally, TEM analysis also indicated that the diameters of all three types of sEVs were smaller than 200 nm. Western blotting results confirmed the expression of CD63, TSG101, and CD73 in all groups, with successful high expression of CD73 in the sEVs-CD73 group (Fig.  2 C). Real-time PCR analysis showed high expression of CD73 mRNA in MSCs transfected with CD73-overexpressing lentivirus, consistent with the findings under fluorescence microscopy (Fig.  2 D). ELISA results indicated higher levels of the target protein in sEVs-CD73 compared to the other groups (Fig.  2 E). These results indicated that the vesicles isolated from MSCs exhibit characteristics consistent with sEVs and we successfully engineered sEVs overexpressing CD73.

Identification of MSC-sEVs. ( A ) Nanosight analysis depicting the size distribution of various MSC-sEVs. ( B ) TEM images illustrating the morphology of various MSC-sEVs. Scale bar = 200 nm. ( C ) Western blotting results indicating the expression of CD63, TSG101, and CD73 in sEVs-N, sEVs-V, and sEVs-CD73 group. To maintain conciseness, cropping was performed. Full-length blots were presented in Supplementary Figure S2 . ( D ) Real-time PCR results showing robust expression of the target gene after viral infection of MSCs. ( E ) ELISA results demonstrating elevated levels of the target protein in sEVs-CD73 compared to the other groups. Mean ± SD, n  = 3 per group, one-way ANOVA test. ***: P  < 0.001

Augmented suppression of experimental autoimmune uveitis following intravenous administration of CD73-overexpressing mesenchymal stem cell-derived small extracellular vesicles

To compare the therapeutic efficacy, we administered intravenous injection of 50 µg of sEVs-N, sEVs-V and sEVs-CD73 to mice on the 11th day post-immunization. The clinical scoring revealed inflammatory responses in the fundus around the 11th day post-immunization. From day 15 to day 21 post-immunization, the sEVs-CD73-treated group demonstrated a significantly lower mean clinical score compared to the other groups ( P  < 0.05) (Fig.  3 A). The peak of clinical scores was observed on day 17 post-immunization. On day 17 post-immunization, the mean clinical scores of the sEVs-N and sEVs-V groups were lower than those of the PBS group, although the difference between these two groups was not statistically significant. However, both groups exhibited higher clinical scores compared to the sEVs-CD73 group (Fig.  3 D). This finding was further corroborated by fundus images (Fig.  3 B). OCT results also demonstrated low OCT signal and severe inflammation cell infiltration at the disease peak in the PBS group, while the sEVs-N and sEVs-V groups displayed milder inflammation. Remarkably, treatment with sEVs-CD73 exhibited the most significant inhibition of these changes among all groups (Fig.  3 C). The OCT scores in the sEVs-CD73 group were significantly lower than those in the other three groups ( P  < 0.05) (Fig.  3 E). In addition, histological analysis confirmed these findings, with the sEVs-CD73-treated mice exhibiting fewer infiltrating inflammatory cells, reduced retinal folds, detachment, and granulomas than the other three groups (Fig.  4 ). These findings suggest that overexpression of CD73 enhances the protective effect of sEV-N on the retina during ocular inflammation.

Over-expression of CD73 enhanced the therapeutic efficacy of MSC-sEVs in EAU. ( A, D ) Mean clinical scores of mice treated with tail vein injection of 50ug sEVs recorded every 2 d from day 9 to day 21 post-immunization. ( B ) The fundus imaging of each sEVs-treated group on day 17 post-immunization. ( C, E ) On day 17 post-immunization, OCT was conducted, and the outcomes were quantified and presented as OCT scores. Mean ± SD, n  = 6 per group, one-way ANOVA test. *: P <0.05; **: P <0.01; ***: P <0.001

Treatment with sEVs-CD73 in EAU mice showed reduced inflammatory cell infiltration, retinal folds and granulomas. ( A ) Representative H&E-stained retinal cross-sections from different groups. The black arrows indicated retinal folds and detachments near the optic disk. GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. ( B ) Quantitative histopathological scores of the retina in each group. Mean ± SD, n  = 6 per group, one-way ANOVA test. **: P <0.01; ***: P  < 0.001

Reduced infiltration of inflammatory cells following treatment of CD73-overexpressing mesenchymal stem cell-derived small extracellular vesicles

T-cells, including Th1, Th17 and Treg cells, play crucial roles in cell-mediated immunity. In our previous studies, we observed that compared to the PBS control group, intravenous injection of 50 µg sEVs-N resulted in a lower percentage of Th1 and Th17 cells in the eyes of mice, and a higher percentage of Treg cells in the spleen and draining lymph nodes [ 41 ]. To better elucidate the influence of CD73 overexpression on sEVs, we collected tissues, including eyeballs, SP, and LNs, from mice to analyze the proportion of various T-cell subsets in each group at the peak of the disease. During the process of detecting T-cells in the eyeballs, one mouse was excluded due to death. Flow cytometric results showed a decrease in the proportions of Th1 cells (CD4 + IFN-γ + ) in the sEVs-CD73 group compared to the sEVs-N and sEVs-V groups in the eyeballs, SP and LNs ( P  < 0.05) (Fig.  5 A-C). Surprisingly, CD73 overexpression did not significantly enhance or inhibit the effect of MSC-sEVs on Th17 cells (CD4 + IL-17 A + ) in these immune-related tissues (Fig.  5 A-C). Moreover, the proportion of Treg cells (CD4 + CD25 + Foxp-3 + ) also exhibited significant changes in the SP and LNs ( P  < 0.05). As illustrated in Fig.  5 B-C, the proportion of Treg cells in the sEVs-CD73 group was significantly higher than that in the sEVs-N and sEVs-V groups ( P  < 0.05). These findings suggest that MSC-sEVs exhibiting high CD73 expression possess augmented inhibitory capabilities against Th1 cells while exerting activating effects on Treg cells. However, CD73 overexpression did not significantly alter the inhibitory effects of sEVs on Th17 cells.

