crow website for research paper

Sci-Hub is the most controversial project in today science. The goal of Sci-Hub is to provide free and unrestricted access to all scientific knowledge ever published in journal or book form.

Today the circulation of knowledge in science is restricted by high prices. Many students and researchers cannot afford academic journals and books that are locked behind paywalls. Sci-Hub emerged in 2011 to tackle this problem. Since then, the website has revolutionized the way science is being done.

Sci-Hub is helping millions of students and researchers, medical professionals, journalists and curious people in all countries to unlock access to knowledge. The mission of Sci-Hub is to fight every obstacle that prevents open access to knowledge: be it legal, technical or otherwise.

To get more information visit the about Sci-Hub section.

Thank you for joining Sci-Hub mailing list!

Corpus and Repository of Writing

Crows Are Even Smarter Than We Thought

If crows like the New Caledonian Crow can plan out and create a specialized tool, then they seem to have smarts that rival those of early humans. 

Not many animals have the capacity to plan ahead, but the New Caledonian Crow is one of them . These birds were observed to keep a tool handy for later use, a degree of advance planning on the level of a human child. It’s one of the few instances of such planning in a non-human, and what’s more, in order to set aside a tool, first the crow needs to understand how to use a tool. In fact, tool use in these crows is sophisticated enough to rival humans and great apes.

There is tool use and there is tool use. To pick up a stick to help remove objects from a small hole is tool use. New Caledonian Crows go much further than that, and actually modify existing objects to create tools . The crows use some simple manufacturing techniques, folding the edged pieces of screw pine leaves into a bent shape to access grubs in holes. But they have also been observed to follow very complicated procedures. To make twig hooks, the crows first select a twig, trim the edges then bend it into a hook shape. Finally, and most remarkably, the crows shape and sharpen the point of the hook using their beaks.

Further evidence of the crows’ acute intelligence comes from complicated tests administered to captive crows . Some crows were able to solve a complicated treasure hunt involving a task where they needed to use find one tool, use that tool to obtain another tool, and then use that second tool to extract food from a box. Most of the crows required several tries, but at least one was able to solve the problem first try. The exact reasoning behind the task is subject to interpretation; it’s possible that they simply eventually figured out the task through conditioning after receiving the reward for successful completion. But the researchers believe that this may be evidence of complicated thought and innovation, especially because they persisted through the first stages of the test without an immediate reward.

Weekly Newsletter

Get your fix of JSTOR Daily’s best stories in your inbox each Thursday.

Privacy Policy   Contact Us You may unsubscribe at any time by clicking on the provided link on any marketing message.

Why did crows develop these incredible abilities? To evolve a brain capable of such tasks carries a cost in terms of the energy needed to run it. But nothing happens without an evolutionary reason. It turns out that larvae found burrowed inside wood are some of the most nutritious prey available , and only sophisticated tools can fish these morsels easily out of their holes. To capitalize on this food source, crows first had to develop new abilities.

The end result is the New Caledonian Crow, and possibly other crow species, are in rarefied company. If crows can plan out and create a specialized tool, then crows seem to have cognitive abilities that rival those of early humans.

JSTOR is a digital library for scholars, researchers, and students. JSTOR Daily readers can access the original research behind our articles for free on JSTOR.

Get Our Newsletter

More stories.

• HMS Challenger and the History of Science at Sea

Astronomers Have Warned against Colonial Practices in the Space Industry

Tree of Peace, Spark of War

How Sports Shaped Glacier Science

Recent posts.

• The Long Civil Rights Movement
• “Protecting Kids” from Gay Marriage
• Seeing Cannibals in the Enlightenment
• Like, It’s a History of Air Guitar, Dudes!

Support JSTOR Daily

Sign up for our weekly newsletter.

Crow, the Corpus & Repository of Writing, is a web-based archive  which supports research and professional development in applied linguistics and rhetoric & composition. Our project began in Fall 2015 at Purdue University and has expanded to many more institutions, including Arizona, NC State, Northern Arizona, and UMass-Boston.

Crow has been supported by an ACLS Digital Extension Grant from the American Council of Learned Societies (ACLS).

Our project has also been supported by the Humanities Without Walls consortium , based at the Illinois Program for Research in the Humanities at the University of Illinois at Urbana-Champaign. The Humanities Without Walls consortium is funded by a grant from the Andrew W. Mellon Foundation .

About the Crow corpus

Our corpus holds over 17,000 texts produced by undergraduate students in first year writing, totalling 17.8 million words. Students represented in the corpus come from over 50 different countries and are majoring across over 100 programs.

Information on the the context in which each text was produced include:

• year and semester the text was written
• course for which the text was written
• assignment of each text (e.g., argumentative paper, genre analysis, literature review)
• draft of each text
• relevant demographic information of the students (gender, country of origin, program and major, TOEFL score, etc.)

