case study questions class 12 biology chapter 8

Gurukul of Excellence

Classes for Physics, Chemistry and Mathematics by IITians

Join our Telegram Channel for Free PDF Download

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

• Last modified on: 2 years ago
• Reading Time: 6 Minutes

Question 1:

In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few days those mice were again infected with the virus. This time they do not show any disease symptoms. Their blood samples were tested. Two graphs show antibody concentration for the first and second infection in mice blood.

Based on the above information, answer the following questions.

(i) P and Q in the given graphs indicate (a) IgM and IgG respectively (b) IgG and IgM respectively (c) IgG and IgE respectively (d) IgM and IgA respectively.

(ii) Which form of pathogen is used in vaccination?

(a) Activated and strong pathogenic antigens (b) Inactivated and weakened pathogenic antigens (c) Hyperactive and strong pathogen (d) Preformed antibodies

(iii) Which of the following is incorrect for P? (a) It is the most abundant class of Ig. (b) It is found in blood, lymph and intestine. (c) It is unable to cross the placental barrier. (d) It is a monomer.

(iv) How does vaccination work? (a) The immune system produces antibodies which stay in the blood. (b) Memory lymphocytes remain in the body to fight off any future infection with the same pathogen. (c) Antigenic proteins of pathogens generate primary immune response and the memory B and T cells. (d) All of these.

(v) Read the given statements and select the correct option. Statement A : Mice do not show any disease symptoms during second exposure to the pathogenic virus. Statement B : The antibody production is accelerated and more intense during secondary immune response. (a) Both statements A and B are true. (b) Statement A is false but statement B is true. (c) Statement A is true but statement B is false. (d) Both statements A and B are false.

You may also like:

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.…

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here,…

Last modified on:2 years agoReading Time:6MinutesCase Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few…

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Last modified on:2 years agoReading Time:3MinutesCase Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare Question 1: Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below…

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques Question 1: The DNA, which is transferred from one organism into another by joining it with the vehicle DNA is called passenger or foreign DNA. Generally three types of passenger DNAs are used. These are complementary DNA…

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Last modified on:2 years agoReading Time:5MinutesCase Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.…

Download CBSE Books

Exam Special Series:

• Sample Question Paper for CBSE Class 10 Science (for 2024)
• Sample Question Paper for CBSE Class 10 Maths (for 2024)
• CBSE Most Repeated Questions for Class 10 Science Board Exams
• CBSE Important Diagram Based Questions Class 10 Physics Board Exams
• CBSE Important Numericals Class 10 Physics Board Exams
• CBSE Practical Based Questions for Class 10 Science Board Exams
• CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
• Sample Question Papers for CBSE Class 12 Physics (for 2024)
• Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
• Sample Question Papers for CBSE Class 12 Maths (for 2024)
• Sample Question Papers for CBSE Class 12 Biology (for 2024)
• CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
• Master Organic Conversions CBSE Class 12 Chemistry Board Exams
• CBSE Important Numericals Class 12 Physics Board Exams
• CBSE Important Definitions Class 12 Physics Board Exams
• CBSE Important Laws & Principles Class 12 Physics Board Exams
• 10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
• ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
• ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
• ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
• ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
• ICSE Important Functions and Locations Based Questions Class 10 Biology
• ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)

✨ Join our Online NEET Test Series for 499/- Only for 1 Year

Leave a Reply Cancel reply

Editable Study Materials for Your Institute - CBSE, ICSE, State Boards (Maharashtra & Karnataka), JEE, NEET, FOUNDATION, OLYMPIADS, PPTs

Discover more from Gurukul of Excellence

Subscribe now to keep reading and get access to the full archive.

Type your email…

Continue reading

Class 12 Biology Case Study Based Questions PDF Download

• Post author: studyrate
• Post published:
• Post category: Class 12 / 12 board
• Post comments: 0 Comments

In the pursuit of academic excellence, Class 12 Biology students often encounter case studies that challenge their problem-solving abilities and critical thinking skills. These case studies serve as valuable learning tools, allowing students to apply their theoretical knowledge to real-life scenarios. In this article, we will delve into the significance of Class 12 Biology Case Study Based Questions and provide a downloadable PDF resource containing a collection of such questions. So, let’s explore how these case studies can enhance students’ understanding and performance in the subject.

Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.

Case study-based questions simulate real-life situations, encouraging students to analyze, evaluate, and apply their knowledge to address specific problems. By engaging with these scenarios, students develop a deeper understanding of the subject matter, making their learning more meaningful and relevant.

Table of Contents

Case Study-Based Questions for Class 12 Biology

These Class 12th Case Study and Passage-Based Questions will help you to score 95% in Your Board Exams.

• Class 12 Physics Case Study Questions
• Class 12 Chemistry Case Study Questions
• Class 12 Biology Case Study Questions
• Class 12 Maths Case Study Questions

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2024 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2024 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2024. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Case Study-Based Questions Benefit Class 12 Biology Students

Comprehensive learning.

By incorporating case studies into the curriculum, Class 12 Biology students gain a comprehensive understanding of complex biological concepts. These case studies encompass a wide range of topics, from ecology to genetics, and offer multifaceted learning experiences.

Application of Theoretical Knowledge

Theoretical knowledge becomes more valuable when students can apply it practically. Case study-based questions bridge the gap between theory and application, empowering students to connect classroom learning to real-world situations.

Engaging and Interactive Learning

Case studies have an inherent appeal, as they present intriguing problems that captivate students’ attention. This engagement enhances their motivation to learn, making the subject more enjoyable and meaningful.

Tips for Effective Utilization of Case Study-Based Questions

Collaborative learning.

Encourage students to discuss case studies in groups. Collaborative learning promotes teamwork, diverse perspectives, and a deeper understanding of the subject matter.

Teacher Guidance

Teachers play a crucial role in guiding students through the analysis of case studies. Providing insights, posing relevant questions, and facilitating discussions can significantly enhance the learning experience.

Regular Practice

Integrate case study-based questions into regular assessments. Regular practice helps students become more comfortable with this format and boosts their confidence in tackling complex problems.

Class 12 Biology Syllabus for 2024

Check the complete syllabus below along with the new exam scheme. 

Detailed Syllabus:

Unit-VI Reproduction

Chapter- 2:   Sexual Reproduction in Flowering Plants

Flower structure; development of male and female gametophytes; pollination – types, agencies and examples; out breeding devices; pollen-pistil interaction; double fertilization; post-fertilization events – development of endosperm and embryo, development of seed and formation of fruit; special modes- apomixis, parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.

Chapter- 3: Human Reproduction

Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis-spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development up to blastocyst formation, implantation; pregnancy and placenta formation (Elementary idea); parturition (elementary idea); lactation (elementary idea).

Chapter- 4: Reproductive Health

Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth control – need and methods, contraception and medical termination of pregnancy (MTP); amniocentesis; infertility and assisted reproductive technologies – IVF, ZIFT, GIFT (Elementary idea for general awareness).

Unit-VII Genetics and Evolution

Chapter-5: Principles of Inheritance and Variation

Heredity and variation: Mendelian inheritance; deviations from Mendelism – incomplete

dominance, co-dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic inheritance; chromosome theory of inheritance; chromosomes and genes; Sex determination – in humans, birds and honey bees; linkage and crossing over; sex-linked inheritance – haemophilia, colour blindness; Mendelian disorders in humans – thalassemia; chromosomal disorders in humans; Down’s syndrome, Turner’s and Klinefelter’s syndromes.

Chapter-6: Molecular Basis of Inheritance

Search for genetic material and DNA as genetic material; Structure of DNA and RNA; DNA packaging; DNA replication; Central Dogma; transcription, genetic code, translation; gene expression and regulation – lac operon; Genome, Human and rice genome projects; DNA fingerprinting.

Chapter-7: Evolution

Origin of life; biological evolution and evidence for biological evolution (paleontology, comparative anatomy, embryology, and molecular evidence); Darwin’s contribution, modern synthetic theory of evolution; mechanism of evolution – variation (mutation and recombination) and natural selection with examples, types of natural selection; Gene flow and genetic drift; Hardy – Weinberg’s principle; adaptive radiation; human evolution.

Unit-VIII Biology and Human Welfare

Chapter-8: Human Health and Diseases

Pathogens; parasites causing human diseases (malaria, dengue, chikungunya, filariasis, ascariasis, typhoid, pneumonia, common cold, amoebiasis, ring worm) and their control; Basic concepts of immunology – vaccines; cancer, HIV and AIDS; Adolescence – drug and alcohol abuse.

Chapter-10: Microbes in Human Welfare

Microbes in food processing, industrial production, sewage treatment, energy generation and microbes as bio-control agents and bio-fertilizers. Antibiotics; production and judicious use.

Unit-IX Biotechnology and its Applications

Chapter-11: Biotechnology  – Principles and Processes

Genetic Engineering (Recombinant DNA Technology).

Chapter-12: Biotechnology and its Applications

Application of biotechnology in health and agriculture: Human insulin and vaccine production, stem cell technology, gene therapy; genetically modified organisms – Bt crops; transgenic animals; biosafety issues, biopiracy and patents.

Unit-X Ecology and Environment

Chapter-13: Organisms and Populations

Population interactions – mutualism, competition, predation, parasitism; population attributes – growth, birth rate and death rate, age distribution. (Topics excluded: Organism and its Environment, Major Abiotic Factors, Responses to Abiotic Factors, Adaptations)

Chapter-14: Ecosystem

Ecosystems:  Patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass, energy (Topics excluded: Ecological Succession and Nutrient Cycles)

Chapter-15: Biodiversity and its Conservation

Biodiversity-Concept, patterns, importance; loss of biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data Book, Sacred Groves, biosphere reserves, national parks, wildlife, sanctuaries and Ramsar sites.

Case study-based questions are invaluable tools that enrich the learning experience of Class 12 Biology students. They foster critical thinking, decision-making skills, and the practical application of theoretical knowledge. By engaging with case studies, students develop a deeper understanding of biological concepts and their relevance in the real world.

Are the case study-based questions suitable for self-study?

Absolutely! These case study-based questions are designed for both classroom learning and self-study. They are excellent resources for independent practice.

Where I can get Class 12th Biology Case Study Questions?

You can practice the Biology Class 12th Case Study Questions on studyrate.in for free.

Do the case studies cover the entire Class 12 Biology syllabus?

Yes, the case studies encompass various topics from the Class 12 Biology syllabus, providing comprehensive coverage.

Are answer keys provided for the case study-based questions?

Yes, after every questions the Ansswer is provided with detailed explanation

You Might Also Like

A roadside stand summary class 12 english pdf, class 12 biology case study questions chapter 3 human reproduction, download disha’s objective questions bank for class 12 term 1 & 2 pdf of pcmb, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

The Topper Combo Flashcards

• Contains the Latest NCERT in just 350 flashcards.
• Colourful and Interactive
• Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE

No thanks, I’m not interested!

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

Not Able To Find Desired Paper or Worksheet SEARCH

Find papers & worksheets search, class 12 biology case study questions chapter 8 human health and diseases.

• (0) Comments
• 1 Downloads

Related Papers

Click to view more related papers, display_name = "class 11" && $paper->display_name = "class 12") { // echo $paper->display_name." questions papers and worksheets"; } //else { // echo $paper->display_name." sample papers and previous year papers"; //} //>, important questions for class 12 biology chapter wise with answers.

Get here all the Important questions for Class 12 Biology chapter wise as free PDF download. Here you will get Extra Important Questions with answers, assertion reasoning and Multiple Choice Questions (MCQ's) chapter wise in Printable format. Class 12 Biology has 16 important chapters covering various important topics related to human physiology evolution, diseases, genetics, organisms, populations, etc.Solving Chapter wise questions is one of the best ways to prepare for the examination. Students are advised to understand the concepts and theories of Biology properly before the exam. You can easily find 1 Mark, 2 marks, 3 marks, and 5 marks questions from each chapter of Class 12 Biology and prepare for exam more effectively. These preparation material for Class 12 Biology , shared by teachers, parents and students, are as per latest NCERT and CBSE Pattern syllabus and assure great success in achieving high score in Final CBSE Board Examinations.

Latest MCQ's and Important Questions for CBSE Class 12 Biology

Reproduction in Organisms class 12 important questions pdf Sexual Reproduction in Flowering Plants class 12 important questions pdf Human Reproduction class 12 important questions pdf Reproductive Health class 12 important questions pdf Principles of Inheritance and Variation class 12 important questions pdf Molecular Basis of Inheritance class 12 important questions pdf Evolution class 12 important questions pdf Human Health and Diseases class 12 important questions pdf Strategies for Enhancement in Food Production class 12 important questions pdf Microbes in Human Welfare class 12 important questions pdf Biotechnology Principles and Processes class 12 important questions pdf Organisms and Populations class 12 important questions pdf Ecosystem class 12 important questions pdf Biodiversity and Conservation class 12 important questions pdf Environmental Issues class 12 important questions pdf important questions of chapter 1 biology class 12 important questions of chapter 2 biology class 12 important questions of chapter 3 biology class 12 important questions of chapter 4 biology class 12 important questions of chapter 5 biology class 12 important questions of chapter 6 biology class 12 important questions of chapter 7 biology class 12 important questions of chapter 8 biology class 12 important questions of chapter 9 biology class 12 important questions of chapter 10 biology class 12 important questions of chapter 11 biology class 12 important questions of chapter 12 biology class 12 important questions of chapter 13 biology class 12 important questions of chapter 14 biology class 12 important questions of chapter 15 biology class 12 important questions of chapter 16 biology class 12 Reproduction in Organisms class 12 mcq Sexual Reproduction in Flowering Plants class 12 mcq Human Reproduction class 12 mcq Reproductive Health class 12 mcq Principles of Inheritance and Variation class 12 mcq Molecular Basis of Inheritance class 12 mcq Evolution class 12 mcq Human Health and Diseases class 12 mcq Strategies for Enhancement in Food Production class 12 mcq Microbes in Human Welfare class 12 mcq Biotechnology Principles and Processes class 12 mcq Biotechnology: and its Application class 12 mcq Organisms and Populations class 12 mcq Ecosystem class 12 mcq Biodiversity and Conservation class 12 mcq Environmental Issues class 12 mcq case based questions class 12 biology chapter 1 case based questions class 12 biology chapter 2 case based questions class 12 biology chapter 3 case based questions class 12 biology chapter 4 case based questions class 12 biology chapter 5 case based questions class 12 biology chapter 6 case based questions class 12 biology chapter 7 case based questions class 12 biology chapter 8 case based questions class 12 biology chapter 9 case based questions class 12 biology chapter 10 case based questions class 12 biology chapter 11 case based questions class 12 biology chapter 12 case based questions class 12 biology chapter 13 case based questions class 12 biology chapter 14 case based questions class 12 biology chapter 15 case based questions class 12 biology chapter 16 Assertion Reason questions Biology Class 12 Chapter 1 Assertion Reason questions Biology Class 12 Chapter 2 Assertion Reason questions Biology Class 12 Chapter 3 Assertion Reason questions Biology Class 12 Chapter 4 Assertion Reason questions Biology Class 12 Chapter 5 Assertion Reason questions Biology Class 12 Chapter 6 Assertion Reason questions Biology Class 12 Chapter 7 Assertion Reason questions Biology Class 12 Chapter 8 Assertion Reason questions Biology Class 12 Chapter 9 Assertion Reason questions Biology Class 12 Chapter 10 Assertion Reason questions Biology Class 12 Chapter 11 Assertion Reason questions Biology Class 12 Chapter 12 Assertion Reason questions Biology Class 12 Chapter 13 Assertion Reason questions Biology Class 12 Chapter 14 Assertion Reason questions Biology Class 12 Chapter 15 Assertion Reason questions Biology Class 12 Chapter 16

Total Papers :

CBSE Class 12 Biology Syllabus

• Reproduction in Organisms
• Sexual Reproduction in Flowering Plants
• Human Reproduction
• Reproductive Health
• Principles of Inheritance and Variation
• Molecular Basis of Inheritance
• Human Health and Diseases
• Strategies for Enhancement in Food Production
• Microbes in Human Welfare
• Biotechnology - Principles and Processes
• Biotechnology and its Application
• Organisms and Populations
• Biodiversity and its Conservation
• Environmental Issues

Course Syllabus Details

Unit vi. reproduction.

Chapter 1: Reproduction in Organisms

• A characteristic feature of all organisms for continuation of species
• Asexual reproduction
• Sexual reproduction
• Modes-Binary fission
• Sporulation
• Fragmentation
• vegetative propagation in plants

Chapter 2: Sexual Reproduction in Flowering Plants

• Flower structure
• Development of male and female gametophytes
• Outbreeding devices
• Pollen-Pistil interaction
• Double fertilization
• Post fertilization Events-Development of endosperm and embryo
• Development of seed and formation of fruit
• Parthenocarpy
• Polyembryony
• Significance of seed and fruit formation

Chapter 3: Human Reproduction

• Male and female reproductive systems
• Microscopic anatomy of testis and ovary
• Spermatogenesis
• Menstrual cycle
• Fertilisation embryo development up to blastocyst formation, implantation pregnancy and placenta formation (Elementary idea)
• Parturition (Elementary idea)
• Lactation (Elementary idea)

Chapter 4: Reproductive Health

• Need for reproductive health and prevention of sexually transmitted diseases (STD)
• Need and Methods
• Contraception
• Medical Termination of Pregnancy (MTP)
• Amniocentesis
• GIFT (Elementary idea for general awareness)

Unit VII. Genetics and Evolution

Chapter 5: Principles of Inheritance and Variation

• Mendelian Inheritance
• Incomplete dominance
• Co-dominance
• Multiple alleles
• Inheritance of blood groups
• Elementary idea of polygenic inheritance
• Chromosome theory of inheritance
• Chromosomes and genes
• Linkage and crossing over
• Haemophilia
• Colour blindness
• Thalassemia
• Down's syndrome
• Klinefelter's syndromes

Chapter 6: Molecular Basis of Inheritance

• Search for genetic material and DNA as genetic material
• Structure of DNA and RNA
• DNA packaging
• DNA replication
• Central dogma
• Transcription, genetic code, translation
• Genome and human ganeome project
• DNA fingerprinting

Chapter 7: Evolution

• Origin of life
• Biological evolution and evidences for biological evolution (Paleontological, comparative anatomy, embryology and molecular evidence)
• Darwin's contribution
• Modern Synthetic theory of Evolution
• Variation (Mutation and Recombination)
• Natural Selection with examples
• Types of natural selection
• Gene flow and genetic drift
• Hardy - Weinberg's principle
• Adaptive Radiation
• Human evolution

Unit VIII. Biology and Human Welfare

Chapter 8: Human Health and Diseases

• Common cold
• Adolescence, drug and alcohol abuse

Chapter 9: Strategies for Enhancement in Food Production

• Plant breeding
• Tissue culture
• Single cell protein
• Biofortification
• Apiculature
• Animal husbandry

Chapter-10: Microbes in Human Welfare

• In household food processing
• Industrial production
• Sewage treatment
• Energy generation and as biocontrol agents
• Biofertilizers
• Production and judicious use

Unit IX. Biotechnology and Its Applications

Chapter 11: Biotechnology - Principles and Processes

• Genetic engineering (Recombinant DNA technology).

Chapter 12: Biotechnology and its Application

• Human insulin and vaccine production, gene therapy
• Genetically modified organisms - Bt crops
• Transgenic Animals; biosafety issues, biopiracy and patents

Unit X. Ecology and Environment

Chapter 13: Organisms and Populations

• Ecological adaptations
• Competition
• Age distribution

Chapter 14: Ecosystem

• Productivity
• Decomposition
• Energy flow
• Pyramids of number, biomass, energy
• Nutrient cycles (carbon and phosphorous)
• Ecological succession
• Carbon fixation
• Pollination
• Seed dispersal
• Oxygen release (in brief)

Chapter-15: Biodiversity and its Conservation

• Concept of biodiversity
• Patterns of biodiversity
• Importance of biodiversity
• Loss of biodiversity
• Endangered organisms
• Red data book
• Biosphere reserves
• National parks
• Sanctuaries
• Ramsar sites

Chapter-16: Environmental Issues

• Air pollution and its control
• Water pollution and its control
• Agrochemicals and their effects
• Solid waste management
• Radioactive waste management
• Greenhouse effect and climate change
• Ozone layer depletion
• Deforestation
• Any one case study as success story addressing environmental issue(s).

Practical Works

Part A: List of Experiments

• Study pollen germination on a slide.
• Collect and study soil from at least two different sites and study them for texture, moisture content, pH and water holding capacity. Correlate with the kinds of plants found in them.
• Collect water from two different water bodies around you and study them for pH, clarity and presence of any living organisms.
• Study the presence of suspended particulate matter in air at two widely different sites.
• Study of plant population density by quadrat method.
• Study of plant population frequency by quadrat method.
• Prepare a temporary mount of onion root tip to study mitosis.
• Study the effect of different temperatures and three different pH on the activity of salivary amylase on starch.
• Isolation of DNA from available plant material such as spinach, green pea seeds, papaya, etc.

Part B: Study/observation of the following (Spotting)

• Flowers adapted to pollination by different agencies (wind, insect, bird).
• Pollen germination on stigma through a permanent slide.
• Identification of stages of gamete development, i.e., T.S. of testis and T.S. of ovary through permanent slides (from grasshopper/mice).
• Meiosis in onion bud cell or grasshopper testis through permanent slides.
• T.S. of blastula through permanent slides.
• Mendelian inheritance using seeds of different colour/sizes of any plant.
• Prepared pedigree charts of any one of the genetic traits such as rolling of tongue, blood groups, ear lobes, widow's peak and colour blindness.
• Controlled pollination - emasculation, tagging and bagging.
• Common disease causing organisms like Ascaris, Entamoeba, Plasmodium, Roundworm through permanent slides or specimens. Comment on symptoms of disease that they cause.
• Two plants and two animals (models/virtual images) found in xeric conditions. Comment upon their morphological adaptations.
• Two plants and two animals (models/virtual images) found in aquatic conditions. Comment upon their morphological adaptations.

Structure of CBSE Biology Sample Paper for Class 12 Science is

For Preparation of exams students can also check out other resource material

CBSE Class 12 Biology Sample Papers

CBSE Class 12 Biology Worksheets

CBSE Class 12 Biology Question Papers

CBSE Class 12 Biology Test Papers

CBSE Class 12 Biology Revision Notes

Question Bank of Other Subjects of Class 12

Importance of Question Bank for Exam Preparation?