sEVs-CD73 treatment in EAU mice inhibited Th1 cells and increased Treg cells compared to sEVs-N. ( A ) Flow cytometric results of the proportions of Th1 (CD4 + IFN-γ + ) cells and Th17 (CD4 + IL-17A + ) cells in the eyeballs ( n  = 5) of mice from different groups. ( B ) Flow cytometric results of the proportions of Th1 cells, Th17 cells and Treg (CD4 + FOXP3 + CD25 + ) cells in the SP of mice ( n  = 6) from different groups. ( C ) Flow cytometric results of the proportions of Th1 cells, Th17 cells and Treg cells in the LNs of mice ( n  = 6) from different groups. We performed relative quantification analysis to compare the experimental groups with a blank control group, which served as the baseline. Mean ± SD, one-way ANOVA test. *: P <0.05; **: P <0.01; ***: P <0.001

Amplified inhibitory effect of CD73 over-expressing mesenchymal stem cell-derived small extracellular vesicles on T cell proliferation

The effect of sEVs-CD73 on T-cell proliferation was evaluated by isolating CD4 + T-cells from SP and LNs of naïve mice using a magnetic bead positive selection kit. These T-cells were then co-cultured with MSC-sEVs from each group at various concentrations, and CFSE expression was assessed after four days of culture. Our previous studies confirmed the impact of different concentrations (0, 1, 10, 50, and 100 µg/mL) of sEVs-N on the proliferation of initial CD4 + T-cells. The sEVs-N group exhibited a notable inhibitory effect compared to the PBS group at a concentration of 10 µg/mL, suggesting a concentration-dependent response [ 41 ]. Consequently, we selected this concentration of 10 µg/mL for further investigation. In the current study, flow cytometric analysis revealed that sEVs-CD73 exhibited a more robust inhibitory effect on T-cell proliferation compared to the sEVs-N and sEVs-V groups at a concentration of 10 µg/mL (Fig.  6 A-B). These findings indicate that overexpression of CD73 enhances the inhibitory effect of sEVs-N on T cell proliferation in vitro.

Enhanced effect of CD73 over-expressing mesenchymal stem cell-derived small extracellular vesicles on Th1 and Treg cell differentiation

Naive T-cells combined with 10 µg/ml of various MSC-sEVs in specific differentiation conditions were cultured for 4 days to assess immune cell proportions. Compared to the other groups, the sEVs-CD73 group exhibited significantly enhanced inhibitory effects on Th1 cell (CD4 + IFN-γ + ) proportion (Fig.  6 C, D) and promoting effects on Treg cell (CD4 + CD25 + Foxp-3 + ) proportion ( P  < 0.05) (Fig.  6 G, H). However, there were no significant differences in the inhibitory effects on Th1 and Treg cell differentiation between the sEVs-N and sEVs-V groups ( P  > 0.05). Regarding Th17 cell (CD4 + IL-17A + ) differentiation, there were no significant differences among these three groups treated with sEVs ( P  > 0.05) (Fig.  6 E, F). These results are consistent with findings from in vivo studies, suggesting that CD73 overexpression may enhance the immunosuppressive effects of sEVs-N by modulating the proportions of Th1 and Treg cells rather than Th17 cells.

sEVs-CD73 inhibited T-cell proliferation and Th1 cell differentiation, while stimulating Treg cells in vitro. ( A, B ) In vitro inhibition of T-cell proliferation by sEVs-CD73 compared to other groups. ( C, D ) In vitro inhibition of Th1 cell differentiation by sEVs-CD73 compared to other groups. ( E, F ) In vitro unchanged effect of Th17 cell differentiation by sEVs-CD73 compared to sEVs-N and sEVs-V groups. ( G, H ) In vitro promotion of Treg cell differentiation by sEVs-CD73 compared to other groups. Mean ± SD, n  = 3 per group, one-way ANOVA test. All experiments were independently repeated 3 times. *: P <0.05; **: P <0.01; ***: P  < 0.001

CD73-enriched mesenchymal stem cell-derived small extracellular vesicles increased adenosine levels in the T-cell supernatant

Using HPLC, the adenosine content in the supernatant of Naive T-cells co-cultured with different groups of MSC-sEVs was analyzed. The linear regression equation for the adenosine standard curve was Y = 13.8533X + 3980.22, with an R 2 value of 0.9991 (Fig.  7 A). A distinct peak at 1.62 min was observed (Fig.  7 B). The addition of sEVs-N and sEVs-V led to an increase in adenosine production compared to the control group, although not reaching statistical significance. However, the sEVs-CD73 group showed a significant increase in adenosine compared to the other three groups (Fig.  7 C).

sEVs-CD73 facilitates the generation of adenosine in vitro. ( A ) The linear regression equation of adenosine standard curve. ( B ) The chromatographic peak of adenosine in sEVs-CD73 group detected by HPLC. ( C ) After co-culturing with T-cells, cell supernatant from the sEVs-CD73 group exhibited the highest proportion of secreted adenosine among the four groups. Mean ± SD, n  = 3 per group, one-way ANOVA test. ***: P <0.001

Our study established that, in comparison to the control group, MSC-sEVs exhibiting elevated CD73 expression exerted a more robust suppressive effect on the progression of EAU. In vivo experiments indicated that sEVs-CD73 can significantly reduce tissue infiltration of EAU in mice compared to normal MSC-sEVs. This alteration may be achieved by inhibiting T-cell proliferation, reducing the Th1 ratio, and increasing the Treg ratio. In vitro results were consistent with those observed in vivo. Moreover, we speculated that the suppressive effect of sEVs-CD73 on EAU was likely mediated by the increased production of adenosine.

Traditional treatment methods for uveitis typically involve the administration of corticosteroids, immunosuppressive agents, or biologic therapies. Prolonged use of corticosteroids and immunosuppressive agents can lead to ocular complications and systemic side effects. Biologic therapies, such as anti-tumor necrosis factor agents, may be expensive and require regular monitoring for adverse effects. While MSCs show promise in treating immune-related diseases like autoimmune uveitis, clinical studies have raised concerns about its safety and efficacy [ 34 , 42 , 43 ]. Moreover, the characteristics of MSCs are influenced by the tissue source and donor physiological status, which should be taken into consideration in clinical applications [ 44 ]. Compared to existing treatment methods, sEVs-CD73 demonstrates significant advantages. Firstly, sEVs-based therapy harnesses the therapeutic potential of EVs. After treatment, sEVs exhibit excellent biocompatibility, allowing them to penetrate the blood-retinal barriers and effectively reach target sites. Secondly, as natural vesicles, sEVs exhibit inherent safety, offering a choice for the treatment of immune disorders.