In addition to our corpus, our repository holds 380 instructional materials linked to the texts represented in the corpus, including:

• In-class activity handouts, homework assignments, and peer review activities
• Assignment sheets/prompts for major assignments
• Lesson plans and presentation slides
• Grading rubrics (scales) for major assignments
• Sample papers used during instruction
• Course syllabi, schedules and policies

Demographic data included in Crow’s corpus come from institutional data where participants are enrolled and/or employed. We recognize that these institutions’ current decisions to categorize gender as binary and country of origin as singular do not fully reflect the complexity of our participants’ identities and backgrounds, and we support advocacy for more inclusive and nuanced institutional data.

To request access to the Crow corpus & repository, review our terms and conditions, then complete the access request form . Please allow five business days for review.

Download a subset of the texts available in the online corpus. This option is intended for users who would like to use the corpus for their own research, particularly if they Note: additional training and verification is required.

For researchers who would like to annotate the corpus, use concordancing software (e.g., Antconc or LancsBox), or create their own programs to analyze the data, we have prepared an offline version. This subset of the Crow corpus has been curated by the Crow team to ensure a representative sample from the first year writing context. Additional training is required for offline use.

Citing the Crow corpus

Using our corpus? Cite us:

Staples, S., & Dilger, B. (2018-). Corpus and repository of writing [Learner corpus articulated with repository]. Available at https://crow.corporaproject.org

Crow is an interdisciplinary and inter-institutional team dedicated to studying and teaching writing. Our project seeks to reach four primary audiences: instructors , researchers , participants , and collaborators .

• Maintain and continually improve our corpus and repository, prioritizing accessibility and usability by listening carefully to our community of users.
• Develop outreach programs for a variety of domestic and international educational institutions, meaningfully including historically marginalized students, teachers, and scholars.
• Advocate for an inclusive view of language that moves beyond deficit models, welcomes vernacular varieties, values learner corpora, acts upon professional standards, and respects the work of multilingual writers and learners.
• Develop and share more sustainable , ethical and effective approaches to building interdisciplinary research teams .
• Build well-documented approaches, methods, and open source tools, supporting multiple approaches to research, teaching, and professional development.
• Conduct writing research using our approaches, methods, and tools, and share it broadly.
• Seek internal and external grant funding to support research, development, and outreach.
• Evaluate our work systematically , including the needs of historically marginalized students, teachers, and scholars.

May 2019: Diversifying Digital Writing Archive to Include Spanish Heritage Speakers, Arizona SBS press release about our 2019 ACLS Digital Extension Grant.

June 2019: CUES Fellows to Explore Ways to Transform Teaching and Learning, Arizona press release describing Shelley Staples’s selction as a CUES fellow.

Accessibility

We hope you find everything on this site works well for you. If not, please let us know and we’ll fix the problem and/or provide the information you need in an alternative format.

Unless otherwise noted, site contents are copyright © 2016–2024 by Shelley Staples and Bradley Dilger. All content published on our weblog is copyrighted by the author or authors as credited in the byline.

All content is published with the Creative Commons Attribution 4.0 International license, meaning that you are free to reuse it as long as you provide credit to Crow and any individual authors named. We ask that you also link to the original page where you found the content.

Share this:

• Research article
• Open access
• Published: 29 May 2012

Brains, tools, innovation and biogeography in crows and ravens

• Knud A Jønsson 1 ,
• Pierre-Henri Fabre 1 &
• Martin Irestedt 2  

BMC Evolutionary Biology volume  12 , Article number:  72 ( 2012 ) Cite this article

16k Accesses

42 Citations

9 Altmetric

Metrics details

Crows and ravens (Passeriformes: Corvus ) are large-brained birds with enhanced cognitive abilities relative to other birds. They are among the few non-hominid organisms on Earth to be considered intelligent and well-known examples exist of several crow species having evolved innovative strategies and even use of tools in their search for food. The 40 Corvus species have also been successful dispersers and are distributed on most continents and in remote archipelagos.

This study presents the first molecular phylogeny including all species and a number of subspecies within the genus Corvus . We date the phylogeny and determine ancestral areas to investigate historical biogeographical patterns of the crows. Additionally, we use data on brain size and a large database on innovative behaviour and tool use to test whether brain size ( i ) explains innovative behaviour and success in applying tools when foraging and ( ii ) has some correlative role in the success of colonization of islands. Our results demonstrate that crows originated in the Palaearctic in the Miocene from where they dispersed to North America and the Caribbean, Africa and Australasia. We find that relative brain size alone does not explain tool use, innovative feeding strategies and dispersal success within crows.

Conclusions

Our study supports monophyly of the genus Corvus and further demonstrates the direction and timing of colonization from the area of origin in the Palaearctic to other continents and archipelagos. The Caribbean was probably colonized from North America, although some North American ancestor may have gone extinct, and the Pacific was colonized multiple times from Asia and Australia. We did not find a correlation between relative brain size, tool use, innovative feeding strategies and dispersal success. Hence, we propose that all crows and ravens have relatively large brains compared to other birds and thus the potential to be innovative if conditions and circumstances are right.