There are many ways to ascertain whether a student has understood the important points and topics of a particular chapter and is he or she well prepared for exams and tests of that particular chapter. Apart from reference books and notes, Question Banks are very effective study materials for exam preparation. When a student tries to attempt and solve all the important questions of any particular subject , it becomes very easy to gauge how much well the topics have been understood and what kind of questions are asked in exams related to that chapter.. Some of the other advantaging factors of Question Banks are as follows

• Since Important questions included in question bank are collections of questions that were asked in previous exams and tests thus when a student tries to attempt them they get a complete idea about what type of questions are usually asked and whether they have learned the topics well enough. This gives them an edge to prepare well for the exam.Students get the clear idea whether the questions framed from any particular chapter are mostly either short or long answer type questions or multiple choice based and also marks weightage of any particular chapter in final exams.
• CBSE Question Banks are great tools to help in analysis for Exams. As it has a collection of important questions that were asked previously in exams thereby it covers every question from most of the important topics. Thus solving questions from the question bank helps students in analysing their preparation levels for the exam. However the practice should be done in a way that first the set of questions on any particular chapter are solved and then solutions should be consulted to get an analysis of their strong and weak points. This ensures that they are more clear about what to answer and what can be avoided on the day of the exam.
• Solving a lot of different types of important questions gives students a clear idea of what are the main important topics of any particular chapter that needs to focussed on from examination perspective and should be emphasised on for revision before attempting the final paper. So attempting most frequently asked questions and important questions helps students to prepare well for almost everything in that subject.
• Although students cover up all the chapters included in the course syllabus by the end of the session, sometimes revision becomes a time consuming and difficult process. Thus, practicing important questions from Question Bank allows students to check the preparation status of each and every small topic in a chapter. Doing that ensures quick and easy insight into all the important questions and topics in each and every individual. Solving the important questions also acts as the revision process.

Question Bank of Other Classes

To Prepare better for CBSE paperclass; ?> " title="Download Free CBSE Papers">Ribblu.com brings to you all the previous years papers & worksheets of subject; ?//> for CBSE paperclass; ?>. This CBSE paper and worksheet can be instrumental in students achieving maximum marks in their exams. These Papers and worksheets help students gain confidence and make them ready to face their school examinations. These Papers and worksheets school wise, covers important concepts from an examination perspective. Students and parents can download all the available papers & worksheets directly in the form of PDF. One can use these papers and worksheets to get extensive practice and familiarise themselves with the format of the question paper.

You can help other users

Be the first to write comment .

Upload papers and the more your paper get downloaded the more you earn the points

You may send papers on email [email protected] along with userid

• Downloaded by: DAVNEET KAUR
• Downloaded by: Abhijit Das
• Downloaded by: _ALL EDITS_

Rules and regulations for uploads

Write your comment

Report this paper, how to earn points.

Upload Papers / Worksheets and Earn 50 Points.

The uploaded material should be original paper or worksheet of any school. Check out some videos on how to upload papers on ribblu

Rate & Review your school and Earn 25 Points.

Review any school that you may be knowing and once your review is approved, you will be credited with 25 points.

Answer on question posted on JustAsk and earn 15 points.

JustAsk is a platform where you can help others to find answers of any question. Share your Knowledge. Answer questions and once approved you will earn 15 points

Complete your profile and earn upto 25 Points.

Edit and complete your user profile and earn points. The more details you submit, the more points you will earn.

Download Ribblu Mobile App and you will (Earn 20 Points) (one time only)

CBSE Schools

• CBSE Schools In Delhi
• CBSE Schools In Noida
• CBSE Schools In Greater Noida
• CBSE Schools In Faridabad
• CBSE Schools In Ghaziabad
• CBSE Schools In Gurgaon
• CBSE Schools In Mumbai
• CBSE Schools In Pune
• CBSE Schools In Bangalore
• CBSE Schools In Hyderabad
• CBSE Schools In Kolkata
• CBSE Schools In Chennai
• CBSE Schools In Patna
• CBSE Schools In Meerut
• CBSE Schools In Kanpur
• CBSE Schools In Indore
• CBSE Schools In Ludhiana
• CBSE Schools In Dehradun

Top Schools

• Schools In Delhi
• Schools In Noida
• Schools In Greater Noida
• Schools In Faridabad
• Schools In Ghaziabad
• Schools In Gurgaon
• Schools In Mumbai
• Schools In Pune
• Schools In Bangalore
• Schools In Hyderabad
• Schools In Kolkata
• Schools In Chennai
• Schools In Patna
• Schools In Meerut
• Schools In Kanpur
• Schools In Indore
• Schools In Ludhiana
• Schools In Dehradun

Other Schools

• Pre Nursery Schools In Noida
• Day Boarding Schools In Noida
• Pre Nursery Schools In Gurgaon
• Pre Nursery Schools In Delhi
• Play Schools In Delhi
• Day Boarding Schools In Delhi

CBSE Papers

• CBSE Class 1 Sample Papers
• CBSE Class 2 Sample Papers
• CBSE Class 3 Sample Papers
• CBSE Class 4 Sample Papers
• CBSE Class 5 Sample Papers
• CBSE Class 6 Sample Papers
• CBSE Class 7 Sample Papers
• CBSE Class 8 Sample Papers

Paper Categories

• Question Bank
• Question Papers
• Revision Notes
• Sample Papers
• Test Papers
• CBSE Class 9 Sample Papers
• CBSE Class 10 Sample Papers
• CBSE Class 11 Sample Papers
• CBSE Class 12 Sample Papers

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..

CBSE Class 12th Biology Board Exam 2023-24 Pattern

The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.

The paper will have 33 questions divided into 5 sections.

Section–A 16 questions of 1 mark each,

Section–B 5 questions of 2 marks each;

Section–C 7 questions of 3 marks each;

Section–D 2 case-based questions of 4 marks each,

and Section–E 3 questions of 5 marks each.

CBSE Class 12 Biology Important Case Study Based Questions

Case Study 1:  Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above

Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.

• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

Case Study 2:  A Representative Diagram of the Human Genome Project:

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics

Q2:  Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.

Answer: Caenorhabditis elegans

Q3: Summarize the methodology adopted in the Human Genome Project.

Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.

Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.

Q4: What are SNPs’? How are they useful in human genomics?

• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.

Q5: Mention at least four salient features of the Human Genome Project.

• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.

Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

Answer:  Minisatellite: the repeating unit consists of 10-100 base pairs.

Microsatellite: the repeating unit consists of 2-6 base pairs.

Q3: How does polymorphism arise in a population?

Answer: Polymorphism (variation at the genetic level) arises due to mutations.

Q4: State the steps involved in DNA Fingerprinting in a sequential manner.

• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.

Case Study 4: Bacteria like Streptococcus pneumoniae  and Haemophilus influenzae  are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.

The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,

headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.

• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.

Q4:  How long does the common cold last?

Answer: 3-7 days

Q5:  Write any two symptoms of the common cold and pneumonia.

Answer: Cough and nasal congestion.

Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.

• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

Case Study 6: Gene Therapy

Read the following and answer the questions that follow:

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting

Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to

• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases
• CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
• CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
• CBSE Class 12 Deleted Syllabus (All Subjects)
• CBSE Class 12 Previous Year Papers with Solution PDF Download
• CBSE Class 12 Additional Practice Questions
• CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
• Important MCQs for CBSE Class 12 Biology, All Chapters
• CBSE Class 12 Biology Mind Maps for Quick Revision
• CBSE Class 12 NCERT Biology Revised Textbook PDF
• CBSE Class 12 NCERT Biology Solutions
• CBSE Class 12 Biology Chapter-wise notes
• CBSE Class 12 Date Sheet 2024
• CBSE Competency Based Questions 2023-24
• CBSE Class 12 Additional Practice Questions 2024

Get here latest School , CBSE and Govt Jobs notification and articles in English and Hindi for Sarkari Naukari , Sarkari Result and Exam Preparation . Download the Jagran Josh Sarkari Naukri App .

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• UGC NET Answer Key 2024
• SSC CGL Exam Analysis 2024
• RBI Grade B Admit Card 2024
• SSC GD Recruitment 2025
• SSC CGL Admit Card 2024
• UP Police Constable Question Paper 2024 PDF
• CDS Question Paper 2024
• RRB NTPC Recruitment 2024
• CBSE Class 12 Sample Papers 2024-25
• CBSE Class 10 Sample Papers 2024-25
• Education News
• CBSE Class 10

Latest Education News

TS 2nd Year Inter Syllabus 2024-25: Download FREE PDFs

अयोध्या राम मंदिर पर हिंदी में निबंध, Essay on Ram Mandir in Hindi

Asian Champions Trophy Hockey 2024: Full Schedule, Results, and Scores

Current Affairs Quiz In Hindi 10 Sept 2024: संसदीय राजभाषा समिति के अध्यक्ष और 54वीं जीएसटी काउंसिल बैठक के फैसले

दुनिया के किस देश में सबसे अधिक सोते हैं लोग, क्या है भारत का स्थान, जानें

TNPSC AE Rank List 2024 OUT at tnpsc.gov.in: Download Marks pdf and other updates

SSC CGL Exam Analysis 2024 Live Updates: Today’s Shift 1, 2, 3 Paper Review, Difficulty Level, Good Attempts

TS 2nd Year Inter Botany Syllabus 2024-25: Download FREE PDFs

CBSE Class 10 Information Technology Sample Paper 2024-25 with Marking, Download in PDF

World Suicide Prevention Day 2024: Significance and Themes

Haryana Police Constable Bharti 2024: हरियाणा पुलिस में 5,600 कांस्टेबलों की भर्ती, जानें डिटेल्स

Today’s School Assembly News Headlines (11th September): Deep Depression, Heavy Rains Desolate Districts in Odisha, NDRF Deployed for Rescue, India- UAE Sign Nuclear Energy Agreement and More

TNPSC Group 2 Exam Day Guidelines 2024: Check Instructions, Do’s and Don’ts

Picture Puzzle IQ Test: Only Top 1% Highly Attentive Can Find the Seal in 5 Seconds!

RSOS Result 2024 Declared: Check Rajasthan State Open School 10th, 12th Class Results Now at rsosadmission.rajasthan.gov.in

PSEB Class 8 Punjabi First Language Sample Paper 2024-25: Download PDF For Free!

Karnataka PGCET Result 2024: Expected Date, Steps to Download Scorecard & Rank List at cetonline.karnataka.gov.in

Who was James Earl Jones? Early Life, Career, Awards and More

Eastern Railway Apprentice Recruitment 2024 for 3115 Vacancies, Apply Online at rrcer.org

NEET PG Score Card 2024 LIVE: NBEMS to be Release NEET PG 50 Percent AIQ Students Scorecards Today at natboard.edu.in, Steps to Download PDF

• NCERT Solutions
• NCERT Class 12
• NCERT 12 Biology
• Chapter 8: Human Health And Diseases

NCERT Solutions For Class 12 Biology Chapter 8 Human Health and Diseases

Ncert solutions for class 12 biology chapter 8 – free pdf download.

* According to the CBSE Syllabus 2023-24, this chapter has been renumbered as Chapter 7.

NCERT Solutions for Class 12 Biology Chapter 8 Human Health and Diseases provides answers for all the textbook questions appearing in the textbook. The NCERT Solutions for Class 12 Biology is available in a PDF format so that students can download and refer to these solutions at their convenience. These solutions are updated following the latest CBSE Syllabus 2023-24 and can also be used to prepare chapter notes that come in handy during revisions.

To make learning simple and interesting, the NCERT Solutions for Class 12 Biology are designed by the experts at BYJU’S have extensive subject knowledge. This is backed by years of experience and research by these academic professionals, which makes this tool all the more reliable. Click the link below to download the NCERT Solutions for Class 12  Biology of this chapter for free.

NCERT Solutions for Class 12 Biology Chapter 8 – Human Health and Diseases

carouselExampleControls112

Previous Next

Access Answers of NCERT Class 12 Biology Chapter 8 – Human Health and Diseases

1. What are the various public health measures, which you would suggest as safeguard against infectious diseases?

Public health measures are the measures taken to prevent and check the spread of different infectious diseases. It is taken to lessen contact with infectious agents.

Some of these preventive measures are as follows:

• Isolation – It prevents the spreading of airborne diseases (chicken pox, pneumonia, tuberculosis, etc.). We isolate an infected person to reduce the chances of the disease spreading.
• Vaccination – It protects the body against communicable diseases by administering some agents that impersonate the microbe in the body. This helps in rendering passive immunization to the body. Vaccines are available for some diseases, such as mumps, polio, measles, etc.
• Vector eradication – Diseases such as dengue, malaria, etc., that spread through vectors can be prevented by ensuring a clean environment and checking the breeding of mosquitoes which is facilitated by regulating water, and not letting it stagnate near residential areas. Some other measures are periodic cleaning of coolers and the use of mosquito nets and insecticides. It can also be controlled by introducing Laxvivorous fish such as Gambusia in ponds, as they control mosquito larvae breeding in stagnant water.
• Maintaining public and personal hygiene is one of the most important practices to prevent the spread of infectious diseases. It includes maintaining a clean body, consuming healthy and nutritious food, clean water, etc. Proper disposal of wastes, excreta, and disinfection of water reservoirs are some of the measures that can be adapted as part of public hygiene.

2. In which way has the study of biology helped us to control infectious diseases?

Biology is a vast field of Science dealing with life forms and their processes. It has helped in controlling infectious diseases in the following ways:

• Complete eradication of fatal diseases such as smallpox was possible with the use of immunization schemes and vaccines
• Other infectious diseases, such as diptheria, polio, pneumonia, etc., have been successfully controlled with the use of vaccines
• Treatment of several infectious diseases have successfully been carried out with the use of antibiotics and other drugs

3. How does the transmission of each of the following diseases take place?

(a) Amoebiasis (b) Malaria (c) Ascariasis (d) Pneumonia

The transmission of diseases is as given in the table:

4. What measure would you take to prevent water-borne diseases?

Measures taken to prevent water-borne diseases are as follows:

• Provision of clean water for drinking
• Industries should be prohibited from discharging wastes into water bodies
• Frequent cleaning and disinfecting of water tanks and reservoirs

5. Discuss with your teacher what does ‘a suitable gene’ mean, in the context of DNA vaccines.

The term ‘suitable gene’ is used to refer to a particular section of DNA that can be altered in the host in order to synthesize a particular protein which attacks and kills a specific disease-causing entity.

6. Name the primary and secondary lymphoid organs.

Primary lymphoid organs are – Thymus and bone marrow

Secondary lymphoid organs are – Mucosal-associated lymphoid tissues (MALT), Lymph nodes, Spleen, Peyer’s patches (small intestine)

7. The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form:

(a) MALT (b) CMI (c) AIDS (d) NACO (e) HIV

The expansion is as follows:

(a) MALT – Mucosal-Associated lymphoid tissues

(b) CMI – Cell-mediated Immunity

(c) AIDS – Acquired Immuno-Deficiency Syndrome

d) NACO – National Aids Control Organization

(e) HIV – Human Immuno-deficiency Virus

8. Differentiate the following and give examples of each:

(a) Innate and acquired immunity (b) Active and passive immunity

The differences are as follows:

(a) Innate and acquired immunity

(b) Active and passive immunity

9. Draw a well-labelled diagram of an antibody molecule.

The diagram is as follows:

10. What are the various routes by which transmission of human immunodeficiency virus takes place?

The various routes by which transmission of the human immunodeficiency virus (HIV) takes place are as follows:

• Sexual relation with the person infected
• Organ transplantation from an infected person
• Transfusion of contaminated blood products and blood
• Transmitted from mother to the child through the placenta

11. What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?

Upon managing to enter the body, this virus enters into macrophages, where the RNA genome of the virus duplicates for the formation of viral DNA by the action of the reverse transcriptase enzyme. The viral DNA is then incorporated into the DNA of the cells of the host, which targets the infected cells to synthesize virus particles. The macrophages continue to produce the virus, serving as an HIV factory. On the other hand, HIV enters the helper T-lymphocytes, replicating and producing progeny viruses, which when released in the blood, target other helper T-lymphocytes, which is reiterated, causing a progressive decrease in the count of helper T-lymphocytes in the patient’s body. In the long run, there is a significant decline in the count of helper T-lymphocytes resulting in the weakening of the defence mechanism of the body. This is referred to as acquired immunodeficiency.

12. How is a cancerous cell different from a normal cell?

13. Explain what is meant by metastasis.

Metastasis is a pathological process that is observed in malignant tumours. In this process, the cancerous cells spread to different body parts and divide indefinitely to form a cluster of cells known as a tumour. Some of these cells from the tumour get sloughed off and manage to enter into the bloodstream, from where they arrive at the distant parts of the body, and thus the formation of new tumours is initiated as they actively divide.

14. List the harmful effects caused by alcohol/drug abuse.

The harmful effects of alcohol and drug abuse are as follows:

Harmful effects of alcohol:

• On individual – It has an adverse effect on the body. When excess alcohol is consumed, it damages the nervous system and the liver, which is a vital organ. This leads to other symptoms such as fatigue, depression, weight loss, aggression, loss of appetite. In extreme cases, heart failure leading to coma and death is also observed.
• On family – Excess alcohol consumption by any family member can have destructive effects on the family members as it may lead to domestic violence, verbal abuse, irritation, insecurity, etc.
• On society – It leads to impulsive behaviour, fading social web, violence, and lack of interest in social activities.

Harmful effects of drugs:

• On individual – The effect of drugs on one’s body is severe, more so on the central nervous system. It can lead to malfunctioning of different organs of the body such as liver, kidney, etc. in such individuals, HIV spreads rapidly among drug users as they share used needles while they inject drugs into the body. Drug addicts face both short-term and long-term effects, some of which are mood swings, aggressiveness, depression, etc.
• On family and society – A drug addict creates issues within the family and society. When a person is dependent on drugs, he/she becomes irritated, frustrated, and anti-social.

15. Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence?

Yes, friends can have an influence on friends to start taking drugs and consuming alcohol. The following actions can be taken as precautionary measures to protect oneself from alcohol/drug abuse, they are:

• One must have a strong control over his/her will. One should refrain from experimenting with alcohol just for the sake of trying/curiosity/fun, etc.
• Stay away from people who are into drugs.
• Seek elderly advise, peer or medical assistance.
• Enlighten yourself with enough knowledge about the consequences of drug abuse.
• Go in for a counselling session.
• Take up some hobby/extracurricular activity.
• If depression or frustration levels persist or heighten, seek immediate medical or professional help.

16. Why is it that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.

Alcohol consumption and usage of drugs have a severe, addictive impact linked with euphoria, rendering a momentary feeling of well-being. Regular intake of drugs can increase the tolerance level of the receptors of the body, which furthermore leads to more drug consumption.

17. In your view, what motivates youngsters to take to alcohol or drugs and how can this be avoided?

Many factors motivate the youth towards drugs or alcohol. Some of the initial causes are curiosity, excitement, adventure, experimentation, etc. Some switch to consuming drugs and alcohol to overcome negative emotions such as pressure, depression, stress, frustration, etc. in order to perform fairly well in other streams. A few media, such as the internet, television, newspaper, movies etc., are responsible for endorsing the idea of using alcohol to the youth. Some more reasons can be unsupportive family structure and unstable relationships. Peer pressure can also cause individuals to take up drugs and alcohol.

Some of the preventive measures against the use of drugs and alcohol are as follows:

• Motivation from parents and elders to develop strong willpower against it
• Awareness about the ill effects of alcohol should be inculcated in children by parents. Proper counselling and knowledge must be given regarding the repercussions of alcohol addiction.
• Parents should take responsibility for monitoring the social circle of their children and must advise them against the wrong company
• Encourage students to dedicate their energy to other activities
• Proper medical and professional assistance should be provided if symptoms of depression and frustration are observed.

Chapter 8  Human Health and Disease Class 12 NCERT Solutions Biology are classified under the Unit – Biology in Human Welfare following the latest CBSE Syllabus for the session 2023-24. The unit consists of three chapters and constitutes around 14 marks as per previous trends. Students can expect a good number of questions to appear from this unit. Therefore, students are required to go through the NCERT Solutions of all the chapters thoroughly in order to be able to answer any type of question, especially High Order Thinking Skills (HOTS) questions, which assess the reasoning skills of students.

Human health is a term that can be used to refer to the social, physical and mental well-being of an individual. Its importance and various diseases are discussed briefly in this chapter. Some fatal diseases such as AIDS, cancer and the concept of drug abuse are also discussed. Access the NCERT Solutions of this chapter that are prepared by subject experts at BYJU’S to learn in-depth.

Important concepts mentioned in the chapter are given below:

• Common Diseases in Humans
• Drugs and Alcohol Abuse

Students can utilise the NCERT Solutions for Class 12 Biology Chapter 8 for a quick reference to comprehend complex topics.

Key Features of NCERT Solutions Class 12 Biology Chapter 8 – Human Health and Diseases

• NCERT Solutions serve as an excellent reference tool
• Use of coherent terms and easy-to-understand language
• Diagrams are self-explanatory and clear
• Framed by subject-matter experts, hence completely reliable
• Use of relevant examples
• Use of pointers wherever necessary

Frequently Asked Questions on NCERT Solutions for Class 12 Biology Chapter 8

List the topics discussed in chapter 8 of ncert solutions for class 12 biology., explain metastasis covered in chapter 8 of ncert solutions for class 12 biology ., why are the ncert solutions for class 12 biology chapter 8 important for the board exams.

Leave a Comment Cancel reply

Your Mobile number and Email id will not be published. Required fields are marked *

Request OTP on Voice Call

Post My Comment

Register with BYJU'S & Download Free PDFs

Register with byju's & watch live videos.

• New QB365-SLMS
• 12th Standard Materials
• 11th Standard Materials
• 10th Standard Materials
• 9th Standard Materials
• 8th Standard Materials
• 7th Standard Materials
• 6th Standard Materials
• 12th Standard CBSE Materials
• 11th Standard CBSE Materials
• 10th Standard CBSE Materials
• 9th Standard CBSE Materials
• 8th Standard CBSE Materials
• 7th Standard CBSE Materials
• 6th Standard CBSE Materials
• Tamilnadu Stateboard
• Scholarship Exams
• Scholarships

CBSE 12th Standard Biology Subject Human Health and Disease Case Study Questions 2021

By QB365 on 21 May, 2021

QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get  more marks in Exams

QB365 - Question Bank Software

12th Standard CBSE

Final Semester - June 2015

Case Study Questions

Your classmate complains of cough and headache to the doctor. The doctor confirms that he is suffering from pneumonia and not just common cold. (a) How did the doctor arrive at this conclusion? (b) Write the binomials of the causative organisms of pneumonia. (c) What is common about the transmission of the two diseases, common cold and pneumonia?