Our research team previously observed that on the 11th day post-immunization, mice treated with 50 µg MSC-sEVs via tail vein injection exhibited a reduction in the proportion of Th1 and Th17 cells compared to the control group, while the proportion of Treg cells was elevated [ 41 ]. Previous research suggested that CD73-mediated adenosine production by MSCs contributes to their immunomodulatory effects, suggesting a potential mechanism for their therapeutic efficacy in EAU [ 28 ]. This finding aligns with previous literature regarding the mechanism of action of MSC-sEVs. We hypothesized that sEVs-CD73 may regulate the Th1/Th17/Treg cell balance by promoting adenosine generation, thereby creating an immune-suppressive microenvironment. Our results indicated that the proportions of Th1 and Treg cells were consistent with our expectations. However, despite the overexpression of CD73, the administration of MSC-sEVs did not significantly alter the suppressive effect on Th17 cells. The relationship between CD73, its hydrolysis product adenosine, and Th17 cells remains incompletely understood. CD73 exhibits diverse biological functions across different cell types, with its deficiency in some cells enhancing susceptibility to autoimmune diseases, while in others, the effects are reversed.

Sun et al. demonstrated contrasting effects of adenosine on Th1 and Th17 cells, mediated by various immune cells, notably γδT cells and DCs [ 45 ]. Activation of adenosine receptors amplifies the activation of γδT cells, which serve as critical promoters of Th17 responses and significantly influences DCs differentiation. This shift in DCs differentiation favors the generation of DCs that stimulate Th17 responses over those that stimulate Th1 responses. These findings suggest that CD73-mediated hydrolysis of adenosine monophosphate (AMP) to adenosine may shift the balance towards Th17 cells, thereby exacerbating autoimmune responses. During various stages of EAU, γδT cells exhibited varying levels of CD73 and A2AR expression. In active disease stages, adenosine collaborates with elevated cytokine levels, resulting in amplified activation of γδT cells and Th17 responses [ 46 ]. Upon activation, γδT cells exhibit elevated expression of A2AR but reduced levels of CD73. While heightened A2AR expression enables activated γδT cells to efficiently bind adenosine compared to other immune cells, diminished CD73 expression limits their capacity to convert AMP into adenosine, potentially exacerbating inflammatory reactions [ 47 , 48 , 49 ]. However, during inactive disease stages characterized by low cytokine levels, adenosine does not augment γδT cell activation. This underscores the variable activation status of γδT cells and A2AR expression during different EAU stages, influencing disease progression. The A2AR antagonist SCH significantly impeded the progression of EAU primarily by regulating Th17 responses. Nevertheless, the timing of treatment administration is crucial. The antagonist effectively curbed EAU advancement only when administered during the active disease stage, but proved ineffective if initiated during the disease induction phase [ 46 ].

In line with our findings, Hernandez-Mir and colleagues (2017) reported similar results [ 50 ]. Their results demonstrated that CD73 deficiency did not significantly influence the progression of experimental autoimmune encephalomyelitis (EAE) or the differentiation of Th17 cells in vitro. These findings contrast with those of Mills et al., who reported reduced severity of EAE in CD73-/- mice along with decreased IFN-γ secretion [ 51 ]. Discrepancies in EAE induction protocols across different laboratories may contribute to variations in the balance between Th17 and Th1 cell populations induced, thus influencing the impact of CD73 presence on disease severity. Hernandez-Mir et al. suggested a primary association between EAE and Th17 cells, while Mills et al. focused their investigation on Th1 cells, proposing a potential pivotal role of CD73 in disease development. Additionally, Hernandez-Mir et al. found that the lack of CD73 had no significant effect on the proportion of Treg cells or their recruitment to the central nervous system. In contrast, our study suggested that overexpression of CD73 enhances the promotive effect of MSC-sEVs on Treg cells in EAU-induced mice. The differences in these results may be attributed to variations in experimental models and procedural differences among different laboratories, leading to variations in the proportions of Treg and Th17 cells within the disease models. While conflicting data exists for the role of Treg cells in EAE [ 52 , 53 ], they have been shown to act as inhibitory T cells in EAU. These regulatory T cells can inhibit cytokine production and T cell proliferation, and one of their immunomodulatory mechanisms involves promoting adenosine generation through CD39 and CD73, leading to increased intracellular cAMP levels upon binding to adenosine receptors. Further investigation revealed that in microenvironments enriched with sEVs expressing CD73 or other CD73-expressing lymphocytes, CD4 + CD39 + Tregs readily interact with surface CD73, mediating adenosine-driven immunosuppressive effects [ 54 ]. Although our results demonstrate that MSC-sEVs overexpressing CD73 cannot directly inhibit the differentiation of Th17 cells, these vesicles effectively suppress Th1 cells and promote Treg cells. Given the critical roles of Th1 and Treg cells in the development of EAU, sEVs-CD73 can shift the balance of immune-related cells towards Treg cells, resulting in more potent immunosuppressive effects than MSC-sEVs alone, thus inhibiting the progression of EAU.

However, certain limitations and avenues for further exploration should be noted. Firstly, technical and time constraints prevented us from measuring pro-inflammatory and anti-inflammatory factors (such as IL-6, IL-4, and IL-10) in the vitreous humor of EAU mice. Additionally, we lack detection of Treg cell proportions in the eyes among all groups. These omissions may have hindered a comprehensive understanding of how our engineered sEVs modulate the immune response. Furthermore, discrepancies between our findings regarding Th17 cells and those reported in existing literature underscore the complexity of the immune response in uveitis. These inconsistencies warrant further investigation to clarify the underlying mechanisms governing Th17 cell modulation by sEVs-CD73. Moreover, the lack of safety validation is a notable concern. Safety validation is crucial for clinical translation. In summary, addressing these limitations through further research will be crucial for advancing our understanding of the safety and efficacy of CD73-overexpressed MSC-sEVs for the treatment of autoimmune uveitis.