Read the following and answer any four questions from (i) to (v) given below : X and Yare communicable diseases whereas Wand Z are non-communicable diseases. X is transmitted through vectors whereas Y is transmitted through droplet infection. W is caused due to a hormone deficiency whereas Z is a degenerative disease. Based on the above information, answer the following questions. (i) Identify W, X, Y and Z.

(ii) Select the correct statement.

(iii) If X and Y both are usual diseases then which of the following holds true?

 (iv) If X and Y both are bacterial diseases then select the correct match from the following.

(v) Assertion: Communicable diseases could be contagious or non-contagious. Reason: Diseases that spread through vectors are non-contagious disease.

Read the following and answer any four questions from (i) to (v) given below : Priya was 4 years old when she contracted chicken pox. It took her around 15 days to recover completely. Now Priya is 5 years old so her mother got her vaccinated few days back for DPT (5th dose) as per immunisation program. Recently she was playing with her friend in the park when her friend accidently fell on iron pipe and badly bruised her knee. She was taken to the hospital where doctor gave her ATS injection and painkillers. Based on the above information, answer the following questions. (i) Select the correct statement.

(ii) Which of the following do you think is an example of natural passive immunity?

(iii) Which of the following is true for active immunity?

(iv) Select the incorrect match.

(v) Assertion: A person recovered from measles develops an active immunity against this infection. Reason: In active immunity, person's own cells develop antibodies in response to infection.

*****************************************

Cbse 12th standard biology subject human health and disease case study questions 2021 answer keys.

(a) In pneumonia, the lung alveoli become filled with a fluid leading to severe problems in breathing, whereas in common cold, only the nose and respiratory passage are affected, but not the lungs. (b) Pneumonia is caused by (i) Streptococcus pneumoniae (ii) Haemophilus influenzae. (c) Both common cold and pneumonia spread by the droplets/aerosols released by the infected person during coughing and sneezing.

(a) Macrophage. (b) RNA (Ribonucleic acid). (c) Reverse transcriptase.

(a) It is consumed by (i) inhalation and (ii) oral ingestion. (b) Marijuana, Hashish, Ganja, Charas.

(i) (b) : X is a communicable disease that is transmitted through vectors. It could be malaria, chikungunya, etc. Y is communicable disease that is transmitted through droplet infection. It could be rhinitis, diphtheria, pertussis, etc. W is a non-communicable disease like diabetes that is caused by deficiency of insulin hormone. Z is a non-communicable degenerative disease like Alzheimer's disease. (ii) (c) : Sleeping sickness is caused by Trypanosoma. Diphtheria is caused by Corynebacterium diphtheriae. In myocardial infarction a large portion of heart muscle is deprived of blood due to coronary thrombosis and patient develops heart attack. (iii) (b) (iv) (a) : Leprosy is a bacterial infection that spreads through prolonged contact with the infected person. Whooping cough spreads through droplet infection. Botulism spreads through faecal oral route. (v) (b)

(i) (d) : In active immunity, person's own cells produce antibodies in response to infection or vaccination. A person who has recovered from an infection develops natural active immunity whereas artificial active immunity is the resistance induced by vaccines. When ready-made antibodies are directly injected into a person to protect the body against foreign agents, it is called passive immunity. (ii) (b) (iii) (c) : Active immunity provides relief only after long period. It is long lasting. (iv) (c) : Administration of antidiphtheric serum in a patient provides artificial passive immunity. (v) (a)

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

• School Solutions
• Star Program
• NCERT Solutions Class 12 Maths
• NCERT Solutions Class 12 Physics
• NCERT Solutions Class 12 Chemistry
• NCERT Solutions Class 12 Biology
• NCERT Solutions Class 12 Commerce
• NCERT Solutions Class 12 Economics
• NCERT Solutions Class 12 Accountancy
• NCERT Solutions Class 12 English
• NCERT Solutions Class 12 Hindi
• NCERT Solutions Class 11 Maths
• NCERT Solutions Class 11 Physics
• NCERT Solutions Class 11 Chemistry
• NCERT Solutions Class 11 Biology
• NCERT Solutions Class 11 Commerce
• NCERT Solutions Class 11 Accountancy
• NCERT Solutions Class 11 English
• NCERT Solutions Class 11 Hindi
• NCERT Solutions Class 11 Statistics
• NCERT Solutions Class 10 Maths
• NCERT Solutions Class 10 Science
• NCERT Solutions Class 10 English
• NCERT Solutions Class 10 Hindi
• NCERT Solutions Class 10 Social Science
• NCERT Solutions Class 9 Maths
• NCERT Solutions Class 9 Science
• NCERT Solutions Class 9 English
• NCERT Solutions Class 9 Hindi
• NCERT Solutions Class 9 Social Science
• NCERT Solutions Class 8 Maths
• NCERT Solutions Class 8 Science
• NCERT Solutions Class 8 English
• NCERT Solutions Class 8 Hindi
• NCERT Solutions Class 8 Social Science
• NCERT Solutions Class 7 Maths
• NCERT Solutions Class 7 Science
• NCERT Solutions Class 7 English
• NCERT Solutions Class 7 Hindi
• NCERT Solutions Class 7 Social Science
• NCERT Solutions Class 6 Maths
• NCERT Solutions Class 6 Science
• NCERT Solutions Class 6 English
• NCERT Solutions Class 6 Hindi
• NCERT Solutions Class 6 Social Science
• NCERT Solutions Class 5 Maths
• NCERT Solutions Class 5 English
• NCERT Solutions Class 5 EVS
• NCERT Solutions Class 4 Maths
• NCERT Solutions Class 4 English
• NCERT Solutions Class 4 EVS
• NCERT Solutions Class 4 Hindi
• NCERT Solutions Class 3 Maths
• NCERT Solutions Class 3 English
• NCERT Solutions Class 3 EVS
• NCERT Solutions Class 3 Hindi
• NCERT Solutions Class 2 Maths
• NCERT Solutions Class 2 English
• NCERT Solutions Class 2 Hindi
• NCERT Solutions Class 1 Maths
• NCERT Solutions Class 1 English
• NCERT Solutions Class 1 Hindi
• NCERT Books Class 12
• NCERT Books Class 11
• NCERT Books Class 10
• NCERT Books Class 9
• NCERT Books Class 8
• NCERT Books Class 7
• NCERT Books Class 6
• NCERT Books Class 5
• NCERT Books Class 4
• NCERT Books Class 3
• NCERT Books Class 2
• NCERT Books Class 1
• Important Questions Class 12
• Important Questions Class 11
• Important Questions Class 10
• Important Questions Class 9
• Important Questions Class 8
• Important Questions Class 7
• important questions class 6
• CBSE Class 12 Revision Notes
• CBSE Class 11 Revision Notes
• CBSE Class 10 Revision Notes
• CBSE Class 9 Revision Notes
• CBSE Class 8 Revision Notes
• CBSE Class 7 Revision Notes
• CBSE Class 6 Revision Notes
• CBSE Class 12 Syllabus
• CBSE Class 11 Syllabus
• CBSE Class 10 Syllabus
• CBSE Class 9 Syllabus
• CBSE Class 8 Syllabus
• CBSE Class 7 Syllabus
• CBSE Class 6 Syllabus
• CBSE Class 5 Syllabus
• CBSE Class 4 Syllabus
• CBSE Class 3 Syllabus
• CBSE Class 2 Syllabus
• CBSE Class 1 Syllabus
• CBSE Sample Question Papers For Class 12
• CBSE Sample Question Papers For Class 11
• CBSE Sample Question Papers For Class 10
• CBSE Sample Question Papers For Class 9
• CBSE Sample Question Papers For Class 8
• CBSE Sample Question Papers For Class 7
• CBSE Sample Question Papers For Class 6
• CBSE Sample Question Papers For Class 5
• CBSE Sample Question Papers For Class 4
• CBSE Sample Question Papers For Class 3
• CBSE Sample Question Papers For Class 2
• CBSE Sample Question Papers For Class 1
• CBSE Previous Year Question Papers Class 12
• CBSE Previous Year Question Papers Class 10
• Extra Questions For Class 8 Maths
• Extra Questions For Class 8 Science
• Extra Questions For Class 9 Maths
• Extra Questions For Class 9 Science
• Extra Questions For Class 10 Maths
• Extra Questions For Class 10 Science
• NEET 2021 Question Paper
• NEET 2020 Question Paper
• NEET 2019 Question Paper
• NEET 2018 Question Paper
• NEET 2017 Question Paper
• NEET 2016 Question Paper
• NEET 2015 Question Paper
• NEET Physics Questions
• NEET Chemistry Questions
• NEET Biology Questions
• NEET Sample Papers
• NEET Physics Syllabus
• NEET Chemistry Syllabus
• NEET Biology Syllabus
• NEET Mock Test
• NEET Eligibility Criteria
• JEE Main 2021 Question Paper
• JEE Main 2020 Question Paper
• JEE Main 2019 Question Paper
• JEE Main 2018 Question Paper
• JEE Main 2017 Question Paper
• JEE Main 2016 Question Paper
• JEE Main 2015 Question Paper
• JEE Main Sample Papers
• JEE Main Physics Syllabus
• JEE Main Chemistry Syllabus
• JEE Main Maths Syllabus
• JEE Main Physics Questions
• JEE Main Chemistry Questions
• JEE Main Maths Questions
• JEE main revision notes
• JEE Main Mock Test
• JEE Advanced Physics Questions
• JEE Advanced Chemistry Questions
• JEE Advanced Maths Questions
• JEE Advanced 2021 Question Paper
• JEE Advanced 2020 Question Paper
• JEE Advanced 2019 Question Paper
• JEE Advanced 2018 Question Paper
• JEE Advanced 2017 Question Paper
• JEE Advanced 2016 Question Paper
• JEE Advanced 2015 Question Paper
• JEE Advanced Physics Syllabus
• JEE Advanced Chemistry Syllabus
• JEE Advanced Maths Syllabus
• JEE Advanced Mock Test
• ISC Class 12 Syllabus
• ISC Class 11 Syllabus
• ICSE Class 10 Syllabus
• ICSE Class 9 Syllabus
• ICSE Class 8 Syllabus
• ICSE Class 7 Syllabus
• ICSE Class 6 Syllabus
• ISC Sample Question Papers for Class 12
• ISC Sample Question Papers for Class 11
• ICSE Sample Question Papers for Class 10
• ICSE Sample Question Papers for Class 9
• ICSE Sample Question Papers for Class 8
• ICSE Sample Question Papers for Class 7
• ICSE Sample Question Papers for Class 6
• ICSE Class 10 Revision Notes
• ICSE Class 9 Revision Notes
• ISC Important Questions for Class 12
• ISC Important Questions for Class 11
• ICSE Important Questions for Class 10
• ICSE Important Questions for Class 9
• ICSE Important Questions for Class 8
• ICSE Important Questions for Class 7
• ICSE Important Questions for Class 6
• ISC Class 12 Question Paper
• ICSE Class 10 Question Paper
• Maharashtra Board Syllabus
• Maharashtra Board Sample Question Paper
• Maharashtra Board Previous Year Question Paper
• AP Board Syllabus
• AP Board Sample Question Paper
• AP Board Previous Year Question Paper
• Tamilnadu Board Syllabus
• Tamilnadu Board Sample Question Paper
• Tamilnadu Board Previous Year Question Paper
• Telangana Board Syllabus
• Telangana Board Sample Question Paper
• Telangana Board Previous Year Question Paper
• Karnataka Board Syllabus
• Karnataka Board Sample Question Paper
• Karnataka Board Previous Year Question Paper
• Examination Full Forms
• Physics Full Forms
• Chemistry Full Forms
• Biology Full Forms
• Educational Full Form
• CUET Eligibility Criteria
• CUET Exam Pattern
• CUET Cutoff
• CUET Syllabus
• CUET Admit Card
• CUET Counselling
• CUET Previous Year Question Papers
• CUET Application Form
• CUET Sample Papers
• CUET Exam Centers
• CUET Exam Dates
• CUET Results
• Physics Formulas
• Chemistry Formulas
• Math Formulas
• Algebra Formulas
• Geometry Formulas
• Trigonometry Formulas
• Subscription

CBSE Important Questions Class 12 Biology Chapter 8

Home » CBSE » CBSE Important Questions Class 12 Biology Chapter 8

• CBSE Important Questions
• Important Questions Class 6
• CBSE Previous Year Question Papers
• CBSE Revision Notes
• CBSE Syllabus
• CBSE Extra Questions
• CBSE Sample Papers
• ISC & ICSE Syllabus
• ICSE Syllabus Class 9
• ICSE Syllabus Class 8
• ICSE Syllabus Class 7
• ICSE Syllabus Class 6
• ICSE Syllabus Class 10
• ICSE Question Paper
• ICSE Sample Question Papers
• ISC Sample Question Papers For Class 12
• ISC Sample Question Papers For Class 11
• ICSE Sample Question Papers For Class 10
• ICSE Sample Question Papers For Class 9
• ICSE Sample Question Papers For Class 8
• ICSE Sample Question Papers For Class 7
• ICSE Sample Question Papers For Class 6
• ICSE Revision Notes
• ICSE Important Questions
• ISC Important Questions For Class 12
• ISC Important Questions For Class 11
• ICSE Important Questions For Class 10
• ICSE Important Questions For Class 9
• ICSE Important Questions For Class 8
• ICSE Important Questions For Class 7
• ICSE Important Questions For Class 6
• Maharashtra board
• Rajasthan-Board
• Andhrapradesh Board
• AP Board syllabus
• Telangana Board
• Tamilnadu Board
• Tamilnadu Sample Question Paper
• Tamilnadu Syllabus
• Tamilnadu Previous Year Question Paper
• NCERT Solutions Class 12
• NCERT Solutions Class 10
• NCERT Solutions Class 11
• NCERT Solutions Class 9
• NCERT Solutions Class 8
• NCERT Solutions Class 7
• NCERT Solutions Class 6
• NCERT Solutions Class 5
• NCERT Solutions Class 4
• NCERT Solutions Class 3
• NCERT Solutions Class 2
• NCERT Solutions Class 1
• JEE Main Question Papers
• JEE Main Syllabus
• JEE Main Questions
• JEE Main Revision Notes
• JEE Advanced Question Papers
• JEE Advanced Syllabus
• JEE Advanced Questions
• JEE Advanced Sample Papers
• NEET Question Papers
• Neet 2021 Question Paper
• Neet 2020 Question Paper
• Neet 2019 Question Paper
• Neet 2018 Question Paper
• Neet 2017 Question Paper
• Neet 2016 Question Paper
• Neet 2015 Question Paper
• NEET Syllabus

Important Questions Class 12 Biology Chapter 8

Important questions for cbse class 12 biology chapter 8 – human health and disease.

Important Questions Class 12 Biology Chapter 8 are prepared by subject experts after a thorough analysis of the past years’ question papers. Students need a question set that provides  guided practice and helps  them in understanding what kinds of questions which are important from an exam point of view as well as  the question pattern. These questions follow the CBSE Syllabus . So, it will help students revise the important concepts from the chapter and practise more questions based on them for a thorough reason.

CBSE Class 12 Biology Chapter-8 Important Questions

Study Important Questions for Class 12 Biology Chapter 8 – Human Health and Disease Students can view a sample of the important questions for Class 12 Biology Chapter 8. They can click on the link provided to access the entire set of questions. 

Very Short Answer Questions (1 Mark)

Q.1. Name the pathogen that causes malaria.

Ans. Plasmodium Falciparum is the pathogen that causes malaria.

Q.2. What is the importance of yeast in medical science?

Ans . Yeast is considered an important microorganism in medical science because it is used to produce the vaccine of Hepatitis B.

Q.3. What causes the shivering in malaria patients?

Ans . After sporozoite infection, when the red blood corpuscles rupture, they release the toxic substance hemozoin in the blood which causes shivering in malaria patients.

Q.4. Why are AIDS patients more susceptible to diseases compared to patients affected by other diseases?

Ans. The HIV virus, which causes AIDS, attacks the immunity system of the human body and weakens it over time, making AIDS patients more susceptible to infections and diseases than patients suffering from other diseases.

Q,5. Write the names of two curable sexually transmitted diseases.

Ans. Syphilis and gonorrhoea are the names of two curable, sexually transmitted diseases.

Q.6. When is a tumour considered malignant?

Ans. When a tumour starts to grow rapidly, causing damage to the normal cells and tissues around it, then the tumour is considered malignant.

Short Answer Questions (2 Marks)

Q.1. Where are B-lymphocytes and T-lymphocytes formed? How do they help develop immunity?

Ans: The B-lymphocytes and T-lymphocytes are formed in the bone marrow of the human body.

The B-lymphocytes protect the body by producing antibodies while the T-lymphocytes immune the body by helping the B-cells produce antibodies.

Q.2. What are allergens? How do they cause inflammatory responses inside the human body?

Ans: Allergens can be defined as substances causing the hypersensitive reaction of the immune system.

When a person comes in contact with an allergen frequently the allergen combines with Ig E on the mast cell. The cells then burst and release Histamines which leads to the inflammatory response.

Q.3 Describe the role of lymph nodes in the human immune response.

Ans : The lymph nodes are the sites in the human body where the lymphocytes and the antigen interact with each other. When microorganisms attack the lymph nodes, the lymphocytes present here get activated and trap  to destroy them.

Long Answer Questions (3 Marks)

Q.1. What is vaccination? Why is it important to take a vaccine?

Ans: Vaccination is a process of developing immunity in the body against pathogens.

A vaccine is a weak pathogen that is injected into the body to produce antibodies against it. These antibodies neutralise the effect of the injected pathogens. Next time, when the vaccinated person gets infected by the same pathogen, but one that is stronger this time, the B lymphocytes and the T lymphocytes will recognise and attack them to protect the body. This type of immunity is called active immunity. However, if a person is severely affected by a pathogen then directly the antibody of the pathogen is injected into the body through a vaccine. This type of immunity is known as passive immunity. So, vaccination is extremely important to develop immunity in the body.

Q.2. What are the reasons for drug abuse? Suggest some of the preventive measures.

Ans: Though everyone knows it is extremely harmful to abuse drugs, some people still consume them and get addicted slowly. The reasons for their attraction towards drugs include the following:

• Curiosity for drugs
• Pressure from peers to consume drugs
• To escape frustration, failure and other psychological problems
• To enhance performance in physical activities

The measures mentioned below can be followed to prevent drug abuse:

• Avoid the friends who pressurise others to consume drugs
• Spreading awareness of the harmful effects of drugs
• Seeking help from parents
• Seeking the help of counsellors and medical experts.

Q.3. Write down the names of the causative agents of the diseases mentioned below.

Pneumonia, Typhoid, Common Cold, Ascariasis, Ringworm, Amebiasis

Ans. The causative of the diseases are as follows:

Very Long Answer Questions (5 Marks)

Q.1. Write a brief note on the role of lymphoid organs in the immune response. Elaborate on the different types of lymphoid organs in the human body with examples.

Ans. Lymphoid organs in the human body track microbes and foreign substances and stimulate an immune response against them. These organs can be divided into the following categories:

• Primary Lymphoid Organs: These organs produce the cells of the immune system. They are also known as central lymphoid organs. Bone marrow and Thymus come under this category.

(a) Bone Marrow: It is the main lymphoid organ that actively produces all types of blood cells including lymphocytes. It helps in the development and maturation of T lymphocytes and B lymphocytes by providing a micro-environment. The mature B cells travel to the circulatory system to detect the pathogens.

(b) Thymus: It is located beneath the breastbone near the heart. T lymphocytes are also produced and nurtured in the thymus. The thymus is large at the time of birth but keeps shrinking with age.

• Secondary Lymphoid Organ: They help the lymphocytes to interact with the antigen and destroy them.

(a) Spleen: It is a large bean-shaped organ that contains mainly lymphocytes and phagocytes. It is regarded as the graveyard of RBC. It acts as a filter for blood by trapping blood-borne microorganisms.

(b) Lymph Node: They are responsible for trapping the microorganisms and antigens that enter the lymph and tissue fluid. The lymphoid tissues located within major tracts are called mucosa-associated lymphoid tissue (MALT).

Q.2. Which protozoa cause malaria? Write a short note on the life cycle of the malarial parasite.

Ans. Plasmodium vivax is the protozoan that causes malaria.

This protozoan is a parasite, so it needs hosts for its growth and development. When a female Anopheles bites an infected person, the protozoa enter its body, and when it further bites someone else the sporozoites of the protozoa mixes up with his blood. Thus, the healthy man becomes infected by malaria protozoa. There are four variants of malarial protozoa, namely, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. 

The life cycle of the protozoa is discussed below.

• The life cycle of Plasmodium protozoa in the human body involves four stages: pre-erythrocytic schizogony phase, erythrocytic schizogony phase, gametogenic phase, and exoerythrocytic schizogony phase.
• The sporozoites of the protozoa are present in the salivary glands of Anopheles mosquitoes. These sporozoites are transmitted into human blood when they bite someone.
• These sporozoites reach the liver of the infected man and multiply there quickly to develop schizonts that contain merozoites.
• These merozoites are attracted by glycoproteins present in the red blood cells.
• There they produce gametes and rupture the red blood cells.
• The ruptured RBCs release toxic haemozoin that causes high fever and shivering.
• The symptoms of malaria become prominent after the incubation period of nine to fourteen days, during which the patient does not feel any illness.
• When a mosquito bites the malaria patient, it takes the gametes present in the blood.
• The gametes are fertilised in the gut of the mosquito.
• The newly formed sporozoites are stored in the salivary gland of the mosquito.
• When this mosquito bites someone, it injects the sporozoites into the blood.  As a result, this cycle never ends. .

Class 12 Biology Chapter 8 Important Questions- Summary

Chapter 8 Class 12 Biology Important Questions cover all the important topics given in the NCERT book. In this set of Important Questions, students will learn what pathogens are, how they affect the health of human beings, and how some pathogens live in the human body itself and later affect it. Along with the names of diseases and their causes, students will also learn the concept of vaccination, which helps develop immunity. The different types of immunity, several organs that produce special kinds of cells to protect the body, the immune response system, etc. are all discussed in detail. Some of the diseases that are extremely important from the exam perspective are elaborately discussed in the next section.

Class 12 Biology Chapter 8 Important Questions- Summary Types of Diseases

Disease can be defined as abnormal conditions of organisms, in which, the normal functions of their body are interrupted. Genetic defects, immunological problems, and unhealthy lifestyle can cause diseases. These diseases can be divided into two categories.

• Congenital Diseases
• Acquired Diseases

Congenital Diseases: These kinds of diseases are also called birth defects because they exist in individuals since their birth. Mutations of genes, chromosomal aberrations, and several environmental factors can cause congenital diseases. These diseases are transmitted from one generation to another through the genes present in chromosomes. Hemophilia, Turner’s Diseases, Colour blindness, Down Syndrome, etc. are the names of some congenital diseases.

Acquired Diseases: People get affected by this kind of disease during their lifetime. Malaria, cancer, conjunctivitis, etc. are some common examples of acquired diseases. This kind of disease can be infectious, non-communicable, deficiency-related, or allergic in nature.

• Pathogens are organisms that cause and spread diseases. Viruses, bacteria, protozoa, fungi, worms, etc. are examples of pathogens.

Immunity is the ability of the body to fight against pathogens. Immunity can be categorised in the following manner:

• Innate Immunity
• Acquired Immunity

Innate Immunity: This kind of immunity is inherent in nature. There are four types of barriers that protect the body from pathogens. These are: physical barriers, physiological barriers, cellular barriers, and cytokine barriers.

Acquired Immunity: This type of immunity is developed when a person comes into contact with a pathogen for the first time and initiates a low-intensity primary response against the pathogen. When that person is affected by the same pathogen later, his body generates a strong secondary response and protects the body. This kind of immunity is called acquired immunity.

AIDS (Acquired Immuno- Deficiency Syndrome)

• AIDS is caused by the HIV virus.
• HIV stands for Human Immunodeficiency Virus.
• It is a retrovirus because it contains RNA as its genetic material.
• It generates viral DNA in the host through the enzyme reverse transcriptase.
• The viral DNA gets multiplied in the host.
• Then the DNA enters T-lymphocytes causing a rapid decrease in their number.
• The normal cells of our body show contact inhibition property, that is, the inhibition of cell growth when the cells are in contact with other cells. Some cells lose this property and continue to multiply leading to formation of a mass of cells, called a tumour.
• Tumours are of two types: benign and malignant.
• In our body, the growth and differentiation of cells are highly controlled. These regulatory mechanisms break down completely in the case of malignant tumour cells.
• The malignant tumour cells grow rapidly and damage the surrounding cells.
• These tumours cause cancer.
• Several specific genes, called cellular oncogenes, have been found in normal cells, which when activated under certain conditions may lead to the oncogenic transformation of cells.

Drugs and Alcohol Abuse

• Some of the widely abused drugs include heroin, cannabinoids, and coca alkaloids.
• The opioid drugs get stuck at the opioid receptors present in the CNS and GI tract.
• Diacetylmorphine, a popularly known heroin or smack, is extracted from the latex of Papaver somniferum, a poppy plant, by morphine acetylation.
• Cannabinoids affect the cannabinoid receptors in the brain.
• Cannabinoids are obtained from Cannabis sativa plants.
• The flower tops, resins, and leaves of the plants are used to prepare cannabinoids, such as marijuana, charas, hashish, ganja, and others.
• Cocaine or coca alkaloid is obtained from a plant, found mostly in South America, Erythroxylum coca. 
• Sportsmen often take cannabinoids to increase their performance, relax their muscles and decrease anxiety.
• Doctors often prescribe drugs to relieve pain, treat depression and insomnia, etc. Morphine is one such drug.
• The nicotine, an alkaloid, found in tobacco stimulates the adrenal gland to release adrenaline and nor-adrenaline hormones into blood circulation which raise blood pressure and increases heart rate.
• Click to share on Facebook (Opens in new window)
• Click to share on Twitter (Opens in new window)
• Click to share on LinkedIn (Opens in new window)
• Click to share on WhatsApp (Opens in new window)

FAQs (Frequently Asked Questions)

1. write down the name of the biological control agent widely used against mosquito larvae..

Gambusia fish is used as a biological control agent against mosquito larvae.

2. Name the cells that produce natural antibodies.

B-lymphocytes are the cells that produce natural antibodies.

3. Write the name of the causative agent of elephantiasis.

The name of the agent causing elephantiasis is Wuchereria Bancrofti.

4. Name the vector that causes Chikungunya.

Aedes albopictus and Aedes aegypti mosquitoes, are the species most frequently engaged in the transmission cycle  of Chikungunya disease. Both species have the ability to spread Zika and dengue fever viruses, as well as other mosquito-borne infections.

CBSE Related Links

NCERT Solutions For Class 12 Biology chapter 8-Human Health And Disease

• Active page

NCERT Solutions for class-12 Biology Chapter 8 Human Health And Disease is prepared by Physics Wallah senior teacher team, primary focus while solving these questions of class-12 in NCERT textbook, Do read theory of this Chapter while going before solving the NCERT questions. You can download and share NCERT Solutions of Class 12 Biology from Physics Wallah.

Checkout Class 12th Books from PW Store

Chapter 8 Human Health And Disease

Answer the following Questions.

Question 1. What are the various public health measures, which you would suggest as safeguard against infectious diseases?

Solution : Public health measures which should be taken to afeguard against infectious diseases are:

• Maintenance of personal and public hygiene: It is one of the most important methods for prevention of various infectious diseases. This measure consists of  maintaining a hygienic body, taking of healthy and nutritious food, drinking clean water, etc. In public hygiene their is proper disposal of garbage, excreta, periodic cleaning of society, and cleaning of water reservoirs.
• Isolation: To prevent the spread of air-borne infectious diseases like pneumonia, chicken pox, tuberculosis, etc., it is essential measure to keep the infected person in isolation with others to reduce the chances of spreading these infectious diseases.
• Vaccination: Vaccination is the protection of the body from communicable diseases by injecting some agent that makes copy of the microbe inside the body. It helps in providing passive immunity to  the body. Several vaccines are available against many diseases such as tetanus, polio, measles, mumps, etc.
• Vector Eradication: Various diseases such as malaria, filariasis, dengue, and chikungunya spread through vectors. Thus, these diseases can be prevented by providing a clean environment and by  the prevention of breeding of mosquitoes. This can be achieved by not allowing water to stagnate around public areas. Also, measures like periodic cleaning of coolers, use of mosquito nets and spreading of insecticides in drains, ponds, etc. can be undertaken to ensure a healthy environment. Introducing fish such as Gambusia in ponds also controls the breeding of mosquito larvae in still water against diseases.

Question 2. In which way has the study of biology helped us to control infectious diseases?

Solution : Various advancements that have occurred in the field of biology have helped us gain a better understanding to fight against various infectious diseases. Biology has helped us study the life cycle of various parasites, pathogens, and vectors along with the modes of transmission of various diseases and the measures for controlling them. Vaccination programmes against several infectious diseases such as small pox, chicken pox, tuberculosis, etc. have helped eradicate these diseases. Biotechnology has helped in the preparation of newer and safer drugs and vaccines. Antibiotics have also played an important role in treating infectious diseases. 

Checkout Class 12th Sample Papers from PW Store

Question 3. How does the transmission of each of the following diseases take place?

(a) Amoebiasis

(b) Malaria

(c) Ascariasis 

(d) Pneumonia

• Amoebiasis: It is a vector transmitted disease that spreads by the means of contaminated food and water. The vector involved in the transmission of this disease is the housefly. Its mode of transmission is Entamoeba histolytica.
• Malaria: It is a vector transmitted disease that spreads by the biting of the female Anopheles mosquito. Its mode of transmission is Ascaris lumbricoides.
• Ascariasis: It spreads through contaminated food and water. Its mode of transmission is Ascaris lumbricoides
• Pneumonia: It spreads by the sputum of a diseased  person. Its mode of transmission is Streptococcus pneumonia

Question 4. What measure would you take to prevent water-borne diseases?

Solution : Water-borne diseases such as cholera, typhoid, hepatitis B, etc. spread  by drinking contaminated water. These water-borne diseases can be prevented by ensuring proper disposal of sewage, excreta, periodic cleaning. Also, measures such as disinfecting community water reservoirs, boiling drinking water, etc. should be observed. 

5. Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.

Solution : A ‘suitable gene’ refers to a specific DNA segment which can be injected into the cells of the host body to produce specific proteins. This protein kills the specific disease-causing organism in the host body and provides immunity. 

Question 6. Name the primary and secondary lymphoid organs.

Solution : (a)Primary lymphoid organs include the bone marrow and the thymus. 

(b) Secondary lymphoid organs are the spleen, lymph nodes, tonsils, Peyer’s patches of small intestine, and appendix.

Question 7. The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form:

(b)CMI 

(c) AIDS 

(d) NACO 

Solution : (a)MALT- Mucosa-Associated Lymphoid Tissue 

(b)CMI- Cell-Mediated Immunity 

(c)AIDS- Acquired Immuno Deficiency Syndrome

(d)NACO- National AIDS Control Organization

(e)HIV- Human Immuno Deficiency virus

Question 8. Differentiate the following and give examples of each:

(a) Innate and acquired immunity 

(b)Active and passive immunity

Solution : (a)Innate and acquired immunity

(b)Active and passive immunity 

Question 9. Draw a well-labelled diagram of an antibody molecule.

• Pneumonia: It spreads by the sputum of a diseased  person. Its mode of transmission is Streptococcus pneumoniae

Question 10. What are the various routes by which transmission of human immunodeficiency virus takes place?

Solution : AIDS (Acquired Immuno Deficiency Syndrome) is caused by the Human immunodeficiency virus (HIV). 

It has the following modes of transmission:

• Unprotected sexual contact with an infected person.
• Transfusion of blood from a healthy to an infected person.
• Sharing infected needles and syringes. 
• From an infected mother to a child through the placenta.

Question 11. What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?

Solution : AIDS (Acquired Immuno Deficiency Syndrome) is caused by the Human immunodeficiency virus (HIV) via sexual or blood-blood contact. After entering the human body, the HIV virus attacks and enters the macrophages. Inside the macrophages, the RNA of the virus replicates with the help of enzyme reverse transcriptase and gives rise to viral DNA. Then, this viral DNA incorporates into the host DNA and directs the synthesis of virus particles. At the same time, HIV enters helper T- lymphocytes. It replicates and produces viral progeny there. These newly formed progeny viruses get released into the blood, attacking other healthy helper T-lymphocytes in the body. As a result, the number of T-lymphocytes in the body of an infected person decreases progressively, thereby decreasing the immunity of a person. 

Question 12. How is a cancerous cell different from a normal cell?

Question 13. Explain what is meant by metastasis.

Solution : The property of metastasis is exhibited by malignant tumors. It is the pathological process of spreading cancerous cells to the different parts of the body. These cells divide uncontrollably, forming a mass of cells called tumor. From the tumor, some cells get sloughed off and enter into the blood stream. From the blood stream, these cells reach distant parts of the body and therefore, initiate the formation of new tumors by dividing actively. 

Question 14. List the harmful effects caused by alcohol/drug abuse.

Solution : Alcohol and drugs have several adverse effects on the individual, his family, and the society.

A. Effects of alcohol:

Effects on the individual: Alcohol has an adverse effect on the body of an individual. When an individual consumes excess alcohol, it causes damage to the liver and the nervous system. As a result, other symptoms such as depression, fatigue, aggression, loss of weight and appetite may also be observed in the individual. Sometimes, extreme levels of alcohol consumption may also lead to heart failure, resulting coma and death. Also, it is advisable for pregnant women to avoid alcohol as it may inhibit normal growth of the baby.

Effects on the family: Consumption of excess alcohol by any family member can have devastating effects on the family. It leads to several domestic problems such as quarrels, frustrations, insecurity, etc. 

Effects on the society:

• Rash behavior
• Malicious mischief and violence
• Deteriorating social network
• Loss of interest in social and other activities

B Effects of drugs:An individual who is addicted to drugs creates problems not only for himself but also for his family.

Effects on the individual: Drugs have an adverse effect on the central nervous system of an individual. This leads to the malfunctioning of several other organs of the body such as the kidney, liver, etc. The spread of HIV is most common in these individuals as they share common needles while injecting drugs in their body. Drugs have long-term side effects on both males and females. These side effects include increased aggressiveness, mood swings, and depression

Effects on the family and society: A person addicted to drugs creates problems for his family and society. A person dependant on drugs becomes frustrated, irritated, and anti-social. 

Question 15. Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence?

Solution : Yes, friends can influence one to take drugs and alcohol. A person can take the following steps for protecting himself/herself against drug abuse:

• Increase your will power to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun. 
• Avoid the company of friends who take drugs. 
• Seek help from parents and peers. 
• Take proper knowledge and counseling about drug abuse. Devote your energy in other extra-curricular activities.
• Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent. 

Question 16. Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.

Solution : Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance level of the body’s receptors, leading to more consumption of drugs. 

Question 17. In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?

Solution : Many factors are responsible for motivating youngsters towards alcohol or drugs. Curiosity, need for adventure and excitement, experimentation are the initial causes of motivation. Some youngsters start consuming drugs and alcohol in order to overcome negative emotions (such as stress, pressure, depression, frustration) and to excel in various fields. Several mediums like television, internet, newspaper, movies etc. are also responsible for promoting the idea of alcohol to the younger generation. Amongst these factors, reasons such as unstable and unsupportive family structures and peer pressure can also lead an individual to be dependant on drugs and alcohol. 

Preventive measures against addiction of alcohol and drugs: 

• Parents should motivate and try to increase the will power of their child. 
• Parents should educate their children about the ill-effects of alcohol. They should provide them with proper knowledge and counselling regarding the consequences of addiction to alcohol. 
• It is the responsibility of the parent to discourage a child from experimenting with alcohol. Youngsters should be kept away from the company of friends who consume drugs. 
• Children should be encouraged to devote their energy in other extra- curricular and recreational activities. 
• Proper professional and medical help should be provided to a child if sudden symptoms of depression and frustration are observed. 

NCERT Solutions For Class 12 Biology Chapter Wise.

Chapter 1 Reproduction in Organisms

Chapter 2 Sexual Reproduction In Flowering Plants

Chapter 3 Human Reproduction

Chapter 4 Reproductive Health

Chapter 5 Principles of Inheritance And Variation

Chapter 6 Molecular Basis of Inheritance

Chapter 7 Evolution

Chapter 9 Strategies For Enhancement In Food Production

Chapter 10 Microbes In Human Welfare

Chapter 11 Biotechnology And Processes

Chapter 12 Biotechnology And Its Applications

Chapter 13 Organisms And Populations

Chapter 14 Ecosystem

Chapter 15 Biodiversity And Conservation

Chapter 16 Environmental Issues

Related Chapters

• chapter 1-Reproduction In Organisms
• chapter 2-Sexual Reproduction In Flowering Plants
• chapter 3-Human Reproduction
• chapter 4-Reproductive Health
• chapter 5-Principles Of Inheritance And Variation
• chapter 6-Molecular Basis Of Inheritance
• chapter 8-Human Health And Disease
• chapter 9-Strategies For Enhancement In Food Production
• chapter 10-Microbes In Human Welfare
• chapter 11-Biotechnology And Principles And Processes
• chapter 12-Biotechnology And Its Applications
• chapter 13-Organisms And Populations
• chapter 14-Ecosystem
• chapter 15-Biodiversity And Conservation
• chapter 16-Environmental Issues

Recent Concepts

Talk to Our counsellor

Last few days of free access to Embibe

Click on Get Started to access Learning Outcomes today

Share this article

Table of Contents

Latest updates.

NCERT Solutions for Class 7 Science Chapter 16 Water – A Precious Resource

NCERT Solutions for Class 7 Science Chapter 17 Forests: Our Lifeline – Download PDF

NCERT Solutions for Class 7 Science Chapter 18: Wastewater Story – Download PDF

NCERT Solutions for Class 7 Science Chapter 10 2024: Respiration in Organisms

NCERT Solutions for Visualizing Solid Shapes Exercise 10.3 Class 8 Maths

NCERT Solutions for Factorisation Exercise 14.1 Class 8 Maths

NCERT Solutions for Class 6 2024: Download PDF

CBSE Class 10 Social Science NCERT Solutions

NCERT Solutions for Class 10 Science Chapter 9

NCERT Solutions for Class 11 Chemistry Chapter 5 States of Matter

Tag cloud :.

• entrance exams
• engineering
• ssc cgl 2024
• Written By Abhishek_verma
• Last Modified 18-03-2024

NCERT Solutions for Class 12 Biology Chapter 8 Human Health and Diseases

NCERT Solutions for Class 12 Biology Chapter 8 Human Health and Diseases: Referring to NCERT Solutions is crucial for students who desire to pursue medicine after Class 12. Students can use the NCERT Solutions for Class 12 Biology Chapter 8 – Human Health and Diseases as a helpful study aid to perform well in exams. Building a solid basis for topics can help students perform well in the NEET exams. The student’s performance in NEET and other medical competitive exams will improve if they fully comprehend this chapter.

CBSE Class 6 Chapter 8 talks about Bacterial Diseases, Viral Diseases, Malaria and its Symptoms, Pathogens – Spread and Control, Anthrax, Third Line of Defence, Vaccines, Types of Vaccines and many more. Embibe offers a set of 400+ questions for all the sub-topics involved in chapter 8. Students must definetely practice all the questions provided by Embibe to score best marks. Keep reading to find out NCERT solutions for Class 12 Biology chapter 8.

NCERT Solutions for Class 12 Biology Chapter 8: Important Topics

Biology is one of the most interesting and important subjects for the students who are willing to pursue their careers in the field of medicine. Human Health and Diseases lays a special focus on the most common diseases and also about the types of vaccines. As students go deeper into the topics, it gets interesting to learn. Students will develop the ability to understand the nature of questions being asked in the exam.

All the solutions of the Human Health and Diseases topic provided by Embibe are framed based on the latest syllabus. Students can practice the questions for at Embibe and score maximum marks in the final exams. Embibe also provides NCERT 3D Videos, NCERT Exemplars, Embibe Explainers, etc., for.

Below-mentioned are the list of important topics from Class 12 Biology chapter 8 Human Health and Diseases.

NCERT Solutions for Class 12 Biology Chapter 8: Points to Remember

Students can find the important points to be remembered related to the Human Health and Diseases chapter as mentioned below.

• Health: Health is not just the absence of disease, but is a state of complete physical, mental, social and psychological well-being.
• Disease: Diseases like typhoid, cholera, pneumonia, fungal infections of skin, malaria and many others are a major cause of distress to human beings
• Infectious Diseases: (i) Vector-borne diseases like malaria, especially the malignant malaria caused by Plasmodium falciparum, if not treated, may prove fatal (ii) Besides personal cleanliness and hygiene, public health measures like proper disposal of waste, decontamination of drinking water, control of vectors like mosquitoes and immunisation are very helpful in preventing these diseases.
•  Immune System: Our immune system plays a major role in preventing the diseases when we are exposed to pathogens.
•  AIDS : (i) AIDS caused by the Human Immunodeficiency Virus (HIV) is fatal but can be prevented if certain precautions are taken. (ii) HIV infects the helper T-lymphocyte (TH) that bears the CD4 receptor site
• Cancer: (i) All cancers are characterised by the uncontrolled growth and division of cells. (ii) The malignant tumours grow very rapidly, invading and damaging the surrounding normal tissues. (iii) The spread of cancerous cells to distant sites is termed metastasis. (iv) Many cancers are curable if detected early and appropriate therapeutic measures are taken

NCERT Solutions for Class 12 Biology: All Chapters

Students can find the detailed NCERT Class 12 Biology solutions for all chapters as provided below for your reference:

• Chapter 1 – Reproduction in Organisms
• Chapter 2 – Sexual Reproduction in Flowering Plants
• Chapter 3 – Human Reproduction
• Chapter 4 – Reproductive Health
• Chapter 5 – Principles of Inheritance and Variation
• Chapter 6 – Molecular Basis of Inheritance in Genetics
• C hapter 7 – Evolution
• Chapter 9 – Strategies for Enhancement in Food Production
• Chapter 10 – Microbes in Human Welfare
• Chapter 11 – Biotechnology Principles and Processes
• Chapter 12 – Biotechnology and Its Applications
• Chapter 13 – Organisms and Populations
• Chapter 14 – Ecosystem
• Chapter 15 – Biodiversity and Conservation
• Chapter 16 – Environmental Issues
• Chapter 17 – Breathing and Exchange of Gases

Ans. NCERT Solutions for Class 12 Biology Chapter 8 are prepared by the top academic experts at Embibe as per the CBSE guidelines. You can download the same from here.

Ans. The major types of cancer are carcinoma, sarcoma, melanoma, lymphoma, and leukaemia. Carcinomas — the most commonly diagnosed cancers — originate in the skin, lungs, breasts, pancreas, and other organs and glands.

Ans. A list of all the exercises of NCERT Solutions for Class 12 Biology Chapter 8 PDF is given below: Common Diseases In Humans, Immunity, AIDS, Cancer and Drug and Alcohol Abuse.

Ans. NCERT Solutions for Class 12 Biology (All Chapters), can be downloaded from this page of Embibe.

Ans. The ability of our body to fight disease-causing organisms, conferred by the immune system, is called immunity. There are two types of immunity, viz. innate immunity and acquired immunity.

Related Articles

NCERT Solutions for Class 7 Science Chapter 16 Water – A Precious Resource: In this chapter, students will study about the importance of water. There are three...

NCERT Solutions for Class 7 Science Chapter 17 Forests Our Lifeline: Science is one of the main subjects included in the Class 7 curriculum. And...

NCERT Solutions for Class 7 Science Chapter 18: Wastewater Story: The 18th chapter of Class 7 Science is Wastewater Story. Top academic experts have prepared...

NCERT Solutions for Class 7 Science Chapter 10 Respiration in Organisms: NCERT solutions are great study resources that help students solve all the questions associated...