Conclusions

Overall, we successfully constructed MSC-sEVs with high CD73 expression. We found that these vesicles exhibited a significantly greater inhibitory effect on EAU compared to normal MSC-sEVs. This effect may be attributed to the enhancement of extracellular adenosine production, thereby augmenting the impact of MSC-sEVs on Th1 and Treg cells. Therefore, CD73-overexpressing MSC-sEVs could present a novel therapeutic avenue for addressing autoimmune uveitis or other autoimmune disorders.

Data availability

The statistical numeric data and figures supporting the conclusions of this article are openly available in Figshare repository at figshare.com ( https://doi.org/10.6084/m9.figshare.25709115 ). Additional data are available from the corresponding author upon reasonable request.

Abbreviations

adenosine monophosphate

analysis of variance

Association for Research in Vision and Ophthalmology

adenosine triphosphate

bright field

complete Freund’s adjuvant

carboxyfluorescein diacetate succinimidyl ester

experimental autoimmune encephalomyelitis

experimental autoimmune uveitis

fetal bovine serum

glucocorticoids

green fluorescent protein

human embryonic kidney 293 T cells

interphotoreceptor retinoid-binding protein

hematoxylin and eosin

liquid chromatography

International Society for Cell & Gene Therapy

lymph nodes

Minimal information for studies of extracellular vesicles

multiplicity of infection

mesenchymal stem cells

normal MSCs

mesenchymal stem cell-derived small extracellular vesicles

vector-infected MSCs

CD73-overexpressed MSCs

nanoparticle tracking analysis

spectralis optical coherence tomography

programmed cell death protein 1

protein kinase A

pertussis toxin

polyvinylidene difluoride

quantitative real-time PCR

standard deviation

small extracellular vesicles

CD73-overexpressed MSC-sEVs

normal MSC-sEVs

vector-infected MSC-sEVs

specific pathogen-free

mycobacterium tuberculosis

Tianjin Medical University Eye Hospital

Regulatory T-cells

Selmi C. Diagnosis and classification of autoimmune uveitis. Autoimmun Rev. 2014;13(4–5):591–4.

Article   CAS   PubMed   Google Scholar  

Prete M, Dammacco R, Fatone MC, Racanelli V. Autoimmune uveitis: clinical, pathogenetic, and therapeutic features. Clin Exp Med. 2016;16(2):125–36.

Nozik RA. Periocular injection of steroids. Trans Am Acad Ophthalmol Otolaryngol. 1972;76(3):695–705.

CAS   PubMed   Google Scholar  

Jea SY, Byon IS, Oum BS. Triamcinolone-induced intraocular pressure elevation: intravitreal injection for macular edema and posterior subtenon injection for uveitis. Korean J Ophthalmol. 2006;20(2):99–103.

Article   PubMed   PubMed Central   Google Scholar  

Yoshikawa K, Kotake S, Ichiishi A, Sasamoto Y, Kosaka S, Matsuda H. Posterior sub-tenon injections of repository corticosteroids in uveitis patients with cystoid macular edema. Jpn J Ophthalmol. 1995;39(1):71–6.

Oh JY, Lee RH. Mesenchymal stromal cells for the treatment of ocular autoimmune diseases. Prog Retin Eye Res. 2021;85:100967.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Tasso R, Ilengo C, Quarto R, Cancedda R, Caspi RR, Pennesi G. Mesenchymal stem cells induce functionally active T-regulatory lymphocytes in a paracrine fashion and ameliorate experimental autoimmune uveitis. Invest Ophthalmol Vis Sci. 2012;53(2):786–93.

Qin Y, Chan AM, Chang YL, Matynia A, Kouris NA, Kimbrel EA, et al. Human embryonic stem cell-derived mesenchymal stromal cells decrease the development of severe experimental autoimmune uveitis in B10.RIII mice. Ocul Immunol Inflamm. 2018;26(8):1228–36.

Yang C, Wu M, You M, Chen Y, Luo M, Chen Q. The therapeutic applications of mesenchymal stromal cells from human perinatal tissues in autoimmune diseases. Stem Cell Res Ther. 2021;12(1):103.

Rahman MM, Islam MR, Islam MT, Harun-Or-Rashid M, Islam M, Abdullah S et al. Stem cell transplantation therapy and neurological disorders: current status and future perspectives. Biology (Basel). 2022;11(1).

Singh B, Mal G, Verma V, Tiwari R, Khan MI, Mohapatra RK, et al. Stem cell therapies and benefaction of somatic cell nuclear transfer cloning in COVID-19 era. Stem Cell Res Ther. 2021;12(1):283.

Eggenhofer E, Benseler V, Kroemer A, Popp FC, Geissler EK, Schlitt HJ, et al. Mesenchymal stem cells are short-lived and do not migrate beyond the lungs after intravenous infusion. Front Immunol. 2012;3:297.

Toma C, Pittenger MF, Cahill KS, Byrne BJ, Kessler PD. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation. 2002;105(1):93–8.

Article   PubMed   Google Scholar  

Dlouhy BJ, Awe O, Rao RC, Kirby PA, Hitchon PW. Autograft-derived spinal cord mass following olfactory mucosal cell transplantation in a spinal cord injury patient: Case report. J Neurosurg Spine. 2014;21(4):618–22.

Vulliet PR, Greeley M, Halloran SM, MacDonald KA, Kittleson MD. Intra-coronary arterial injection of mesenchymal stromal cells and microinfarction in dogs. Lancet. 2004;363(9411):783–4.

Thery C, Witwer KW, Aikawa E, Alcaraz MJ, Anderson JD, Andriantsitohaina R, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles. 2018;7(1):1535750.

Zhou Y, Yamamoto Y, Xiao Z, Ochiya T. The immunomodulatory functions of mesenchymal Stromal/Stem cells mediated via paracrine activity. J Clin Med. 2019;8(7).

Zhang B, Yin Y, Lai RC, Tan SS, Choo AB, Lim SK. Mesenchymal stem cells secrete immunologically active exosomes. Stem Cells Dev. 2014;23(11):1233–44.