Class 8 Maths Chapter 10 Exercise 10.3: Chapter 10 of Class 8 Maths covers the concept of visualizing solid shapes. Detailed step-by-step solutions for all...

NCERT Exercise 14.1 Class 8 Maths Solutions: NCERT solutions for Class 8 Maths chapter 14 exercise 14.1 - Factorisation provides answers to all of the chapter's...

NCERT Solutions for Class 6 2023-24: CBSE and many state education boards prescribe the NCERT curriculum for classes 1 to 12. The syllabus is curated to...

CBSE Class 10 Social Science NCERT Solutions: CBSE Class 10 exam is the gateway to higher education and students' career. Therefore, acing the board exam...

NCERT Solutions for Class 10 Science Chapter 9: The ninth chapter of CBSE Class 10 Science is Heredity and Evolution. In this chapter, students will...

NCERT Solutions for Class 11 Chemistry Chapter 5 States of Matter: The fifth chapter of NCERT Chemistry for Class 11 is about the States of...

NCERT Solutions for Class 12 Maths Chapter 2 Inverse Trigonometric Functions

NCERT Solutions for Class 12 Maths Chapter 2 Inverse Trigonometric Functions: Students might already have some basic idea about Trigonometric from their previous classes. In...

NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance: The sixth chapter of NCERT Solutions for Biology is Molecular Basis of Inheritance...

NCERT Solutions for Class 12 Maths Chapter 9 Differential Equations

NCERT Solutions for Class 12 Maths Chapter 9 Differential Equations: A differential equation is a mathematical expression that connects one or more unknown functions and their...

NCERT Solutions for Class 12 Chemistry Chapter 10 Haloalkanes and Haloarenes

NCERT Solutions for Class 12 Chemistry Chapter 10: Haloalkanes and Haloarenes is an important chapter in Class 12 Chemistry. The in-text questions from this chapter that are...

NCERT Solutions for Class 12 Maths Chapter 8 Application of Integrals

NCERT Solutions for Class 12 Maths Chapter 8 Application of Integrals: The application of integrals are used in the construction of buildings or for determining...

NCERT Solutions for Class 12 Physics Chapter 9: Ray Optics and Optical Instruments

NCERT Solutions for Class 12 Physics Chapter 9 Ray Optics and Optical Instruments: The NCERT solutions for Class 12 Physics Chapter 9 provided by Embibe is...

NCERT Solutions for Class 12 Chemistry Chapter 8: D and F Block Elements

NCERT Solutions for Class 12 Chemistry Chapter 8 The D and F Block Elements: In this article, we will provide NCERT Solutions for Class 12...

NCERT Solutions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

NCERT Solutions for Class 12 Biology Chapter 12: Chapter 12 of Class 12 Biology deals with Biotechnology and Its Applications. These NCERT Solutions are designed as...

NCERT Solutions for Class 12 Chemistry Chapter 11 Alcohols, Phenols and Ethers

NCERT Solutions for Class 12 Chemistry Chapter 11: The chapter 11 of Chemistry Class 12 is Alcohols, Phenols and Ethers. These NCERT Solutions are prepared...

NCERT Solutions for Class 12 Chemistry Chapter 14 Biomolecules

NCERT Solutions for Class 12 Chemistry Chapter 14 Biomolecules: The fourteenth chapter in Class 12 NCERT Solutions for Chemistry is Biomolecules. The NCERT Solutions are...

NCERT Solutions for Class 12 Maths Chapter 12 Linear Programming

NCERT Solutions for Class 12 Maths Chapter 12 Linear Programming: Chapter 12 of CBSE Class 12 Maths covers the important concepts of Linear Programming. Students must...

NCERT Solutions for Class 9 Maths Chapter 5 Introduction to Euclid’s Geometry

NCERT Solutions for Class 9 Maths Chapter 5: NCERT Maths textbook for Class 9 has 15 chapters. Chapter 5 Euclid's Geometry includes some NCERT questions that...

NCERT Solutions for Class 9 Science Chapter 9

NCERT Solutions for Class 9 Science Chapter 9: NCERT Solutions for Class 9 Science Chapter 9 forms an important part of the Class 9 Science...

NCERT Solutions for Class 9 Science 2024: Chapter 10; Gravitation

NCERT Solutions for Class 9 Science Chapter 10 Gravitation: Class 10 Science deals with Gravitation, which is an important topic. The chapter focuses on giving...

NCERT Solutions for Class 9 Maths Chapter 1 Number Systems

NCERT Solutions for Class 9 Maths Chapter 1 Number Systems: NCERT Solutions for Class 9 maths chapter 1 number systems begin with an introduction to...

NCERT Solutions for Class 9 Maths Chapter 2 Polynomials

NCERT Solutions for Class 9 Maths Chapter 2 Polynomials: The chapter Polynomials is an important chapter in CBSE Class 9. Every student must cover this...

NCERT Solutions for Class 12 Physics Chapter 15 Communication System

NCERT Solutions for Class 12 Physics Chapter 15 Communication System: The NCERT Class 12 Physics Chapter 15 deals with various aspects of the Communication System....

39 Insightful Publications

Embibe Is A Global Innovator

Innovator Of The Year Education Forever

Interpretable And Explainable AI

Revolutionizing Education Forever

Best AI Platform For Education

Enabling Teachers Everywhere

Decoding Performance

Leading AI Powered Learning Solution Provider

Auto Generation Of Tests

Disrupting Education In India

Problem Sequencing Using DKT

Help Students Ace India's Toughest Exams

Best Education AI Platform

Unlocking AI Through Saas

Fixing Student’s Behaviour With Data Analytics

Leveraging Intelligence To Deliver Results

Brave New World Of Applied AI

You Can Score Higher

Harnessing AI In Education

Personalized Ed-tech With AI

Exciting AI Platform, Personalizing Education

Disruptor Award For Maximum Business Impact

Top 20 AI Influencers In India

Proud Owner Of 9 Patents

Innovation in AR/VR/MR

Best Animated Frames Award 2024

Trending Searches

Previous year question papers, sample papers.

Reduce Silly Mistakes? Practice Unlimited Class 12 NCERT Biology Questions With Hints & Solutions

Practice Unlimited Class 12 NCERT Biology Questions With Hints & Solutions

Enter mobile number.

By signing up, you agree to our Privacy Policy and Terms & Conditions

NCERT Solutions for Class 6, 7, 8, 9, 10, 11 and 12

Human Health and Disease Class 12 Important Questions and Answers Biology Chapter 8

July 29, 2022 by Bhagya

We have given these  Class 12 Biology Important Questions Chapter 8 Human Health and Disease to solve different types of questions in the exam. Go through these Class 12 Biology Chapter 8 Important Questions, Human Health and Disease Important Questions & Previous Year Questions to score good marks in the board examination.

Class 12 Biology Chapter 8 Important Questions Human Health and Disease

Question 1. State the functions of mast cells in allergy response. (All India 2019) Answer: The function of mast cell is allergy response is that it releases histamin which cause inflammatory reactions in the body.

Question 2. State the function of interferons. (All India 2019) Answer: Interferons protect non-infected cells from the other viral infected cells by releasing cytokine barriers.

Question 3. How do monocytes act as a cellular barrier in humans to provide innate immunity? (2018) Answer: Monocytes phagocytose and destroy microbes present in the blood to provide innate immunity.

Question 4. How do cytokine barriers provide immunity in humans? (2018) Answer: Cytokine barriers include interferons, which are secreted by virus infected cells. They provide protection to non-infected cells from further same viral infection.

Question 5. Name two diseases whose spread can be controlled by the eradication of Aedes mosquito. (2018) Answer: Dengue fever and chikungunya are two diseases, whose spread can be controlled by the eradication of Aedes mosquito.

Question 6. Suggest a method to ensure an anamnestic response in humans. (Delhi 2017) Answer: Anamnestic response is the quick and intense response, which occurs when an individual encounters a particular antigen for the second time. It is aided by the memory of primary response stored in B-cells. By the administration of a dead or attenuated pathogen in the body of person, a secondary immune response can be ensured due to the presence of memory cells in the body.

Question 7. Retroviruses have no DNA. However, the DNA of the infected host cell does possess viral DNA. How is it possible? (All India 2015) Answer: Retroviruses have RNA as their genetic material. After getting into the body of a person, the virus enters the macrophages. Here, RNA is replicated to form viral DNA by using enzyme reverse transcriptase. The viral DNA now, gets incorporated into the host cell’s DNA and directs the infected cells to produce viruses.

Question 8. Indiscriminate diagnostic practices using X-rays, etc., should be avoided. Give one reason. (Delhi 2015) Answer: Indiscriminate diagnostic practices using X-rays should be avoided, because there are several potential risks from exposure to ionising radiations, e.g. cancer can be developed in later stages of life, various tissues can also get affected leading to cataract, hair loss, etc.

Question 9. In what way is monocyte a cellular barrier with reference to immunity? (Delhi 2015) Or Name any two types of .cells that act as ‘cellular barriers’ to provide innate immunity in humans. (Delhi 2014) Answer: Cellular barriers include certain types of leucocytes of our body such as polymorphonuclear leucocytes, monocytes and natural killer in the blood as well as macrophages in tissues. These can phagocytose and destroy microbes and provide innate immunity to humans.

Question 10. How do cytokinin barriers help in evading viral infections? (Delhi 2015) Or How do interferons protect us? (All India 2012) Answer: Cytokinins are virus infected cells, which secrete proteins called interferons. They protect non-infected cells from further viral infection by inhibiting their replication and making cell resistant to further infection.

Question 11. Why is Gambusia introduced into drains and ponds? (All India 2014) Answer: Gambusia is a fish that feed upon mosquito larvae. Thus, it is introduced in drains and ponds to destroy disease vectors.

Question 12. Why is secondary immune response more intense than the primary immune response in humans? (All India 2014) Or When does a human body elicit an anamnestic response? (All India 2013; Delhi 2011C) Answer: The secondary or anamnestic immune response is based on the memory of primary response, i.e. first encounter with an antigen. Due to this, the second generated immune response is more fast and have higher affinity for antigen and therefore, it is more intense than primary immune response in humans.

Question 13. How does haemozoin affect the human body when released in blood during malarial infection? (Foreign 2014) Answer: The release of toxic haemozoin by the ruptured RBCs during malarial infection results in recurrence of high fever and chill every 3-4 days.

Question 14. What is an autoimmune disease? Give an example. (Foreign 2014) Answer: The abnormal response of an immune system, in which it fails to recognise ‘self’ and ‘non-self’ and starts destroying its own cells and molecules is called autoimmune disease. Rheumatoid arthritis is an example of autoimmune disease, which destroys articular cartilage and fusing bones.

Question 15. Why sharing of injection needles between two individuals is not recommended? (Delhi 2013) Answer: Sharing of injection needles may act as a mode of transmission of certain diseases including AIDS. Thus, it is not recommended.

Question 16. State two different roles of spleen in the human body? (All India 2012) Answer: The two different roles of spleen in human body are

• Spleen acts as a filter to trap blood-borne microorganisms.
• It is a large reservoir of erythrocytes.

Question 17. Why do pollen grains of some flower trigger sneezing in some people? (Foreign 2012) Answer: Pollen grains are allergens that cause allergy in some people due to release of chemicals like histamine and serotonin from mast cells. These trigger the inflammatory responses in body, e.g. sneezing, wheezing, etc.

Question 18. What is it that prevents a child to suffer from a disease he/she is vaccinated against? Give one reason. (Delhi 2010) Answer: Due to vaccination body produces antibodies in large numbers. It protects the child by neutralising the pathogenic agents during infection. The vaccine also generates memory B-cells and T-cells that can recognise pathogens on subsequent exposure and produce intense immune response.

Question 19. How does malaria differ from chikungunya with reference to their vectors? (All India 2010C) Answer: Malaria is spread by female Anopheles mosquito, whereas chikungunya is spread by female Aedes mosquito.

Question 20. Malaria, typhoid, pneumonia and amoebiasis are some of the human infectious diseases. Which one of these is transmitted through mechanical carriers? (Foreign 2010) Answer: Amoebiasis is transmitted through mechanical carrier, i.e. houseflies.

Question 21. Differentiate between the roles of B-lymphocytes and T-lymphocytes in generating immune responses. (Delhi 2019) Answer: For B and T-lymphocytes, Refer to page no. 210.

Question 22. Principle of vaccination is based on the property of ‘memory’ of the immune system. Taking one suitable example, justify the statement. (Delhi 2019) Answer: For vaccination, Refer to page no. 211.

Question 23. Why is the structure of an antibody molecule represented as HgLa ? Name any two types of antibodies produced in a human body. (2018C) Answer: For structure of antibody molecule. Refer to page no. 210-211.

Question 24. Mention one application for each of the following (i) Passive immunisation (ii) Antihistamine (iii) Colostrum (iv) Cytokinin-barrier (All India 2017) Answer: Applications of given components are as follows (i) Passive immunisation provides a faster immune response. (ii) Antihistamine is used to reduce the symptoms of allergy, such as sneezing, watery eyes, rashes, running nose, etc. (iii) Colostrum consists of antibodies (e.g. IgA) that provide immunity to an infant against infections. (iv) Cytokinin barrier produces interferons and protects non-infected cells from further viral infection.

Question 25. Name the cells HIV (Human Immunodeficiency Virus) gains entry into after infecting the human body. Explain the events that occur in these cells. (All India 2016) Or How do macrophages in the human body act as HIV factory? (All India 2010) Or Name the cells that act as HIV factory in humans when infected by HIV. Explain the events that occur in the infected cell. Answer: After infecting the human body, the HIV gains entry into macrophages. Events occurring in these cells are as follows

• RNA genome of the virus replicates to form viral DNA by enzyme reverse transcriptase.
• Viral DNA gets incorporated into the macrophage DNA and directs the infected cells to produce new viruses.
• Macrophages continue to produce virus particles and thus called HTV factory.

Question 26. Name the causative organism of the disease amoebiasis. List three symptoms of the disease. (All India 2016) Or (i) Name the protozoan parasite that causes amoebic dysentery in humans. (ii) Mention two diagnostic symptoms of the disease. (iii) How is this disease transmitted to others? (All India 2016, Delhi 2012) Answer: The disease amoebic dysentery or amoebiasis is caused by an intestinal parasite, Entamoeba histolytica, which is found in the large intestine of human. Transmitting agent is housefly, which acts as mechanical carrier. It transmits the parasite from faeces of infected person to the food. Symptoms include constipation, abdominal pain and cramps, stools with excess mucous and blood clots.

Question 27. (i) Name any two causative organisms responsible for ringworm. (ii) State any two symptoms of the disease. (Delhi 2016C) Answer: (i) Causative organisms responsible for ringworm are Microsporum, Epidermophyton and Trichophyton (all fungi).

(ii) Two symptoms of the disease are

• Intense itching
• Appearance of dry, scaly lesions on various body parts.

Question 28. (i) Name any two helminths which are known pathogenic to human. (ii) List any two symptoms of the diseases caused by any one of them. (Delhi 2016) Or List the symptoms of ascariasis. How does a healthy person acquire this infection? (All India 2014) Answer: (i) Helminths worms, which pathogenic to human are

• Ascaris, the roundworm.
• Wuchereria, the filarial worm.

(ii) Ascaris is an intestinal parasite that causes ascariasis. Symptoms of ascariasis are internal bleeding, muscular pain, fever, anaemia and blockage in intestinal passage. A healthy person acquires this infection through consumption of water, vegetables or fruits contaminated with the eggs of parasite Ascaris.

Question 29. Name any two secondary lymphoid organs in a human body and state the function of any of them. (Delhi 2016) Answer: Secondary lymphoid organs provide the site for interaction of lymphocytes with the antigen, which then proliferate to become effector cells, e.g. spleen, tonsils and lymph nodes. Lymph nodes help to trap antigens entering the tissue fluid, whereas spleen trap the blood-borne microbes.

Question 30. How are oncogenic viruses different from proto-oncogenes? Answer: Oncogenic viruses The cancer causing viruses which have viral genes or oncogenes are called, oncogenic viruses. Proto-oncogenes These genes are present in normal cells, which when activated under certain conditions could lead to oncogenic transformation of the cells, thus leading to cancer.

Question 31. (i) Which organ of the human body is initially affected when bitten by an infected female Anopheles! Name the stage of the parasite that infects this organ. (ii) Explain the events that are responsible for chill and high fever in the patient. (Delhi 2016C) Answer: (i) Liver is initially affected by the sporozoites stage dud to the bite of female Anopheles. (ii) Rupture of RBC and release of haemozoin is responsible for chill and high fever.

Question 32. Name an allergen and write the response of human body when exposed to it. (Delhi 2014C) Answer: The allergen can be pollen grains, spores or dust particles. When the allergens are inhaled or enter body system, they stimulate body to produce IgE antibodies and trigger an antiallergic reaction. The chemicals such as histamine and serotonin are released from mast cells in response to allergen, thereby causing dilation of blood vessels. These chemicals also elicit inflammatory response that may result in sneezing, watery eyes, running nose, etc.

Question 33. Differentiate between active and passive immunity. (Delhi 2014C) Answer: Differences between active and passive immunity are as follows

Question 34. How does a vaccine for a particular disease immunise the human body against that disease? (Delhi 2013C) Answer: During vaccination for a particular disease, an antigen or antigenic protein or weak pathogen, which is in inactive form is introduced into the body to induce mild immune response.

The vaccine generates antibodies that neutralises the toxin/pathogen and produces memory-B or T-cells, which recognise the pathogen in the subsequent encounters and produce antibodies.

Question 35. Why is a person with cuts and bruises following an accident administered tetanus antitoxin? Give reasons. (All India 2013) Or Why does a doctor administer tetanus antitoxin and not a tetanus vaccine to a child injured in a roadside accident with a bleeding wound? All India 2010 Answer: A person with cuts and bruises following an accident is administered tetanus antitoxin, because this toxin contains performed antibodies against the pathogen Clostridium tetani. This inactivates the pathogen and provide passive immunity. Also, tetanus antitoxin provide instant response unlike tetanus vaccine, which take time to develop immunity.

Question 36. A patient showed symptoms of sustained high fever, stomach pain and constipation, but no blood clot in stools. Name the disease and its pathogen. Write the diagnostic test for the disease. How does the disease get transmitted? (Delhi 2013C) Answer: The symptoms, such as constant high fever, stomach pain and constipation, weakness and headache are shown in typhoid. Its causative’agent is a bacterium called Salmonella typhi. Widal test is used for its diagnosis. Typhoid is transmitted through contaminated food and water.

Question 37. A student on a school picnic to a park on a windy day started sneezing and having difficulty in breathing on reaching the park. The teacher enquired whether the student was allergic to something. (i) What is an allergy? (ii) Write the two unique characteristics of the system involved in the response observed in the student. (Delhi 2013) Answer: (i) Allergy is a hypersensitive response to a foreign substance coming in contact with or entering the body, e.g, sneezing, watery eyes, etc. (ii) It is due to the release of histamine and serotonin by the mast cells.

Question 38. A young boy when brought a pet dog home started to complain of watery eyes and running nose. The symptoms disappeared when the boy was kept away from the pet. (i) Name the type of antibody and the chemicals responsible for such a response in the boy. (ii) Mention the name of any one drug that could be given to the boy for immediate relief from such a response. (Delhi 2013) Answer: (i) In case of allergy, IgE antibodies are involved. Histamine and serotonin are responsible for such responses. (ii) Antihistamine could be given for immediate relief.

Question 39. (i) Highlight the role of thymus as a lymphoid organs. (ii) Name the cells that are released from the above mentioned gland. Mention, how they help in immunity? (Delhi 2012) Answer: (i) Thymus is a primary lymphoid organs of the immune system. Here, immature lymphocytes get differentiated into antigen-sensitive T-lymphocytes. (ii) T-lymphocytes are released from thymus, after their maturation get completed. They themselves do not produce antibodies, but help B-cells to produce them. They are also responsible for Cell Mediated Immune (CMI) response.

Question 40. Name the parasite that causes filariasis in humans. Mention its two diagnostic symptoms. How is this transmitted to others? (Delhi 2012) Answer: Wuchereria (W. bancrofti and W. malayi) is the filarial worm that causes filariasis in humans. Diagnostic Symptoms

• The presence of nematodes in lymph vessels causes collection of fluid. It may lead, to swelling in arms, breasts, legs and genital region.
• Inflammation of lower limbs result in deformities. It is transmitted to a healthy person through the bite of the female mosquito vector, Culex.

Question 41. Name and explain the two types of immune responses in humans. (All India 2012) Answer: Immune responses are of two types

• Primary response The reaction of the body’s immune system to the first attack of microbe (antigen) is called primary immune response. It is slow and less intense.
• Secondary response The reaction of the body’s immune system to any subsequent infection of the same microbe is termed as secondary immune response. It is fast and intense.

Question 42. Name the two special types of lymphocytes in humans. How do they differ in their roles in immune response? (All India 2012) Answer: Two special types of lymphocytes in humans are

• B-lymphocytes or B-cells
• T-lymphocytes or T-cells

Differences between B and T-lymphocytes are as follows

Question 43. (i) Name the group of virus responsible for causing AIDS in humans. Why are these virus so, named? (ii) List any two ways of transmission of HIV infection in humans other than sexual contact? All India 2012 Answer: (i) Retrovirus is the group of viruses causing AIDS in humans. They contain RNA as genetic material and with the help of enzyme reverse transcriptase, they make viral DNA using RNA as a template. Thus, they are called retrovirus.

(ii) (a) By sharing infected needles. (b) By transfusion of blood contaminated with HIV.

Question 44. Why is an antibody represented as H 2 L 2 ? (Foreign 2012) Answer: Antibody is represented as H2I2 because each antibody molecule has four peptide chains, i.e. two small light (L) chains and two longer heavy (H) chains.

Question 45. Name the different types of cell providing cellular barrier responsible for innate immunity in humans. (Foreign 2012) Answer: For cellular barrier as innate immunity, Refer to page no. 209.

Question 46. List any two emergent circumstances, when a medical doctor would recommend injection of a preformed antibody into the body of a patient and why? (Delhi 2011C) Answer: In case of snake bite and in tetanus infection. Preformed antibodies help in providing quick immune response.

Question 47. List the two types of immunity a human baby inborn with. Explain the differences between the two types. (All India 2011) Answer: Two types of immunity with which human baby is born include.