Gnecchi M, Danieli P, Malpasso G, Ciuffreda MC. Paracrine mechanisms of mesenchymal stem cells in tissue repair. Methods Mol Biol. 2016;1416:123–46.

Alcedo KP, Bowser JL, Snider NT. The elegant complexity of mammalian ecto-5’-nucleotidase (CD73). Trends Cell Biol. 2021;31(10):829–42.

Yegutkin GG. Nucleotide- and nucleoside-converting ectoenzymes: important modulators of purinergic signalling cascade. Biochim Biophys Acta. 2008;1783(5):673–94.

Hasko G, Linden J, Cronstein B, Pacher P. Adenosine receptors: therapeutic aspects for inflammatory and immune diseases. Nat Rev Drug Discov. 2008;7(9):759–70.

Baharav E, Bar-Yehuda S, Madi L, Silberman D, Rath-Wolfson L, Halpren M, et al. Antiinflammatory effect of A3 adenosine receptor agonists in murine autoimmune arthritis models. J Rheumatol. 2005;32(3):469–76.

Cronstein BN, Levin RI, Philips M, Hirschhorn R, Abramson SB, Weissmann G. Neutrophil adherence to endothelium is enhanced via adenosine A1 receptors and inhibited via adenosine A2 receptors. J Immunol. 1992;148(7):2201–6.

Raskovalova T, Lokshin A, Huang X, Su Y, Mandic M, Zarour HM, et al. Inhibition of cytokine production and cytotoxic activity of human antimelanoma specific CD8 + and CD4 + T lymphocytes by adenosine-protein kinase a type I signaling. Cancer Res. 2007;67(12):5949–56.

Mandapathil M, Hilldorfer B, Szczepanski MJ, Czystowska M, Szajnik M, Ren J, et al. Generation and accumulation of immunosuppressive adenosine by human CD4 + CD25highFOXP3 + regulatory T cells. J Biol Chem. 2010;285(10):7176–86.

Chen S, Wainwright DA, Wu JD, Wan Y, Matei DE, Zhang Y, et al. CD73: an emerging checkpoint for cancer immunotherapy. Immunotherapy. 2019;11(11):983–97.

Chen X, Shao H, Zhi Y, Xiao Q, Su C, Dong L, et al. CD73 pathway contributes to the Immunosuppressive ability of mesenchymal stem cells in intraocular autoimmune responses. Stem Cells Dev. 2016;25(4):337–46.

Lee JJ, Jeong HJ, Kim MK, Wee WR, Lee WW, Kim SU, et al. CD39-mediated effect of human bone marrow-derived mesenchymal stem cells on the human Th17 cell function. Purinergic Signal. 2014;10(2):357–65.

Huang F, Chen M, Chen W, Gu J, Yuan J, Xue Y, et al. Human gingiva-derived mesenchymal stem cells inhibit Xeno-Graft-versus-host disease via CD39-CD73-Adenosine and IDO signals. Front Immunol. 2017;8:68.

Schneider E, Winzer R, Rissiek A, Ricklefs I, Meyer-Schwesinger C, Ricklefs FL, et al. CD73-mediated adenosine production by CD8 T cell-derived extracellular vesicles constitutes an intrinsic mechanism of immune suppression. Nat Commun. 2021;12(1):5911.

Kerkela E, Laitinen A, Rabina J, Valkonen S, Takatalo M, Larjo A, et al. Adenosinergic immunosuppression by human mesenchymal stromal cells requires co-operation with T cells. Stem Cells. 2016;34(3):781–90.

Crain SK, Robinson SR, Thane KE, Davis AM, Meola DM, Barton BA, et al. Extracellular vesicles from Wharton’s Jelly Mesenchymal stem cells suppress CD4 expressing T cells through transforming growth factor Beta and Adenosine Signaling in a Canine Model. Stem Cells Dev. 2019;28(3):212–26.

Bai L, Shao H, Wang H, Zhang Z, Su C, Dong L, et al. Effects of Mesenchymal Stem Cell-Derived exosomes on Experimental Autoimmune Uveitis. Sci Rep. 2017;7(1):4323.

Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315–7.

Jian R, Yang M, Xu F. Lentiviral-mediated silencing of mast cell-expressed membrane protein 1 promotes angiogenesis of rats with cerebral ischemic stroke. J Cell Biochem. 2019;120(10):16786–97.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.

Witwer KW, Buzas EI, Bemis LT, Bora A, Lasser C, Lotvall J et al. Standardization of sample collection, isolation and analysis methods in extracellular vesicle research. J Extracell Vesicles. 2013;2.

Agarwal RK, Caspi RR. Rodent models of experimental autoimmune uveitis. Methods Mol Med. 2004;102:395–419.

Gadjanski I, Williams SK, Hein K, Sattler MB, Bahr M, Diem R. Correlation of optical coherence tomography with clinical and histopathological findings in experimental autoimmune uveoretinitis. Exp Eye Res. 2011;93(1):82–90.

Li Y, Ren X, Zhang Z, Duan Y, Li H, Chen S, et al. Effect of small extracellular vesicles derived from IL-10-overexpressing mesenchymal stem cells on experimental autoimmune uveitis. Stem Cell Res Ther. 2022;13(1):100.

Yang J, Ren XJ, Chen XT, Jiang YF, Han ZB, Han ZC, et al. Human umbilical cord-derived mesenchymal stem cells treatment for refractory uveitis: a case series. Int J Ophthalmol. 2021;14(11):1784–90.

Kim JY, You YS, Kim SH, Kwon OW. Epiretinal Membrane Formation after Intravitreal Autologous Stem Cell Implantation in a Retinitis Pigmentosa Patient. Retin Cases Brief Rep. 2017;11(3):227–31.

Dar ER, Gugjoo MB, Javaid M, Hussain S, Fazili MR, Dhama K et al. Adipose tissue- and bone marrow-derived mesenchymal stem cells from Sheep: culture characteristics. Anim (Basel). 2021;11(8).

Sun D, Ko M, Shao H, Kaplan HJ. Adenosine receptor ligation tips the uveitogenic Th1 and Th17 balance towards the latter in experimental autoimmune uveitis-induced mouse. Curr Res Immunol. 2021;2:93–103.