• Innate immunity It is inherited type of immunity and it protects an organism from birth throughout the life. It is not specific to particular pathogen and consists of four types of barriers namely physical, physiological, cellular and cytokine.
• Natural passive immunity It is passively transferred from mother to foetus through placenta, e.g. IgG antibodies can cross placental barrier to reach the foetus.

Question 48. How is an allergic reaction caused by an allergen? Name the drug that can reduce the symptoms of allergy? (All India 2011C) Answer: An allergic reaction is caused by allergens as these can produce IgE type of antibodies. These antibodies causes the release of histamine and serotonin like chemicals from mast cells, which cause allergic reactions. The use of drugs like antihistamine, adrenaline and steroids quickly reduce the symptoms of allergy.

Question 49. Name the two types of immunity in a human body. Why are cell-mediated and humoral immunities so called? (Delhi 2011) Answer: Types of immunity system in humans are

• Innate immunity and acquired immunity are two main types of immunities in human body.
• Cells mediated immunity is so called as it is mediated by specialised cells, the T-lymphocytes that recognise self and non-self cells. Humoral immunity is so called because it is mediated by antibodies, which are found circulating in body fluid (humor) e.g. blood.

Question 50. Write the scientific names of the causal organisms of elephantiasis and ringworm in humans. Mention the body parts affected by them. (Delhi 2011) Answer:

• Elephantiasis is caused by Wuchereria bancrofti and W. malayi. These affect lower limbs and genital organs.
• Ringworm is caused by Microsporum, Trichophyton and Epidermophyton. They affect the skin, nails and scalp.

Question 52. Name the host and the site, where the following occur in the life cycle of a malarial parasite. (i) Formation of gametocytes. (ii) Fusion of gametocytes. (Delhi 2010) Answer: (i) Formation of gametocytes occurs in the erythrocytes (RBCs) of human beings. (ii) Fusion of gametocytes occurs in the intestine of mosquito.

Question 53. Define the term health. Mention any two ways of maintaining it. (All India 2010) Answer: Health can be defined as a state of complete physical, mental and social well-being. It can be maintained by taking balanced diet, maintaining personal hygiene, regular exercise/yoga, vaccination against infectious diseases, etc. (1+1)

Question 54. Identify A, B, C and D in the following table. (Foreign 2010)

Answer: A – Small intestine B – Rhinovirus C – Nose, respiratory passage D- Alveoli of lungs.

Question 55. The barriers in the innate immunity are given in the following table. Identify A, B, C and D. (Delhi 2010C)

Answer: A-Epithelium lining B-Tears C-Cytokinin D-Polymorphonuclear leucocytes.

Question 56. (i) How does a vaccine affect immunity? (ii) How can we get immunisation against tetanus? (All India 2010) Answer: (i) In vaccination, a preparation of antigenic proteins of pathogen or inactivated/ weakened pathogen (vaccine) are introduced into the body. The antibodies produced in the body against these antigens would neutralise the pathogenic agents during actual infection. The vaccines also generate memory-B and T-cells. (ii) Preformed antibodies for tetanus are directly injected to acquire quick immune response. This is called passive immunisation against tetanus.

Question 57. Why do normal cells not show cancerous growth? (All India 2010) Answer: Normal cells do not show cancerous growth as

• Their growth and division are regulated by certain regulatory mechanisms.
• They show the property of contact inhibition, by virtue of which contact with other cells inhibit their uncontrolled growth.

Question 58. State the effect of carcinogens on human body. Name the carcinogenic ionising and non-ionising radiations. Mention their carcinogenic effects. (All India 2010C) Answer: Carcinogens can transform normal cell into cancerous cells. Carcinogenic ionising radiations are X-rays and gamma rays. Carcinogenic non-ionising radiations are UV-rays. These radiations cause changes in base sequences, i.e. mutations that lead to transformation of normal cells into cancerous cell.

Question 59. (i) Explain the property that prevents normal cells from becoming cancerous. (ii) All normal cells have inherent characteristic of becoming cancerous. Explain. Answer: (i) For concerous cells Refer to Answer No. 57. (ii) All normal cells have ceUular oncogenes (c-onc) or proto-oncogenes. When activated under certain conditions, such genes could lead to oncogenic transformation of cells, i.e. they may become cancerous.

Question 60. Name a human disease, its causal organism, symptoms (any three) and vector spread by intake of water and food contaminated by human faecal matter. (All India 2017) Or A patient is down with amoebiasis. List the symptoms that confirm this infection. Name the causative pathogen. (Delhi 2015c) Answer: Amoebiasis is a disease spread by intake of water and food contaminated by human faecal matter. Causal organism Entamoeba histolytica. Symptoms

• Abdominal pain
• Constipation with cramps
• Faeces with excess mucus Vector or carrier of pathogen is housefly.

Question 61. (i) What precaution(s) would you recommend to a patient requiring repeated blood transfusion? (ii) If the advise is not followed by the patient there is an apprehension that the patient might contract a disease that would destroy the immune system of his/her body. Explain with the help of schematic diagram only how the immune system would get affected and destroyed. (Delhi 2017) Answer: (i) Repeated blood transfusion may result in contracting diseases like AIDS. The recipient must ensure that the donor’s blood is being screened for HIV and other pathogens. Also, he should make sure that doctors are using fresh needles.

Question 62. (i) It is generally observed that the children who had suffered from chickenpox in their childhood may not contract the same disease in their adulthood. Explain giving reasons the basis of such an immunity in an individual. Name this kind of immunity. (ii) What are interferons? Mention their role. (Foreign 2016) Answer: (i) A child who had suffered from chickenpox in childhood may not contract disease in his/her adulthood. It is because during the first encounter with pathogen (chickenpox) specific antibodies (by humoral immune response) are produced to counter the attack. During this attack, memory cells are also produced. Due to this, on subsequent exposure to the same pathogen, the immune response is more rapid and intense. That is why, second exposure to the chickenpox does not cause disease. It is known as acquired immunity of the body.

(ii) Interferons are special kind of proteins secreted by virus infected cells. These protect the healthy cells from the virus attacks.

Question 63. Certain attributes of innate immunity are given in the table below. Identify A, B, C, D, E and F respectively in it. (Delhi 2016C)

Answer: (i) A – Physiological barriers B – Lysozyme in saliva

(ii) C – Cellular barriers D – Fhagocytose and destroy microbes

(iii) E – Interferons F – Prevention of viral infections

Question 64. State the three characteristics of acquired immunity. List the different ways by which it can be attained by humans. (Delhi 2016C) Answer: The characteristics of acquired immunity are

• It is pathogen specific.
• It is characterised by memory.
• Responses can be characterised as a primary response (of low intensity) and secondary response.

Acquired immunity can be attained by humans in the following ways

• Active immunity The antibodies are produced in the host body as a response to foreign entitities, i.e. on living microbes or other proteins. The onset of response is slow.
• Passive immunity The readymade antibodies are directly introduced to protect the body against foreign agents.

Question 65. How are primary and secondary immune responses carried out in the human body? Explain. (Delhi 2016C) Answer: The primary response is the first response of immune system to a newly introduced foreign agent, while a second intensified immune response to same foreign agent is the secondary or anamnestic response. Immune responses are produced by two types of lymphocytes

• B-Iymphocytes These produce an army of proteins in response to pathogens, i.e. antibodies in the blood. The different types of antibodies secreted are IgA, IgM, IgE and IgG. This response generated via antibodies of the immune system is also called the humoral immune response.
• T-lymphocytes are the mediators of the cell-mediated immunity (CMI). The cell-mediated immune response is responsible for the graft rejection.

Question 66. (i) HIV and Hepatitis-B are STDs. Mention the two other ways by which they can be transmitted to a healthy person. (ii) Why is early detection of STD essential? What can it lead to otherwise? Explain. (Delhi 2016C) Answer: (i) STDs like AIDS and hepatitis-B can be transmitted to a healthy person in the following ways

• Unsafe blood transfusion.
• From infected mother to foetus throught lactation.

(ii) Early detection of STD is essential for timely cure. Otherwise this can lead to Pelvic Inflammatory Diseases (PIDs), abortions or even cancer of the reproductive tract. (IVi)

Question 67. A youth in his twenties met with an accident and succumbed to the injuries. His parents agreed to donate his organs. List any two essential clinical steps to be undertaken before any organ transplant. Why is the transplant rejected sometimes? What views would you share with your health club members to promote organ donation? (Delhi 2015C) Answer: Organ transplantation involves the removal of damaged/injured tissues or organs from the body of a person and their substitution by similar tissues/organs from a donor. Tissue matching, blood group matching are essential clinical steps before undertaking any graft/transplant. Transplantation may result in the rejection of transplanted organs as the immune system recognises the protein in the transplanted tissue or organs as foreign and initiates cellular immunity. We should raise and promote awareness about organ donation, about need of organ and tissue donors. There are lakhs of people waiting for organ donation and many people die daily while waiting for transplant. Organs and tissues from one donor can save upto 40-50% lives. So, we should encourage and get registered for organ donation to save many lives.

Question 68. (i) State what happens in the human body when malarial parasites infected RBCs burst to release the parasites in the blood. (ii) Mention the specific sites in the host body, where production of (a) sporzoites and (b) gametocytes takes place in the life cycle of the malarial parasites. (Delhi 2015C) Answer: (i) When the RBCs infected with malarial parasites burst open, they release a toxic substance called haemozoin, which is responsible for the chill and high fever recurring every three to four days. (ii) (a) Sporozoites They are produced in the gut (inside oocyte on the surface of stomach) of the female Anopheles mosquitoes. (b) Gametocytes RBCs of human body.

Question 69. What is the functional difference between B-and T-cells. (Delhi 2015) Answer: B-and T-cells are lymphocytes involved in immune responses generated by the host’s body. Functional differences between B- Cells and T-Cells are as follows

Question 70. Mention any two human diseases caused by round worms. Name their causative agents and their mode of transmission into the human body. (All India 2015C) Answer: Roundworms are nematodes, that cause helminthic disease in humans. Two human diseases caused by roundworms are

• Ascariasis It is caused by intestinal endoparasite of humans, Ascaris lumbricoides. Infection occurs through contaminated vegetables, fruits and water.
• Filariasis It is caused by filarial worms, Wuchereria bancrofti and W. malayi. It is transmitted by the bite of female Culex mosquito.

Question 71. At what stage is Plasmodium picked up by the female Anopheles? Describe the life cycle of the parasite in this insect. (Delhi 2015C) Answer: Female Anopheles pick up Plasmodium at gametocyte stage from human body. Inside mosquito’s body, the gametocytes develop to form male and female gametes. These gametes fuse and form zygote, which further divides to form many sporozoites in the intestine of mosquito. These sporozoites later move into salivary glands. See text on page no. 206.

Question 72. (i) Differentiate between benign and malignant tumours. (ii) Why is colostrum a boon to the newborn baby? (Delhi 2015C) Answer: (i) Differences between benign and malignant tumours are as follows

(ii) The milk produced during the initial few days of lactation is called colostrum, which contains IgA antibodies. These are essential to develop resistance in newborn babies as they provide passive immunity. Thus, breast- feeding during the initial period of infant growth is recommended by doctors for bringing up a healthy baby.

Question 73. A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave him an injection to protect him against a deadly disease. (i) Write what did the doctor inject into the patient’s body? (ii) How do you think this injection would protect the patient against the disease? (iii) Name the disease against which this injection was given and the kind of immunity it provides. (All India 2015) Answer: (i) The doctor must have injected the tetanus vaccine into the patient. (ii) The vaccine injection stimulates the body to make antibodies against the tetanus toxin. (iii) The disease is tetanus, which is caused by bacterium Clostridium tetani. It may enter the skin through a cut or puncture wound. Once bacteria is under the skin, it makes a toxin that causes severe and painful muscle spasms, which can even be fatal. The injection provides passive immunity.

Question 74. Community service department of your school plans a visit to a slum near the school with an objective to educate the slum dwellers with respect to health and hygiene, (i) Why is there a need to organise such visits? (ii) Write the steps you will highlight, as a member of this department, in your interactions with them to enable them to lead a healthy life. All Indio 2Q14 Answer: (i) The community service department of schools plans a visit to a slum is educate them about health, hygiene and nutrition. These, people are’always at risk of acquiring infections due to poor hygiene. Therefore, there is always a need to organise visits to slums so, as to educate and create awareness among them regarding the importance of hygiene.

(ii) The points to be highlighted while interacting with the slum people may be:

• Importance of cleanliness and hygiene of body as well as surroundings.
• Awareness and prevention of infectious diseases.
• Use of public facilities, i.e. toiletries.
• Consumption of properly cooked and hygienic food and water.
• Administration of vaccines to newborn children, so as to prevent diseases.

Question 75. (i) Name and explain giving reason, the type of immunity provided to the newborn by the colostrum and vaccinations. (ii) Name the type of antibody (a) present in colostrum. (b) produced in response to allergens in human body. (Foreign 2014) Answer: (i) The immunity provided to the newborn by colostrum and vaccinations is called passive immunity.

This is because both in colostrum and vaccines the antibodies conferred are not produced by own body, but are rather transferred passively to recipient’s body. Such as IgA antibodies pass through milk (colostrum) to infants and provides passive immunity against infection.

(ii) (a) The type of antibody present in colostrum is IgA. (b) IgE is produced in response to allergens in human body.

Question 76. (i) Name the causative organisms for the following diseases (a) Elephantiasis (b) Ringworm (c) Amoebiasis (ii) How can public hygiene help to control such diseases? Delhi 2014c Answer: (i) The causative agents or organisms for the following diseases are: (a) Elephantiasis- Wuchereria bancrofti (b) Ringworm- Microsporum (c) Amoebiasis-Entamoeba histolytica

(ii) Maintenance of public hygiene includes

• keeping body and surroundings clean.
• consumption of clean drinking water, fruits and vegetables, etc.
• proper disposal of waste and excreta.
• regular cleaning and disinfection of tanks and other water reservoirs, etc.
• all the above measures help to control the increase in vectors of infectious diseases and their breeding places. Thus, there would be reduced chances of transmission of infectious diseases.

Question 77. Name the cells HIV attacks first, when it gains entry into a human body. How does this virus replicate further to cause immunodeficiency in the body? (Delhi 2013C, 2010; All India 2D10C) Or Trace the events occur in human body to cause immunodeficiency, when HIV gains entry into the body. (Delhi 2011) Answer: The HIV virus attacks the macrophages first in human body. The further replication of virus causes immuno deficiency in the following way

• RNA is replicated to form viral DNA by the enzyme reverse transcriptase.
• Viral DNA gets incorporated into the host cell’s DNA and directs the infected cells to produce viruses.
• Macrophages continue to produce virus particles and function as HIV factories.
• The virus particles enter helper T-lymphocytes in the blood, where they continue to replicate and produce viral progenies.
• The number of helper T-lymphocytes progressively decreases in the body of the infected person.
• With the decrease in number of T-cells, the immunity also decreases. The person is unable to produce any immune response even against common bacteria like Mycobacterium, parasites like Toxoplasma, viruses and fungi.

Question 81. (i) Name the causative agent of typhoid in humans. (ii) Name the test administered to confirm the disease. (iii) How does the pathogen gain entry into the human body? Write the diagnostic symptoms and mention the body organ that gets affected in severe cases? All India 2011 Answer: (i) Salmonella typhi. (ii) Widal test. (iii) Pathogens enter the human body through contaminated food and water. Diagnostic symptoms high fever, weakness, stomach pain. The body organ affected is small intestine.

Question 82. An antibody molecule is represented as H 2 L 2 . Explain. (Delhi 2010.) Answer: For Antibody H 2 L 2 , Refer to Answer No. 44. Refer to figure 8.2. on page no. 210.

Question 83. (i) All human beings have cellular oncogenes, but only few suffer from cancer disease. Give reasons. (ii) How is a malignant tumour different from a benign tumour? (Foreign 2010) Answer: (i) Ail cells have cellular oncogenes (c-onc) or proto-oncogene, but only few suffer from cancer disease because these genes code for certain growth factors. Under certain conditions, they get activated and lead to oncogenic transformation causing cancer. This transformation is induced by physical, chemical and biological factors called carcinogens.

(ii) For differences between benign and malignant tumours, Refer to Answer No. 72 (i).

Question 84. Under polio prevention programme, infants in India were given polio vaccines on a large scale at regular intervals to eradicate polio from the country. (i) What is a vaccine? Explain, how does it impart immunity to the child against the disease. (ii) With the help of an example each, differentiate between active and passive immunity. (Foreign 2015) Answer: (i) Vaccine is a preparation of inactivated or weakened pathogen of polio virus or protein that is injected into a person to provide protection against disease. Refer to Answer No. 34. (ii) Refer to Answer No. 33.

Question 85. (i) Cancer is one of the most dreaded diseases. Explain ‘contact inhibition’ and ‘metastasis’ with respect to disease. (ii) Name the group of genes that have been identified in normal cells that could lead to cancer. How do these genes cause cancer? (iii) Name any two techniques that are useful in detecting cancers of internal organs. (iv) Why are cancer patients often given a-interferon as part of the treatment? (Delhi 2014) Answer: (i) Contact inhibition is the property exhibited by normal cells. It prevents their uncontrolled proliferation when they are in contact with other neighbouring cells. But cancerous cells seem to have lost this property and continue to divide despite being in contact with other cells, which leads to masses of cells called tumours.

Metastasis is the property exhibited by malignant tumours which grows rapidly, invades neighbouring tissues and is capable of reaching distant sites through blood and lymph thus, spreading malignant tumours to other organs or parts of body. These two properties make ‘cancer’ one of the dreaded diseases.

(ii) The group of genes called cellular oncogenes or proto-oncogenes in normal cells could lead to cancer. These genes are present in inactivated or suppressed form. Some factors, i.e. physical, chemical or biological called carcinogens are capable of activating these oncogenes and thus, transforming normal cells into cancerous one.

(iii) The two techniques useful in detecting cancers of internal organs, are CT (Computed Tomography) and MRI (Magnetic Resonance Imaging).

(iv) As tumour cells are capable of avoiding recognition and destruction by immune system, the cancer patients are given a-interferons, which are biological response modifiers. It helps in activating the immune system and destroy tumours.

Question 86. (i) Name and explain any four lymphoid organs present in humans. (ii) Categorise the named lymphoid organs as primary or secondary lymphoid organs, giving reasons. (Foreign 2014) Answer: (i) The four lymphoid organs are:

• Bone marrow Major lymphoid organs as both B and T-lymphocytes are formed here and p-lymphocytes mature here only.
• Thymus T-lymphocytes mature in thymus and they are responsible for cell mediated iinmupe response.
• Spleen Bean-shaped organ comprising of single mass of lymphoid tissues. In foetal stage, it produces all type of blood cells but only lymphocytes are produced in adult stage.
• Lymph nodes These are small solid structures composed of lymphoid tissue. They produce lymphocytes and plasma cells and also act as filters for lymph.

(ii) The above described lymphoid organs, such as bone marrow and thymus can be grouped under primary lymphoid organs, because these act as organs where both B and T-lymphocytes mature and acquire their antigenic specificity. Whereas the spleen and lymph nodes are considered as secondary lymphoid organs where the lymphocytes undergo proliferation and differentiation. These are the site of acquired immune response to antigens and formation of effector cells.

Question 87. A person in your colony has recently been diagnosed with AIDS. People/residents in the colony want him to leave the colony for the fear of spread of AIDS. (i) Write your view on the situation, giving reasons. (ii) List the possible preventive measures that you would suggest to the residents of your locality in a meeting organised by you so that they understand the situation. (iii) Write the symptoms and the causative agent of AIDS. (All India 2013) Answer: (i) AIDS is not contagious, i.e: it does not spread by shaking hand, talking and use of common utensils. So, there is no need of fear to live with the AIDS patient. (ii) Some preventive and safe steps to be suggested are:

• Taking out HIV affected blood from blood bank, ensuring the use of only disposable needles and syringes in all public and private hospitals and clinics.
• Free distribution of condoms in public.
• Advocating safe sex and promoting regular check-up for HIV in population.

(iii) AIDS is caused by Human Immunodeficiency Virus (HIV), a retrovirus. This virus attacks on T-helper cells, thus destroying the immune system. The common symptoms of AIDS are weakness, fever, weight loss, regular illness, etc.

Question 88. Describe the asexual and sexual phases of life cycle of Plasmodium that causes malaria in humans. (Delhi 2013) Answer: For life cycle of Plasmodium, Refer to page no. 206.

Question 89. Mention the useful as well as the harmful drug obtained from the latex of poppy plant. (Delhi 2013) Answer: Morphine is obtained from latex of poppy plant. It is useful as an analgesic. Heroin formed after acetylation of morphine is harmful as it is a depressant.

Question 90. How does smoking tobacco in human lead to oxygen deficiency in their body? (Delhi 2012) Answer: Smoking increases carbon monoxide (CO) content in blood and reduces the concentration of haem-bound oxygen. This causes oxygen deficiency in the body. (1)

Question 91. (i) Name the source plant of heroin drug. How is it obtained from the plant? (2018C) (ii) Write the effects of heroin on the human body.20ia c Answer: (i) Heroin is obtained from Papaver somniferum. It is extracted from the latex of the plant. (ii) Heroin is a depressant and slows down body function.

Question 92. Why are adolescents especially advised not to smoke? How does smoking affect the functioning of the body? (Outside Delhi 2016C) Answer: Adolescents are advised not to smoke for the following reasons

• Smoking paves way for hard drugs.
• Smoking is associated with increased incidences of cancers of lung, throat and bronchitis and emphysema. It also increases carbon monoxide content in blood and reduces the concentration of haem-bound oxygen.

Question 93. Name two drugs obtained from poppy plant. ‘These drugs are medically useful, but are often abused’. Taking the mentioned examples justify by giving reasons. (Delhi 2016 C) Or How are morphine and heroin related? Mention the effect each one of them has on the human body? (All India 2014C) Answer: Both morphine and heroin are extracted from the latex of plant Papaver somniferum. Heroin is actually obtained by the acetylation of morphine. Thus, both heroine and morphine are related. Morphine acts as an effective sedative and pain-killer while heroin acts as depressant and slows down body functions.

Question 94. What happens to an individual when a regular dose of drugs/alcohol is abruptly discontinued? What characteristics manifest in the individual under such a situation? (Outside Delhi 2016C) Or What is ‘withdrawal syndrome’? List any two symptoms it is characterised by. (Foreign 2014) Answer: If the regular dose of drug or alcohol in an addicted person is discontinued abruptly, the body exhibits characteristic and unpleasant symptoms called ‘withdrawal syndrome’. The ‘withdrawal syndrome’ is characterised by symptoms like anxiety, nausea and excessive sweating.

Question 95. Write the scientific name of the source plant of the drugs-marijuana and hashish and mention their effects on human body. (Delhi 2014C) Or Name the plant source of ganja. How does it affect the body of the abuser? (All Indio 2012) Answer: The scientific name of source plant of drugs marijuana, hashish and ganja is Cannabis sativa. These drugs usually affect the cardiovascular system of human body.

Question 96. Name the plant source of the drug popularly called smack. How does it affect the body of the abuser? (Delhi 2012) Or Name the opioid drug and its source plant. How does the drug affect the human body? (All India 2010) Answer: Smack is obtained from Papaver somniferum (poppy plant). Drug’s affects

• It binds to specific opioid receptors present in our central nervous system and gastro-intestinal tract.
• It is a depressant that slows down the body functions.

Question 97. Identify A, B, C and D in the following table. (Delhi 2012C)

Answer: A- Heroine B – Cardiovascular system C – Cocaine D – Central nervous system

Question 98. Why is tobacco smoking associated with rise in blood pressure and emphysema (oxygen deficiency in the body)? Explain. (All India 2011) Answer: The nicotine present in tobacco stimulates adrenal glands to secrete adrenaline and nor-adrenaline. Both these hormones increase blood pressure and heart rates. ID Smoking is associated with increased incidence of lung cancers. It increases carbon monoxide level of the blood, which competes with oxygen for transport. As the concentration of haem-bound oxygen decreases, there is oxygen deficiency in the body. It also increases the craving for hard drugs.

Question 99. Why is there a fear amongst the guardians that their adolescent wards may get trapped in drug/alcohol abuse? (All India 2017) Answer: There is always a fear amongst guardians that their adolescents may get trapped in drug/alcohol abuse due to following reasons:

• Adolescence is accompanied by several biological and behavioural changes. It is a vulnerable phase of mental and psychological development of an individual in which an individual may get addicted to alcohol/drugs very easily.
• In this age, the first use of drugs or alcohol may be out of curiosity or experimentation, which later on turns to addiction.
• Adolescents usually take drugs due to social pressure, need of adventure, excitement to avoid stress, depression and frustration.

Question 100. Explain ‘addiction’ and ‘dependence’ in respect of drug/alcohol abuse in youth. (All India 2017) Answer: Addiction is a psychological attachment to certain effects such as euphoria and a temporary feeling of well-being associated with drugs and alcohol. These drive people to take them without need or even when it becomes self-destructive. In the absence of any guidance or counselling, the person gets addicted and becomes dependent on their use.

Dependence on drug/alcohol is the tendency of the body to manifest a characteristic and unpleasant withdrawal syndrome, if regular dose of drugs/alcohol is discontinued abruptly. Withdrawal symptoms are characterised by anxiety, shakiness, nausea and sweating. Sometimes, it can be so severe that they may be life threatening.

Question 101. Prior a sports event blood and urine samples of sports persons are collected for drug tests. (i) Why is there a need to conduct such tests? (ii) Name the drugs the authorities usually look for. (iii) Write the generic names of two plants from which these drugs are obtained. (Delhi 2016) Answer: (i) It is necessary to conduct these tests as sports-persons often take drugs to increase their performance. (ii) Cocaine and morphines are the drugs the authorities usually look for. (iii) Morphine is extracted from the latex of poppy plant Papaver somniferum. Cocaine is obtained from the coca plant Erythroxylum coca.

Question 102. A team of students are preparing to particfpate in the interschool sports meet. During a practice session you find some vials with labels of certain cannabinoids. (i) Will you report to the authorities? Why? (ii) Name a plant from which such chemicals are obtained. (iii) Write the effect of these chemicals on human body. (Delhi 2015) Answer: (i) Yes, I will report it to the authorities, because cannabinoids are classified as drugs and taking them without medical supervision is illegal. (ii) Cannabinoids are obtained from various parts of plant Cannabis sativa. (iii) Effect The cannabinoids interact with cannabinoid receptors in the brain and affect the cardiovascular system of the body.

Question 103. Do you support ‘dope test’ being conducted on sports persons participating in a prestigious athletic meet? Give three reasons in support of your answer. (All India 2014C) Answer: Yes, the ‘dope test’ should be conducted on sports persons participating in a prestigious athletic meet. This is done to find out if any participant had taken any kind of performance enhancing drugs. The use of drugs in sports should be banned as

• they increase muscle strength.
• promote aggressiveness.
• increase athletic performance.

Because of above reasons, use of such drugs, e.g. steroids, analgesics, diuretics should be banned for participants as it would be unfair on the part of other participants (not consuming such drugs).

Question 104. ‘Prevention is better than cure’ is an apt slogan to safeguard adolescents from drug abuse. List any 6 steps that could be taken in this regard. (All India 2013C) Answer: Six steps that could be taken to prevent adolescents from drug alcohol abuse are as follows

• A child should not be pushed unduly to perform beyond his/her limits in studies, sports or any other activities.
• Educating and counselling him/her to face problems and stresses and accept disappointments and failures as part of life.
• Parents and teachers can identify the danger signs and take appropriate steps to diagnose the malady and underlying causes.
• Help should be taken from qualified psychologists and psychiatrists.
• Parents and teacher should become more supportive.
• Help of close friends and relatives can also be taken.

Question 105. Write the source and the effect on the human body of the following drugs (i) Morphine (ii) Cocaine (iii) Marijuana (Delhi 2011) Answer: (i) Morphine is obtained from the latex of Papaver somniferum. It is a depressant, which slows down the body functions. (ii) Cocaine is obtained from Erythroxylum coca. It is a stimulant and produces a sense of euphoria and increased energy. (iii) Marijuana is obtained from the inflorescence of Cannabis sativa. It affects cardiovascular system of the body.

Question 106. (i) Name the drug used (a) as an effective sedative and pain killer. (b) for helping patients to cope with mental illness like depression, but often misused. (ii) How does moderate and high dosage of cocaine affect the human body? (Foreign 2011) Answer: (i) (a) Morphine is an effective sedative and pain-killer. (b) Lysergic Acid Diethylamides (LAD) or barbiturates are often misused.

(ii) Moderate dose of cocaine have a stimulating action on central nervous system. It produces a sense of euphoria and increased energy. High dosage of cocaine causes hallucinations.

Question 107. Municipal corporation has deputed personals to check mosquito breeding in your school. Which places they should check for mosquitoes and name two diseases which are spread by them. Answer: They should check water tanks, flower pots, etc. These are the places where mosquitoes breed. Mosquitoes spread dengue and malaria.

Question 108. It is commonly observed that parents feel embarrassed to discuss freely with their adolescent children about sexuality and reproduction. The result of this parental inhibition is that the children go astray sometimes. (i) Explain the reasons that you feel are behind such embarrassment amongst some parents to freely discuss such issues with their growing children. (ii) By taking one example of a local plant and animal, how would you help these parents to overcome such inhibitions about reproduction and sexuality? (All India 2017) Answer: (i) The reasons behind the embarrassment amongst some parents to freely discuss sexuality and reproduction related issues are as follows

• Communication gap is a big reason for the same. The parents feel that talking about such issues will have a negative impact on children.
• In India, sex-related issues are considered as taboos, so people feel awkward while talking about them.
• Social beliefs are also responsible for this. Most parents think that there has to be a V line of respect between parents and their children. Parents usually think that their child is too young to discuss over this topic.

(ii) To overcome this inhibition, parents can make children understand about sexuality via scientific perspective. For example, in order to tell them about sexuality parents can take the example of cucurbit and papaya. In cucurbits, both male and female reproductive structures are present on the same plant, i.e, they are bisexual, while in papaya both male and female reproductive structures are present on different plants, i.e. they are unisexual. Similarly, in animals, earthworm is bisexual or hermaphrodite while cockroaches are unisexual. The concept of reproduction can be taught in same way by citing the examples of asexual reproduction in lower animals and sexual reproduction in higher animals.

Question 109. Modern life style in big cities and towns is surely making the life more easy and comfortable for people. On the contrary, many more health issues and problems are on the rise and one of them is allergic reactions. (i) Write any four steps you would suggest to minimise the cause of the above allergic responses. (ii) List any two allergens. How does the human body respond to them? Explain. (Delhi 2014) Answer: (i) Allergy is a hypersensitive reaction of the immune system to certain antigens present in the environment. The following steps can be used to minimise the allergic reactions

• Provide a less protected environment in early childhood.
• Avoiding exposure to allergens like mites in dust, pollens, animal dander, etc.
• Use of drugs; like antihistamine, adrenaline and steroids.
• Exposing the patient to small doses of allergens and studying possible reactions.

(ii) Mist in dust and pollens are allergens. The human body responds to them by producing IgE antibodies and releasing chemicals like histamine and serotonin from mast cells.

Question 110. Peer pressure plays a negative role in triggering smoking habits in adolescents. As a school captain list any two activities you would like to organise with the help of senior students of your school and any other two activities you would like your school authorities to organise for the students to tackle this problem. Explain how these activities will help in doing so. (Delhi 2015) Answer: As a captain, we will organise craft competition to create the awareness among the students. Secondly, we will prepare some students to deliver debate during morning assembly to make it more effective and with the help of school authorities, we will prepare hoardings and put them Up on walls. We will also distribute some brochure amongst the students including the lecture of principal during morning assembly, we can also arrange a play on any auspicious occasion.

Question 111. You have attended a birthday party hosted by one of your classmates. You found some guests at the party sitting in a corner making a lot of noise and consuming ‘something’. After a while one of the boys from the group started screaming, behaving abnormally and sweating profusely. (i) Would you inform your parents/school authorities? Yes/No? Give reason in support of your answer. (ii) Prepare a note to be circulated amongst the schoolmates about the sources and dangers of any two drugs. (iii) Write any two ways that you will suggest to your school principal, so as to promote awareness amongst the youth against the use of these drugs. (Foreign 2015) Answer: (i) Yes, I will inform the school authorities, because such kind of behaviour may lead to terrible consequences in future. It may lead to addiction to drugs. (1) (ii) Following are two drugs that are most commonly available

(iii) Ways to promote awareness amongst the youth against the use of these drugs are as follows:

• All students must be inspired to adopt a healthy life style.
• There should be a counsellor who must talk to students about their problems and situations that force them to adopt wrong habits.

Question 112. An active member of an awareness group conducts regular programmes to sensitise public against alcoholism amongst youth as a serious health hazard in his locality. Identify the values this member of the group is trying to propagate amongst the people in his locality. (Value Based Question, Delhi 2013C) Answer: Member of an awareness group is trying to aware public, commonly youth about the harmful impacts of alcohol. He wants to tell people that alcohol has several ill effects which affect the body of the individual in many ways as follows

• Alcohol affects the foetus in case of pregnancy.
• It leads to reckless behaviour, vandalism and violence.
• It causes aggressiveness, rebellious behaviour and depression.
• Fatigue, isolation, fluctuations in weight are the other ill effects.
• Change in sleeping pattern, loss of appetite and lack of personal hygiene is also seen in addicts.

Free Resources

NCERT Solutions

Quick Resources

NCERT Solutions for Class 12 Biology Chapter 8 – Human Health and Diseases

Table of Contents

Subject specialists have created NCERT Solutions for Class 12 Biology Chapter 8 – Human Health and Diseases, which includes thorough solutions for reference. All of the questions from the textbook’s exercises are answered here. Students can use these answers to help them prepare for their exams. The NCERT Solutions for Class 12 provide useful solutions for improving conceptual knowledge.

Fill Out the Form for Expert Academic Guidance!

Please indicate your interest Live Classes Books Test Series Self Learning

Verify OTP Code (required)

I agree to the terms and conditions and privacy policy .

Fill complete details

Target Exam ---

These solutions by Infinity Learn are carefully solved using student-friendly terms while still adhering to the norms that must be followed when solving NCERT Solutions for Class 12. Practicing these answers can be incredibly advantageous not only in terms of exams but also in terms of helping Class 12 pupils perform well in upcoming competitive exams.

The approaches for answering have been given special consideration to stay on target while not deviating from the intended answer. Because time is so important in exams, excellent time management when answering questions is essential for getting the best results.

Download PDF for Free. Study without Internet (Offline)

Grade --- Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 Class 12

Target Exam JEE NEET CBSE

Preferred time slot for the call --- 9 am 10 am 11 am 12 pm 1 pm 2 pm 3 pm 4 pm 5 pm 6 pm 7 pm 8pm 9 pm 10pm

Language --- English Hindi Marathi Tamil Telugu Malayalam

Are you a Sri Chaitanya student? No Yes

NCERT Solutions for Class 12 Biology Chapter 8 – Human Health and Diseases

Chapter 8 NCERT Solutions for Class 12 Biology are included in the term – II CBSE Syllabus for the session 2021-22 and are classed under the Unit – Biology in Human Welfare. According to recent patterns, the unit consists of three chapters and is worth roughly 14 points. This unit is likely to generate a large number of questions for students. As a result, students must extensively read the NCERT Solutions for all chapters in order to be ready to answer any type of question, particularly High Order Thinking Skills (HOTS) — questions that examine students’ reasoning.

Human health is a broad word that encompasses an individual’s social, physical, and mental well-being. This chapter briefly discusses its significance as well as several disorders. Some fatal diseases, such as AIDS and cancer, are also covered, as well as the concept of drug abuse.

The important concepts explained in the chapter are listed below:

• Common Diseases in Humans
• Drugs and Alcohol Abuse

NCERT Solutions for Class 12 Biology Chapter 8 can be used as a quick reference to help students understand complicated concepts.

The Key Features of NCERT Solutions Class 12 Biology Chapter 8 – Human Health and Diseases are:

• The exact answer is a layout by solutions.
• In support of CBSE exam preparations, it is an extremely helpful tool.
• It is readily available.
• Downloading of solutions is free.
• The answers are simple and to the point.
• To learn rapidly and remember effectively use pointers.

Frequently Asked Questions on NCERT Solutions for Class 12 Biology Chapter 8

• List out the topics discussed in Chapter 8 of NCERT Solutions for Class 12 Biology?
• Explain metastasis covered in Chapter 8 of NCERT Solutions for Class 12 Biology?
• Why are the NCERT Solutions for Class 12 Biology Chapter 8 important for the second term exams?

1. List out the topics discussed in Chapter 8 of NCERT Solutions for Class 12 Biology?

Following are the topics that are explained in Chapter 8 of NCERT Solutions for Class 12 Biology :

• Drugs and Alcohol Abuse.

2. Explain metastasis covered in Chapter 8 of NCERT Solutions for Class 12 Biology?

In malignant tumors, metastasis is a pathogenic process that occurs. During this phase, malignant cells move to different regions of the body and divide endlessly, forming tumors. Some of the tumor’s cells slough off and enter the bloodstream, where they travel to different parts of the body, resulting in the creation of new tumors as they actively divide. Students should get the solutions from our experts if they want to understand the concepts mentioned in this chapter. The solutions were developed by a group of highly experienced subject matter experts with the goal of assisting students in achieving excellent scores on their second-term exams.

3. Why are the NCERT Solutions for Class 12 Biology Chapter 8 important for the second term exams?

Class 12 is regarded as one of the most important milestones in a student’s life. Our experts created chapter-by-chapter solutions for this aim after doing extensive research on each issue. The solutions include extensive and step-by-step explanations to assist students in achieving high marks on the term – II exams. Our professionals have prepared solutions in PDF format, which students can download and utilize according to their needs.

Related content

Get access to free Mock Test and Master Class

Register to Get Free Mock Test and Study Material

Offer Ends in 5:00

Select your Course

Please select class.

Talk to our experts

1800-120-456-456

NCERT Solutions for Class 12 Biology Chapter 8 - Microbes In Human Welfare

NCERT Solutions for Class 12 Biology Chapter 8 - Microbes in Human Welfare

NCERT Solutions for Class 12 Chapter 8 are available for free download on Vedantu. All the concepts covered in the chapter are well-explained in these NCERT Solutions. You can download and refer to the NCERT Solutions for Class 12, Chapter 8 - Microbes in Human Welfare PDF from Vedantu for free. Everything you read in your high school serves as the foundation for your college education, and thus, your career afterward. Therefore, an accurate NCERT Solutions bank is an essential tool for performance-oriented study sessions.

It serves as an easy tool to ensure your grasp on various topics, and remove any lingering doubts about the concepts. Since entrance exams start right after Class 12, preparation is the key to acing the exams with ease.

Microbes in Human Welfare Chapter at a Glance - Class 12 NCERT Solutions

Microbes in Human Welfare

• Microbes or microorganisms are small which are not visible to the naked eye because they have a size of 0.1 mm or less. They can therefore be seen only under the microscope. 

Microbes are seen everywhere inside the soil, in all types of waters, in air, on dust particles, inside and outside our body as well as in plants and animals. They even occur in inhospitable environments where no other life form exists like in snow. In thermal vents or inside geysers (at temperature of 100° C), deep inside soil, highly acidic soil.  

Microbes belong to a diverse group of organisms like bacteria, protozoa, fungi and microscopic plants. Most of these microbes can grow in nutritive media where they form colonies- bacteria and fungi. The colonies can be seen with the naked eye. They are useful in the study of various aspects of microorganisms. 

Some other types of microorganisms are viruses, viroids and prions.

Access NCERT Solution for Class 12 Biology Chapter 8 - Microbes in Human Welfare

1. Bacteria Cannot Be Seen With the Naked Eyes, but These Can Be Seen With the Help of a Microscope. If You Have to Carry a Sample from Your Home to Your Biology Laboratory to Demonstrate the Presence of Microbes Under a Microscope, Which Sample Would You Carry and Why?

A sample, Curd, can be used for the study of microbes. Numerous lactic acid bacteria (LAB) or Lactobacillus are present in Curd. Acids are produced by these bacteria that coagulate and digest milk proteins.

In the research laboratory, a tiny low drop of curd is carried because it contains multitudes of bacteria, which might be easily observed under a microscope which are of varied shapes and sizes.

2. Give Examples to Prove That Microbes Release Gases During Metabolism.

For the release of gases during metabolism, the examples are:

(a) A puffed appearance is seen in dough which is used for making idli and dosa . This is Due to the action of bacteria; carbon dioxide is released. This CO₂ released from the dough gets caught within the dough, hence giving it a puffed appearance.

(b) During wastewater treatment, the digestion of sludge produces a bacteria which is a mixture of gases such as methane, hydrogen sulphide and carbon dioxide.

3. In Which Food Would You Find Lactic Acid Bacteria? Mention Some of Their Useful Applications.

Lactic acid bacteria is present in curd.

Their useful applications are as follows:

(i) Formation of milk into curd is produced by this bacterium.

(ii) Multiplication of the bacterium increases its number, which converts the milk into curd. 

(iii) The content of vitamin B12 increases in the curd.

(iv) Presence of lactic acid bacteria in the stomach keeps a check on the disease- causing micro-organisms.

4. Name Some Traditional Indian Foods Made of Wheat, Rice and Bengal Gram (or Their Products) Which Involve Use of Microbes .

(i) In the making dosa and idli, rice powder is fermented by bacteria and for creating bread (from wheat), yeast (Saccharomyces cerevisiae) is employed.

(ii) Gutta (made from black gram) also uses bacteria.

(iii) Microbes are accustomed to ferment fish, soya bean and bamboo shoots to create foods.

5. In Which Way Have Microbes Played a Major Role in Controlling Diseases Caused by Harmful Bacteria ?

(i) Several microorganisms are used for preparing medicines. In order to kill other disease-causing microorganisms antibiotics were developed which are produced by certain microorganisms.

(ii) Medicines are usually obtained from bacteria and fungi. Either they get killed or the growth gets stopped by disease-causing microorganisms.

(iii) For the treatment of life-threatening diseases such as plague, whooping cough (kali khansi), diphtheria (galghotu) and leprosy (kusht rog) and for many other common infections different antibiotics were used which are Streptomycin, tetracycline, and penicillin are common ones .

(iv) Growth of Staphylococci bacteria in the body was checked by chemical penicillin produced by Penicillium notatum, a fungus.

(v) Bacteria were destroyed by weakening their cell walls by antibiotics. Due to this weakening, certain immune cells such as the white blood cells enter the bacterial cell and cause cell lysis. The process of destroying cells such as blood cells and bacteria is cell lysis.

6. Name Any Two Species of Fungus, Which are Used in the Production of Antibiotics.

Antibiotics are drugs produced by certain microorganisms to fight disease-causing microorganisms. These medications are frequently derived from microbes and fungus.

The following fungi are used in the production of antibiotics.

7. What is Sewage? In Which Way Can Sewage Be Harmful to Us?

The municipal waste matter is the sewage which is carried away in sewers and drains.

It consists of both liquid and solid wastes, which is rich in organic matter and microbes. Most of these microbes are pathogenic and may cause several water- borne diseases. Sewage water is a major source of polluting drinking water. Hence, it is important that sewage water should be properly collected, treated, then disposed of.

8. What is the Key Difference Between Primary and Secondary Sewage Treatment?

9. Do You Think Microbes Can Also Be Used as a Source of Energy? If Yes, How?

Yes, microbes can be used as an energy source. Bacteria like Methane bacterium are employed for the generation of gobar gas or biogas.

(i) In a biogas plant, the generation of biogas is an anaerobic process which consists of a concrete tank (10-15 feet deep) with sufficient outlets and inlets.

(ii) Slurry is formed by the mixture of dung and water and is further thrown into the tank. The digester of the tank contains numerous anaerobic methane-producing bacteria, which produce biogas from the slurry.

(iii) Biogas can be used as a source of energy after removal through the pipe, while the spent slurry is removed from the outlet and is used as a fertilizer.

10. Microbes Can Be Used to Decrease the Use of Chemical Fertilizers and Pesticides. Explain How This Can Be Accomplished .

Organisms that enrich the nutrient quality of the soil are the microbes which can be employed as biofertilizers .Bacteria, fungi and cyanobacteria are the main sources of biofertilizers . By this, fertility of the soil is increased in many ways

(i) Nodules on the roots of leguminous plants (a symbiotic association) that is formed by Rhizobium fixes the atmospheric nitrogen into organic form, which is used by the plant as a nutrient.