Ko MK, Shao H, Kaplan HJ, Sun D. Timing effect of Adenosine-Directed Immunomodulation on Mouse Experimental Autoimmune Uveitis. J Immunol. 2021;207(1):153–61.

Nian H, Shao H, O’Brien RL, Born WK, Kaplan HJ, Sun D. Activated gammadelta T cells promote the activation of uveitogenic T cells and exacerbate EAU development. Invest Ophthalmol Vis Sci. 2011;52(8):5920–7.

Shao H, Kaplan HJ, Sun D. The role of Adenosine in gammadelta T-Cell regulation of Th17 responses in experimental autoimmune uveitis. Biomolecules. 2023;13(10).

Liang D, Shao H, Born WK, O’Brien RL, Kaplan HJ, Sun D. High level expression of A2ARs is required for the enhancing function, but not for the inhibiting function, of gammadelta T cells in the autoimmune responses of EAU. PLoS ONE. 2018;13(6):e0199601.

Hernandez-Mir G, McGeachy MJ. CD73 is expressed by inflammatory Th17 cells in experimental autoimmune encephalomyelitis but does not limit differentiation or pathogenesis. PLoS ONE. 2017;12(3):e0173655.

Mills JH, Thompson LF, Mueller C, Waickman AT, Jalkanen S, Niemela J, et al. CD73 is required for efficient entry of lymphocytes into the central nervous system during experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 2008;105(27):9325–30.

McGeachy MJ, Stephens LA, Anderton SM. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4 + CD25 + regulatory cells within the central nervous system. J Immunol. 2005;175(5):3025–32.

Korn T, Reddy J, Gao W, Bettelli E, Awasthi A, Petersen TR, et al. Myelin-specific regulatory T cells accumulate in the CNS but fail to control autoimmune inflammation. Nat Med. 2007;13(4):423–31.

Schuler PJ, Saze Z, Hong CS, Muller L, Gillespie DG, Cheng D, et al. Human CD4 + CD39 + regulatory T cells produce adenosine upon co-expression of surface CD73 or contact with CD73 + exosomes or CD73 + cells. Clin Exp Immunol. 2014;177(2):531–43.

Download references

Acknowledgements

Not applicable.

This research was funded by the National Natural Science Foundation of China (81900846) and Tianjin Key Medical Discipline (Specialty) Construction Project (TJYXZDXK-037A).

Author information

Yanan Duan and Xiteng Chen contributed equally to this work.

Authors and Affiliations

Tianjin Key Laboratory of Retinal Functions and Diseases, Tianjin Branch of National Clinical Research Center for Ocular Disease, Eye Institute and School of Optometry, Tianjin Medical University Eye Hospital, Tianjin, China

Yanan Duan, Xiteng Chen, Yongtao Li, Zhihui Zhang, Huan Li, Chuan Zhao, Hong Xiao, Jiawei Wang & Xiaomin Zhang

Department of Ophthalmology and Visual Sciences, Kentucky Lions Eye Center, School of Medicine, University of Louisville, Louisville, KY, USA

You can also search for this author in PubMed   Google Scholar

Contributions

Methodology, YND, HS, ZHZ, YTL and HL; Conceptualization, XTC, HS; Validation and formal analysis, YND, CZ, HX and JWW; Writing—original draft preparation: YND; Writing—review and editing, XMZ; Supervision, XMZ; Funding acquisition, XTC. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Xiaomin Zhang .

Ethics declarations

Ethics approval and consent to participate.

The animal studies were approved by the Laboratory Animal Care and Use Committee of Tianjin Medical University Eye Hospital (TMUEC) (No. TJYY20230202892). The approved project was titled “The Mechanism Study of MSCs-exo Regulating Th17/Treg Cells in Treating Mouse EAU via CD39/CD73/Adenosine Pathway.” The date of approval is February 2, 2023.

Consent for publication

Competing interests.

The authors have declared that no competing interest exists.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Additional file 1

: Figure S1. Identification of MSCs. Specific differentiation conditions promote successful differentiation of MSCs into osteoblasts, chondrocytes, and adipocytes.

Additional file 2

: Figure S2. The Western blot gel image depicted protein expression patterns in sEVs-N, sEVs-V, sEVs-CD73. To minimize cross-contamination between different antibodies, two gels were prepared to detect the expression of surface proteins on distinct groups of sEVs. Gel 1 was utilized for detecting CD63 and TSG101, while Gel 2 was employed for incubating with CD73. Both gels were loaded with the same amounts of samples, and β-actin was probed on each gel to ensure consistency in loading. Lane assignments were as follows: Lane 1, 2 (sEVs-N); Lane 3, 4 (sEVs-V); Lane 5, 6 (sEVs-CD73). For conciseness, the images were cropped, as indicated by the boxed area.

Additional file 3

: Figure S3. Flow cytometry gating strategy for Th1 and Th17 cells in the eye, spleen, and lymph nodes. Cell suspensions were prepared from eye (A), spleen (B), and lymph node tissues (C), and stained with Brilliant Violet™ 711 anti-mouse CD4, FITC anti-mouse IFN-γ and PE anti-mouse IL-17A antibodies. Lymphocytes were gated first, followed by selection of CD4 + T-lymphocytes, and subsequently gated for specific IFN-γ and IL-17A expression.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Duan, Y., Chen, X., Shao, H. et al. Enhanced immunosuppressive capability of mesenchymal stem cell-derived small extracellular vesicles with high expression of CD73 in experimental autoimmune uveitis. Stem Cell Res Ther 15 , 149 (2024). https://doi.org/10.1186/s13287-024-03764-7

Download citation

Received : 16 January 2024

Accepted : 20 May 2024

Published : 23 May 2024

DOI : https://doi.org/10.1186/s13287-024-03764-7

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Mesenchymal stem cell
• Small extracellular vesicle
• Autoimmune uveitis

Stem Cell Research & Therapy

ISSN: 1757-6512

• Submission enquiries: Access here and click Contact Us
• General enquiries: [email protected]

Time in Elektrostal , Moscow Oblast, Russia now

• Tokyo 11:22AM
• Beijing 10:22AM
• Kyiv 05:22AM
• Paris 04:22AM
• London 03:22AM
• New York 10:22PM
• Los Angeles 07:22PM

Time zone info for Elektrostal

• The time in Elektrostal is 8 hours ahead of the time in New York when New York is on standard time, and 7 hours ahead of the time in New York when New York is on daylight saving time.
• Elektrostal does not change between summer time and winter time.
• The IANA time zone identifier for Elektrostal is Europe/Moscow.