(ii) Fixing atmospheric nitrogen by Azospirillum and Azotobacter , while living freely, and enhancing the nitrogen content of the soil.

(iii) Symbiotic association is formed by the many members of the genus Glomus (fungi) with vascular host plants known as mycorrhiza that:

Helps within the absorption of phosphorus from soil and pass it to the plant.

Resistance to root-borne pathogens are developed within the plants.

Overall increase in plant growth and development can be done by increasing their tolerance to salinity and drought.

(iv) Cyanobacteria autotrophic microbes, e.g., Anabaena, Nostoc, Oscillatoria can fix atmospheric nitrogen, in aquatic and terrestrial environments and also add organic matter to the soil and increase its fertility.

11. Three Water Samples Namely River Water, Untreated Sewage Water and Secondary Effluent Discharged from a Sewage Treatment Plant Were Subjected To BOD Test. The Samples Were Labelled A, B and C; but the Laboratory Attendant Did Not Note Which Was Which. The BOD Values of the Three Samples A, B and C Were Recorded as 20 mg/L, 8 mg/L and 400 mg/L, Respectively. Which Sample of the Water Is Most Polluted? Can You Assign the Correct Label to Each Assuming the River Water is Relatively Clean?

The amount of oxygen required by micro-organisms to decompose the waste present in the water supply is determined using the Biological Oxygen Demand (BOD) method. When the water supply contains high levels of organic wastes, the number of decomposing bacteria also increases, leading to a higher BOD value. Consequently, water supplies that are more polluted tend to have higher BOD values. Sample C, with a BOD value of 400 mg/L, is the most polluted among the three samples. The discharge of secondary effluent from a sewage treatment plant is more polluted than river water, which explains why sample A has a higher BOD value of 20 mg/L compared to sample B, which has a BOD value of 8 mg/L and is sourced from a river.

Hence, the correct label for each samples are:

12. Find Out the Name of the Microbes from Which Cyclosporin a (an Immunosuppressive Drug) and Statins (Blood Cholesterol Lowering Agents) are Obtained

13. Find Out the Role of Microbes in the Following and Discuss it With Your Teacher.

(a) Single cell protein (SCP)

(a) Single Cell Protein (SCP) refers to harmless microbial cells that may be used as an alternate source of excellent protein. Just like mushrooms (a fungus) is eaten by many individuals and yeast utilized by athletes as a protein source; similarly, other sorts of microbial cells can also be used as food rich in protein, minerals, fats, carbohydrates and vitamins. On an industrial scale, microbes like Spirulina and Methylophilus methylotrophus are grown on materials containing starch like waste, water from potato processing plants, straw, molasses, animal manure and even sewage. These single cell microbes may be used as a source.

(b) Soil: An important role is played by microbes in maintaining soil fertility. By the process of decomposition, they help in the formation of nutrient-rich humus  . The ability to fix atmospheric nitrogen into usable form is done by many species of bacteria and cyanobacteria . A symbiotic bacteria found in the root nodules of leguminous plants is a Rhizobium. Free living nitrogen-fixing bacteria are Azospirillum and Azotobacter, whereas Anabaena, Nostoc, and Oscillitoria are examples of nitrogen-fixing cyanobacteria.

14. Arrange the Following in the Decreasing Order (most Important First) of Their Importance, for the Welfare of Human Society. Give Reasons for Your Answer.

Biogas, Citric acid, Penicillin and Curd

Penicillin > Biogas > Curd > Citric acid

Penicillin is the most crucial product for human welfare in society. It is an antibiotic that is used to treat a variety of bacterial infections. 

Biogas is the second most important product. It is an environmentally friendly form of energy as it is non-polluting decent fuel that is produced as a byproduct of sewage treatment. 

Curd, a food item produced by the action of lactobacillus bacteria on milk, it has excellent nutrient value, providing vitamin-B12 and replaces unfavourable bacteria of the  stomach. 

Citric acid, which is utilised as a food preservative, is the next most important product.

15. How Do Biofertilizers Enrich the Fertility of the Soil?

Fertility of the soil can be increased by the use of biofertilizers. Selection of beneficial microorganisms are involved that help in improving plant growth by providing plant nutrients. To mobilize the availability of nutrients by their biological activity, these are introduced to seeds,  roots, or soil. Therefore, they are extremely beneficial in enhancing the soil with organic nutrients. The ability to fix free atmospheric nitrogen is shown by many species of bactrium. A symbiotic bacteria found in the root nodules of leguminous plants is a Rhizobium. Free living nitrogen-fixing bacteria are Azospirillum and Azotobacter, whereas Anabaena, Nostoc, and Oscillitoria are examples of nitrogen-fixing cyanobacteria.

Bio-fertilizers are cost effective and eco-friendly.

NCERT Solutions for Class 12 Biology Chapter 8: Microbes in Human Welfare - Free PDF Download

NCERT Class 12 Biology Chapter 8, focuses on the importance and uses of microbes in human welfare. Vedantu’s NCERT Class 12 Biology Chapter 8 Solutions are fabricated to enhance your understanding of the topic, thus helping you ace the exams. Most of the discussed questions are repeated in the CBSE 12th board examinations. The theories relevant to every answer is explained in detail, in these solutions. Download the NCERT Solutions Class 12 Biology Chapter 8 Solutions PDF to learn and understand the concepts covered in the ch 8 biology class 12.

Introduction to Microbes in Human Welfare

Chapter 8, microbes in Human welfare, discusses various concepts and theories related to the common uses of microbes in our daily life, and its significant role in industries and pharmaceuticals. The chapter mainly focuses on the roles that the microbes play in the synthesis of various products, sewage treatment, composting and biogas production, etc. The concepts and processes behind these applications are also discussed in this chapter. It entails all the inputs each of them takes, such as enzymes, microbes such as bacteria and fungi, environmental factors, etc, and their end-products.

The major applications of the mentioned processes are in the pharmaceutical industry, biogas and composting, household products, sewage treatment plants, bioagents needed in other biochemical processes, etc. The chapter covers information related to the real-life application of biotechnology and its importance in our daily lives.

Important Topics for NCERT Class 12 Biology Chapter 8 - Microbes in Human Welfare

Microbes in Household Products

Microbes in Industrial Products

Fermented Beverages

Antibiotics

Chemicals, Enzymes, and other Bioactive Molecules

Microbes in Sewage Treatment

Microbes in Production of Biogas

Microbes as Biocontrol Agents

Microbes as Bio fertilisers

Class 12 Biology Chapter 8 NCERT Solutions Highlights

The microbes in human welfare class 12 NCERT solutions are written in the most plain language possible, making them easier to read and understand.

Points are utilised to frame responses in the microbes in human welfare class 12 NCERT pdf to assist students grasp quickly.

The subject expert derived the solution content for microorganisms in human wellbeing NCERT pdf from the textbook.

NCERT solutions for microbes in human welfare are based on the most recent CBSE Syllabus and recommendations.

Microbes in human welfare class 12 pdf links are widely available and free of charge.

The NCERT class 12 biology chapter 8 pdf contains a list of important subjects.

NCERT is an excellent source of knowledge on microbes in human welfare class 12.

Benefits of NCERT Solutions for Class 12 Biology

Biology can be a very scoring subject if mugging up the theory and concepts is your forte. Many students believe that mugging up is the only way through this subject. Especially among the students driven by the desire to ace the exams, this is definitely not a healthy practice. A team of expert teachers has prepared Vedantu’s biology, class 12, chapter 8 solutions, for the convenience of students.

Some advantages of NCERT Solutions for Class 12 Biology are as follows.

Complete understanding of the subject through topic-wise discussion.

The solutions cover concepts relevant to the questions and are prepared as per the CBSE guidelines. So, acing CBSE exams becomes much easier.

The questions are answered in a way to maximize your understanding of the core concepts involved.

The solutions are available in PDF format online for your easy referral.  

Access Other Chapters of NCERT Solutions for Class 12 Biology

Ncert solutions for class 12 biology chapter 1 reproduction in organism ncert solutions for class 12 biology chapter 2 sexual reproduction in flowering plant ncert solutions for class 12 biology chapter 3 human reproduction   ncert solutions for class 12 biology chapter 4 reproductive health ncert solutions for class 12 biology chapter 5 principle of intelligence and variation ncert solutions for class 12 biology chapter 6 molecular basis of inheritance ncert solutions for class 12 biology chapter 7 evolution ncert solutions for class 12 biology chapter 8 human health and disease ncert solutions for class 12 biology chapter 9 strategies for enhancement in food production ncert solutions for class 12 biology chapter 11 biotechnology: principle and process   ncert solutions for class 12 biology chapter 12 biotechnology and application ncert solutions for class 12 biology chapter 13 organism and population ncert solutions for class 12 biology chapter 14 ecosystem ncert solutions for class 12 biology chapter 15 biodiversity and conservation ncert solutions for class 12 biology chapter 16 environmental issues , other related links, ncert solutions for class 12 biology ncert books for class 12 biology cbse class 12 biology revision notes important questions for cbse class 12 biology, chapter-wise solutions cbse syllabus for class 12 biology (term 1 & 2), why should you refer to vedantu’s study materials, vedantu is consistent in its efforts to provide you with the best study material. a team of dedicated teachers works diligently to formulate the best possible answers for the ncert solutions for class 12 biology chapter 8 microbes in human welfare. these ncert solutions will help you to learn the chapter efficiently and ace the exams successfully. the solutions are prepared by a team of experts by keeping the cbse guidelines in mind. all the study materials, such as test papers and revision notes, are developed with the sole purpose of allowing the reader to secure maximum marks in the exams and boost their understanding of the topic. all the topics are covered in an organized manner to enhance understanding. a platform for the students to address their doubts and get appropriate answers is provided by vedantu. our expert faculty are always available to address the doubts that students may have while learning..

FAQs on NCERT Solutions for Class 12 Biology Chapter 8 - Microbes In Human Welfare

1. What are the Topics Under Biology Class 12, Chapter 8?

The chapter covers various purposes for which microbes are efficiently employed. The main topics taught under the chapter include:

Microbes in household products.

Microbes in industrial production of chemicals, organic acids, enzymes, and other bioactive molecules.

Microbes in Sewage Treatment.

Microbes in Production of Biogas.

Microbes as Biocontrol agent.

Microbes as Biofertilizers.

2. How many Questions are There in the Exercises of this Chapter?

The chapter contains 15 questions in its exercises, divided into 9 short answer type questions (3 lines or less), and 6 long answer type questions (more than 3 lines).

3. What Role does Vedantu’s NCERT Solutions for this Chapter Play?

One of the major mistakes students make is not building a solid foundation of concepts. Mugging up theories cannot help you get a comprehensive knowledge of the subject. So learning the chapter by understanding the concepts and solutions is the best approach.

Vedantu’s NCERT Solutions is crafted and curated by a resident team of subject experts. They ensure that you get a complete theoretical understanding of the topic and also understand its implementation in daily life. The solutions are explained to relate to the theory taught in the best way, thus ensuring efficient learning and the best performance of students.

4. Name some traditional Indian foods made of wheat, rice, and Bengal gram (or their products) that involve the use of microbes.

Some traditional foods made of wheat, rice, an Bengal Gram are:

Nan made from wheat

Idli, dosa from rice 

Pakoda , khandvi from Bengal gram.

To gain more insights into this chapter, students can make use of the NCERT solutions provided by the Vedantu to help them prepare for their exams. These questions and its solutions are created by the subject experts. Download the PDF from the Vedantu website or the app free of cost.

5. In which way have microbes played a major role in controlling diseases caused by harmful bacteria?

Antibiotics like Streptomycin, Tetracycline and Penicillin produced by microbes play an important role in fighting and killing the disease-causing microorganisms. Vedantu’s NCERT solutions provide detailed explanations for all the concepts in Biology Class 12. These solutions are prepared by the experts to clear the doubts of the students. To download the PDF of important questions free of cost, students are advised to visit the Vedantu website (vedantu.com).

6. What are the key features of NCERT Solutions for Class 12 Biology Chapter 8?

Vedantu provides NCERT Solutions for Class 12 Biology. The solutions are prepared by the experts in a very simple language for students to learn the concepts quickly. Students can also register for live online classes to get well versed in the subject. The NCERT solutions are crafted with no errors and provide authentic information. Students can download the NCERT solution free of cost at Vedantu platform.

7. Mention the topics included in Chapter 8 of NCERT Solutions for Class 12 Biology.

The topics in Chapter 8 of Class 12 Biology are:

Microbes as Biocontrol agents.

You can visit the Vedantu website to gain in-depth knowledge in Chapter 8 provided by the professionals. 

8. What are human welfare microbes?

Microbes help the body kill the disease-causing microorganism by producing antibiotics. But few microorganisms are useful to our body. And they are Bacteria, Fungi, and Protozoa. These microbes help in human welfare. They help in digestion and protect the body from infections. The NCERT questions and their solutions help the students to secure a perfect score in the exams.

9. What is SCP in microbes in human welfare?

Single-cell protein refers to the protein produced by microorganisms like yeast, fungi, algae, and bacteria. These can be used as substitutes for protein, carbohydrates, minerals, and vitamin-rich foods and can be consumed by humans. Vedantu offers a PDF of the NCERT solutions for the students to help them in their exam preparations. Students are advised to download the important question on the official website of Vedantu or use the Vedantu app on their phones to access the PDFs.

10.  Which sample would you carry and why?

One of the natural habitats for microbes is soil and water and it is easy to carry these samples. They can be observed under the microscope. Vedantu ‘s NCERT solutions are created by the experts with questions that enhance your understanding of the subject. 

11.  What is another name used to address the virus parasitizing bacteria?

Virus parasitizing bacteria is also known as Bacteriophages. Vedantu offers the best study material for this chapter. Visit the  Vedantu website  where the experts explain the concepts in detail and offer NCERT solutions to the students to ace their exam successfully. Since these solutions are prepared by the subject experts, students can also talk to subject experts to clarify their doubts. 

NCERT Solutions Class 12 Biology

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Important Question
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• Question Bank
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• Toppers Notes
• Most Repeated Question
• Diagram Based Question
• Study Planner
• JEE Previous Year Paper
• JEE Mock Test
• JEE Crash Course
• JEE Sample Papers
• Important Info
• SRM-JEEE Previous Year Paper
• SRM-JEEE Mock Test
• VITEEE Previous Year Paper
• VITEEE Mock Test
• BITSAT Previous Year Paper
• BITSAT Mock Test
• Manipal Previous Year Paper
• Manipal Engineering Mock Test
• AP EAMCET Previous Year Paper
• AP EAMCET Mock Test
• COMEDK Previous Year Paper
• COMEDK Mock Test
• GUJCET Previous Year Paper
• GUJCET Mock Test
• KCET Previous Year Paper
• KCET Mock Test
• KEAM Previous Year Paper
• KEAM Mock Test
• MHT CET Previous Year Paper
• MHT CET Mock Test
• TS EAMCET Previous Year Paper
• TS EAMCET Mock Test
• WBJEE Previous Year Paper
• WBJEE Mock Test
• AMU Previous Year Paper
• AMU Mock Test
• CUSAT Previous Year Paper
• CUSAT Mock Test
• AEEE Previous Year Paper
• AEEE Mock Test
• UPSEE Previous Year Paper
• UPSEE Mock Test
• CGPET Previous Year Paper
• BCECE Previous Year Paper
• JCECE Previous Year Paper
• Crash Course
• Previous Year Paper
• NCERT Based Short Notes
• NCERT Based Tests
• NEET Sample Paper
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• Verbal Ability & Reading Comprehension
• Logical Reasoning & Data Interpretation
• CAT Mock Test
• CAT Important Question
• CAT Vocabulary
• CAT English Grammar
• MBA General Knowledge
• CAT Mind Map
• CAT Study Planner
• CMAT Mock Test
• SRCC GBO Mock Test
• SRCC GBO PYQs
• XAT Mock Test
• SNAP Mock Test
• IIFT Mock Test
• MAT Mock Test
• CUET PG Mock Test
• CUET PG PYQs
• MAH CET Mock Test
• MAH CET PYQs
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

Biology Case Study for Class 12 (Download Free PDF)

Free pdf download.

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

Biology Case Study for Class 12

While preparing for the board exams, students are being judged on different levels of skills, such as writing, reading, etc. Biology Case Study for Class 12 questions are one of them that helps in assessing critical thinking.

The Central Board of Secondary Education will be asking the case study questions in the Class 12 board examination. Therefore, here on this page, we have provided the Biology Case Study for Class 12 at free of cost. Our subject matter experts have prepared Case Study questions so that Apart from the basic standard questions, students can have a variety of problems to solve. 

Just like MCQs, and other written types questions Biology Case Study for Class 12 questions will impact the overall performance of a student. Therefore for the convenience of the students we have provided the download links here, so that they can easily access the Class 12 Case Study.

Download Chapter Wise Biology Case Study for Class 12 Question and Answers PDF 

There are lots of chapters in class 12 Biology from which Class 12 Case Study Questions can be framed. Going through such types of questions help the students to assess their understanding level in the topics discussed in NCERT Class 12 Biology Books. By practicing the Class 12 Case Study Questions for Biology students will be very confident to ace the board exam. Also the Biology case study will be very useful for the NEET exam preparation.

Doing a regular practice of Class 12 Biology Case Study questions is a great way to score higher marks in the board exams as it will help students to develop a grip on the concepts. 

Here our subject experts have crafted the Subject Wise Case Study For Class 12. Download Subject Wise CBSE Case Study Class 12 Question and Answers PDF from the below given links.

Case Study Questions Class 12 Chapter 2 Sexual Reproduction in Flowering Plants

Case Study Questions Class 12 Chapter 3 Human Reproduction

Case Study Questions Class 12 Chapter 4 Reproductive Health

Case Study Questions Class 12 Chapter 5 Principles of Inheritance & Variation

Case Study Questions Class 12 Chapter 6 Molecular Basic of Inheritance

Case Study Questions Class 12 Chapter 7 Ecosystem

Case Study Questions Class 12 Chapter Evolution

Case Study Questions Class 12 Chapter 8 Human Health And Diseases

Case Study Questions Class 12 Chapter 10 Microbes in Human Welfare

Case Study Questions Class 12 Chapter 11 Biotechnology - Principles & Processes

Case Study Questions Class 12 Chapter 12 Biotechnology And Its Applications

Case Study Questions Class 12 Chapter 13 Organisms And Populations

Case Study Questions Class 12 Chapter 15 Biodiversity And Conversation

Case study types of questions are generally descriptive that helps to gather more information easily so, it is kinda easy to answer. However, our subject matter experts have given the solutions of all the Biology Case Study for Class 12 Biology questions.

Passage Based Class 12 Biology Case Study Questions in PDF

CBSE Class 12 Case studies are known as Passage Based Questions. These types of problems usually contain a short/long paragraph with 4 to 5 questions. 

Students can easily solve Passage Based Class 12 Case Study Questions by reading those passages. By reading the passage students will get the exact idea of what should be the answers. Because the passage already contains some vital information or data. However a better understanding of the basic concepts that can be learned from the NCERT Class 12 Textbooks will aid in solving the Case based questions or passage based questions.

How to Download CBSE Case Study of Class 12 Biology ?

Follow the below given simple steps to know how to download CBSE Case Study of Class 12 Biology:-

• Open Selfstudys website in your browser
• Go to the navigation menu that look like this
• Now, click on CBSE and then Case Study respectively
• A new page will open, where you have to click on “Class 12”
• Now, you are ready to select the subject for which you want to download the case study questions.

How to Solve Biology Case Study Based Questions of Class 12?

There are very simple methods that a student should keep in mind while solving Biology Case Study for Class 12 for any subject:

• Read each line of paragraph carefully and pay attention to the given data/numbers. Often questions are framed according to the highlighted data of the passage.
• Since case study questions are often framed in Multiple choice questions, students should have the knowledge of elimination methods in MCQs.
• Having a good understanding of the topics that are discussed in CBSE Class 12 Books are ideal to Solve Case Study Based Questions of Class 12.

Features Of Class 12 Biology Case Study Questions And Answers PDF

The three most noticeable features of Class 12 Biology Case Study Questions And Answers Pdf are -

• It Is Free To Use:  Keeping in mind the need of students and to help them in doing Self Study, our team has made all the PDF of Biology Case Study for Class 12 free of cost.
• Answers Are Given:  Not only the PDFs are free provided but answers are given for all the questions of Biology Case Study for Class 12. 
• PDF Can Be Downloaded Or Viewed Online:  Many students don’t like to download the PDFs on their device due to the shortage of storage. Therefore, CBSE Class 12 Case Study questions are made available here in online format, so that students can view them online. However, through the Selfstudys app, a learner can download the PDFs too.

Benefits of Using CBSE Class 12 Biology Case Study Questions and Answers

The CBSE Class 12 Biology Case Study Questions and Answers can help a student in several ways:

• In Exam Preparation:  Those who go through the Biology Case Study for Class 12 will find support during the exam preparation as case based questions are also asked in the CBSE Class 12 Board examination. 
• Help in brushing up the previous learnings:  No matter how brilliant you are, you have to revise the studied topics time and again to keep them refreshed. And in this task, the CBSE Class 12 Case Study Questions and Answers can help a lot.
• To develop the critical thinking:  Able to analyse information and make an objective judgement is a skill that is known as critical thinking. A student of class 12 can use Biology Case Study for Class 12 with answers to develop critical thinking so that they can make better decisions in their life and in the board examination.

• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences

• Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

Case Study Question for Class 12 Biology Ch. 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16

Case study question for class 12 biology ch 1 to 16, case study 01:, case study 02:, case based questions class 12 biology chapterwise.

Key questions for 10th review Biology are outlined agreeing to the CBSE NCERT program. All address sorts are accessible within the PDF, from one-word to one-line answers, brief reply sorts to five point long reply sorts. Hence, understudies can plan for exams and indeed clarify their concepts through them. On the off chance that they refer to these questions, it’ll get ready their minds to pick up a competitive advantage. Understudies will gotten to be commonplace with question patterns and the sorts of questions that will show up on exams.

Leave a Reply Cancel reply

We have a strong team of experienced teachers who are here to solve all your exam preparation doubts, chhattisgarh class 4 math numbers solution, up scert solutions class 8 english chapter 3 – the right choice, dav class 6 english literature book solution chapter 9 our tree, dav class 6 english literature book solution chapter 8 hanuman and i.