Time difference from Elektrostal

Sunrise, sunset, day length and solar time for elektrostal.

• Sunrise: 03:51AM
• Sunset: 08:56PM
• Day length: 17h 5m
• Solar noon: 12:24PM
• The current local time in Elektrostal is 24 minutes ahead of apparent solar time.

Elektrostal on the map

• Location: Moscow Oblast, Russia
• Latitude: 55.79. Longitude: 38.46
• Population: 144,000

Best restaurants in Elektrostal

• #1 Tolsty medved - Steakhouses food
• #2 Ermitazh - European and japanese food
• #3 Pechka - European and french food

Find best places to eat in Elektrostal

• Best pizza restaurants in Elektrostal
• Best restaurants with desserts in Elektrostal
• Best dinner restaurants in Elektrostal

The 50 largest cities in Russia

Some results uranium dioxide powder structure investigation

• Processes of Obtaining and Properties of Powders
• Published: 28 June 2009
• Volume 50 , pages 281–285, ( 2009 )

Cite this article

• E. I. Andreev 1 ,
• K. V. Glavin 2 ,
• A. V. Ivanov 3 ,
• V. V. Malovik 3 ,
• V. V. Martynov 3 &
• V. S. Panov 2  

7 Citations

Explore all metrics

Features of the macrostructure and microstructure of uranium dioxide powders are considered. Assumptions are made on the mechanisms of the behavior of powders of various natures during pelletizing. Experimental data that reflect the effect of these powders on the quality of fuel pellets, which is evaluated by modern procedures, are presented. To investigate the structure of the powders, modern methods of electron microscopy, helium pycnometry, etc., are used. The presented results indicate the disadvantages of wet methods for obtaining the starting UO 2 powders by the ammonium diuranate (ADU) flow sheet because strong agglomerates and conglomerates, which complicate the process of pelletizing, are formed. The main directions of investigation that can lead to understanding the regularities of formation of the structure of starting UO 2 powders, which will allow one to control the process of their fabrication and stabilize the properties of powders and pellets, are emphasized.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Price includes VAT (Russian Federation)

Instant access to the full article PDF.

Rent this article via DeepDyve

Institutional subscriptions

Similar content being viewed by others

Investigation of the Properties of Uranium-Molybdenum Pellet Fuel for VVER

Investigation of the Influence of the Energy of Thermal Plasma on the Morphology and Phase Composition of Aluminosilicate Microspheres

Evaluation of the possibility of fabricating uranium-molybdenum fuel for vver by powder metallurgy methods.

Patlazhan, S.A., Poristost’ i mikrostruktura sluchainykh upakovok tverdykh sharov raznykh razmerov (Porosity and Microstructure of Chaotic Packings of Solid Spheres of Different Sizes), Chernogolovka: IKhF RAN, 1993.

Google Scholar  

Andreev, E.I., Bocharov, A.S., Ivanov, A.V., et al., Izv. Vyssh. Uchebn. Zaved., Tsvetn. Metall. , 2003, no. 1, p. 48.

Assmann, H., Dörr, W., and Peehs, M., “Control of HO 2 Microstructure by Oxidative Sintering,” J. Nucl. Mater. , 1986, vol. 140,issue 1, pp. 1–6.

Article   ADS   CAS   Google Scholar  

Download references

Author information

Authors and affiliations.

Elektrostal’ Polytechnical Institute (Branch), Moscow Institute of Steel and Alloys, ul. Pervomaiskaya 7, Elektrostal’, Moscow oblast, 144000, Russia

E. I. Andreev

Moscow Institute of Steel and Alloys (State Technical University), Leninskii pr. 4, Moscow, 119049, Russia

K. V. Glavin & V. S. Panov

JSC “Mashinostroitelny Zavod”, ul. K. Marksa 12, Elektrostal’, Moscow oblast, 144001, Russia

A. V. Ivanov, V. V. Malovik & V. V. Martynov

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to K. V. Glavin .

Additional information

Original Russian Text © E.I. Andreev, K.V. Glavin, A.V. Ivanov, V.V. Malovik, V.V. Martynov, V.S. Panov, 2009, published in Izvestiya VUZ. Poroshkovaya Metallurgiya i Funktsional’nye Pokrytiya, 2008, No. 4, pp. 19–24.

About this article

Andreev, E.I., Glavin, K.V., Ivanov, A.V. et al. Some results uranium dioxide powder structure investigation. Russ. J. Non-ferrous Metals 50 , 281–285 (2009). https://doi.org/10.3103/S1067821209030183

Download citation

Published : 28 June 2009

Issue Date : June 2009

DOI : https://doi.org/10.3103/S1067821209030183

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• nuclear fuel
• uranium dioxide
• uranium protoxide-oxide
• crystallite
• agglomerate
• conglomerate
• surface morphology
• ADU-ammonium diuranate
• Find a journal
• Publish with us
• Track your research

This paper is in the following e-collection/theme issue:

Published on 27.5.2024 in Vol 26 (2024)

Correction: Developing and Testing the Usability of a Novel Child Abuse Clinical Decision Support System: Mixed Methods Study

Authors of this article:

Amy Thomas   1 , MD ;   Andrea Asnes   1 , MSW, MD ;   Kyle Libby   2 , BA, MS ;   Allen Hsiao   1 , MD, FAAP, FAMIA ;   Gunjan Tiyyagura   1 , MHS, MD

1 Department of Pediatrics, Yale University School of Medicine, New Haven, CT, United States

2 3M | M*Modal, 3M Health Information Systems, 3M Company, Maplewood, MN, United States

Corresponding Author:

• Gunjan Tiyyagura , MHS, MD
• Department of Pediatrics
• Yale University School of Medicine
• Pediatric Emergency Medicine, PO Box 208064
• New Haven , CT , 06520
• United States
• Phone: 1 203 464 6343
• Fax: 1 203 737 7447
• Email: [email protected]

Research involvement of medical students in a medical school of India: exploring knowledge, attitude, practices, and perceived barriers

• Find this author on Google Scholar
• Find this author on PubMed
• Search for this author on this site
• ORCID record for Abhinav Jha
• ORCID record for Deepak Dhamnetiya
• For correspondence: [email protected]
• ORCID record for Ravi Prakash Jha
• Info/History
• Preview PDF

Introduction Research in the medical discipline significantly impacts society by improving the general well-being of the population, through improvements in diagnostic and treatment modalities. However, of 579 Indian medical colleges, 332 (57.3%) did not publish a single paper from the year 2005 to 2014," indicating a limited contribution from medical fraternity In order to probe in to the cause of this a study was conducted to assess the knowledge, attitude, practices (KAP) and perceived barriers to research among students of a medical school in Delhi, India.

Methods A cross-sectional study was conducted among medical students and the data on academic-cum-demographic information, assessment of knowledge, attitude, practices and barriers to research was collected using a pre-tested, semi-structured questionnaire. Chi-square test was used to check the association of various factors with the KAP of research. A p-value less than 0.05 was considered significant.

Results A total of 402 (N) subjects were enrolled in the study. Majority were male (79.6%) and from clinical professional years (57%). Majority (266, 66.2%) of the subjects had adequate knowledge. Of the study subjects (61,15%) having inadequate knowledge of research, sixty percent were from pre- and para-clinical years, while around 70 % of those having good knowledge were from clinical professional years. However, only 16.9% of the participants had participated in a research project, and only 4.72% had authored a publication. Sixty one percent of study subjects having a positive attitude towards research, were from pre- and para-clinical years. Among the study subjects having a positive attitude towards research, over 60% were from pre- and para-clinical years. The barriers for conducting research were mostly; lack of funds/laboratory equipment/infrastructure (85.1%), lack of exposure to opportunities for research in the medical (MBBS) curriculum (83.8%), and lack of time (83.3%). There was a statistically significant association between knowledge and attitude towards research with a professional year of study.

Conclusions The study revealed that while most of the students had a positive attitude towards research as well as an adequate knowledge of research, there was a poor level of participation in research. These challenges can be overcome by incorporating research as a part of the medical school curriculum from early years on, setting aside separate time for research, and establishing student research societies that can actively promote research.

Competing Interest Statement

The authors have declared no competing interest.

Funding Statement

This study did not receive any funding.

Author Declarations

I confirm all relevant ethical guidelines have been followed, and any necessary IRB and/or ethics committee approvals have been obtained.

The details of the IRB/oversight body that provided approval or exemption for the research described are given below:

The ethics committee of Dr Baba Saheb Ambedkar Medical College and Hospital, New Delhi gave ethical approval for this work.

I confirm that all necessary patient/participant consent has been obtained and the appropriate institutional forms have been archived, and that any patient/participant/sample identifiers included were not known to anyone (e.g., hospital staff, patients or participants themselves) outside the research group so cannot be used to identify individuals.

I understand that all clinical trials and any other prospective interventional studies must be registered with an ICMJE-approved registry, such as ClinicalTrials.gov. I confirm that any such study reported in the manuscript has been registered and the trial registration ID is provided (note: if posting a prospective study registered retrospectively, please provide a statement in the trial ID field explaining why the study was not registered in advance).

I have followed all appropriate research reporting guidelines, such as any relevant EQUATOR Network research reporting checklist(s) and other pertinent material, if applicable.

Email id: jhaabhinav677{at}gmail.com , manas.shah1999{at}gmail.com , Ritikgoyal152{at}gmail.com , drdeepakdhamnetiya{at}gmail.com , apoorv1729{at}gmail.com , raviprakashjha{at}gmail.com , dr.prachi.obg{at}bsamch.in

Data Availability

All data produced in the present study are available upon reasonable request to the authors.

View the discussion thread.

Thank you for your interest in spreading the word about medRxiv.

NOTE: Your email address is requested solely to identify you as the sender of this article.

Citation Manager Formats

• EndNote (tagged)
• EndNote 8 (xml)
• RefWorks Tagged
• Ref Manager
• Tweet Widget
• Facebook Like
• Google Plus One

Subject Area

• Medical Education
• Addiction Medicine (324)
• Allergy and Immunology (633)
• Anesthesia (168)
• Cardiovascular Medicine (2404)
• Dentistry and Oral Medicine (289)
• Dermatology (207)
• Emergency Medicine (381)
• Endocrinology (including Diabetes Mellitus and Metabolic Disease) (853)
• Epidemiology (11802)
• Forensic Medicine (10)
• Gastroenterology (705)
• Genetic and Genomic Medicine (3771)
• Geriatric Medicine (350)
• Health Economics (637)
• Health Informatics (2410)
• Health Policy (940)
• Health Systems and Quality Improvement (905)
• Hematology (342)
• HIV/AIDS (787)
• Infectious Diseases (except HIV/AIDS) (13348)
• Intensive Care and Critical Care Medicine (769)
• Medical Education (369)
• Medical Ethics (105)
• Nephrology (402)
• Neurology (3526)
• Nursing (199)
• Nutrition (529)
• Obstetrics and Gynecology (681)
• Occupational and Environmental Health (670)
• Oncology (1835)
• Ophthalmology (540)
• Orthopedics (222)
• Otolaryngology (287)
• Pain Medicine (234)
• Palliative Medicine (67)
• Pathology (447)
• Pediatrics (1039)
• Pharmacology and Therapeutics (426)
• Primary Care Research (424)
• Psychiatry and Clinical Psychology (3195)
• Public and Global Health (6187)
• Radiology and Imaging (1293)
• Rehabilitation Medicine and Physical Therapy (751)
• Respiratory Medicine (832)
• Rheumatology (380)
• Sexual and Reproductive Health (375)
• Sports Medicine (324)
• Surgery (407)
• Toxicology (50)
• Transplantation (172)
• Urology (147)