Crows are large passerine birds that are considered intelligent because of their flexible behaviour, problem-solving abilities and social learning [ 1 , 2 ]. Several species show a number of fascinating innovations including tool use in their foraging, the best-known example being that of the New Caledonian crow ( C . moneduloides ) [ 3 – 5 ]. Such innovations in foraging are not only unique but are also expected to require increased cognitive abilities, which have been shown to be related to a brain size relatively larger than that of other birds [ 1 , 4 , 6 ]. Thus, the combination of opportunistic behaviour and intelligence should make corvids highly adaptable, competitive and potentially good colonizers of new environments [ 7 , 8 ].

The family Corvidae (crows, jays, magpies and allies) contains 117 species [ 9 ] distributed across most continents except Antarctica. Within the family, crows (genus Corvus ) make up about one third of the species diversity (40 species) and they occur on all continents except South America and Antarctica as well as in remote archipelagos such as Hawaii, Micronesia and Melanesia [ 10 ]. The Corvidae is part of the core Corvoidea radiation that contains more than 750 species. Recent studies have argued that the core Corvoidea originated in an archipelago environment north of Australia in the late Oligocene/early Miocene and dispersed via the historically complex Indo-Pacific archipelagos to the rest of the world [ 11 ]. Thus, we may expect that some or all of the core Corvoidea’s member groups could have been preadapted for dispersal and colonization and in the case of Corvus , it can be expected that this combined with large brains and the increased associated cognitive abilities would make them ideal dispersers and colonizers across the planet [ 8 ].

Species-level systematics within Corvus has been based largely on morphological data [ 12 ] or very sparse sampling for molecular phylogenies e.g. [ 13 – 15 ] and even vocalizations have been used to infer phylogeny e.g. C. enca and C. mellori , [ 16 , 17 ]. A molecular phylogeny based on extensive taxon sampling is required to establish systematic relationships within Corvus so that questions pertaining to historical biogeography, brain size and the evolution of innovative foraging habits and tool use might be addressed. Additionally, a robust and densely sampled phylogeny will provide a framework for future work on plumage evolution and various aspects of macroecology and macroevolution.

In the present study, we present a molecular phylogeny including all extant crow species and a number of subspecies sometimes assigned species rank [ 10 ]. We use the phylogeny to assess systematic relationships and to elucidate historical biogeographical patterns by dating the phylogeny and estimating ancestral areas across the tree. Furthermore, taking into account the Corvus phylogeny, we test whether ( i ) brain size is correlated with the ability to disperse to and colonize islands and ( ii ) brain size correlates with innovative feeding behaviour and tool use within crows.

Taxon sampling and laboratory procedures

We sampled all forty extant species of Corvus [ 9 ] (Table  1 ). Where possible we included multiple individuals and, for widespread species, multiple subspecies (e.g. Corvus enca Corvus macrorhynchos Corvus coronoides and Corvus frugilegus ). We also included some well-documented closely related genera to test for monophyly of Corvus : Garrulus Pica Nucifraga [ 14 ]. Lanius was used to root the tree.

Two nuclear gene regions, ornithine decarboxylase (ODC) introns 6 to 7 (chromosome 3), and glyceraldehyde-3-phosphodehydrogenase (GAPDH) intron-11 (chromosome 1), and two mitochondrial markers NADH dehydrogenase subunit 2 (ND2) and subunit 3 (ND3) were sequenced and used to estimate phylogenetic relationships. Primer pairs used for amplification were: ND2: Lmet [ 18 ]/H6312 [ 19 ]; ND3: ND3-L10755/ND3-H11151 [ 20 ]; ODC: OD6/OD8 [ 21 ], G3P13/G3P14b [ 22 ]. For the old museum specimens we only sequenced the mitochondrial genes. Corresponding laboratory procedures for study skins are detailed in Irestedt et al. [ 23 ]. Additional internal primers were designed for this study, ND3-corvR1: GTCAAATAGTAGAAACAGGATTGC; ND3-CorvF1: TTTTCAATTCGATTCTTCCTAGT; ND2-CorvR1: CTTGAACTAGAAAGTATTTGGTTGC; ND2-CorvF2:CCCCTAATCTCAAAATCTCACCA; ND2-CorvR2: CCTTGTAGGACTTCTGGGAATC; ND2-CorvF3: CTAGGACTAGTGCCATTTCACTT; ND2-CorvR3: AGATAGAGGAGAAGGCCATAATT; ND2-CorvF4: CTGAATAGGACTAAACCAAACACAA; ND2-CorvR4: AGTGTTAGTAGGAGGATTGTGCT; ND2-CorvF5: CCACACTAATAACTGCATGAACAAA; ND2-CorvR5: TGTGGGGTGGAAGTGTGATTGT; ND2-CorvF6: TCACTACTGGGCCTCTTCTTCTA. Purified PCR products were cycle-sequenced using the Big Dye terminator chemistry (ABI, Applied Biosystems) in both directions with the same primers used for PCR amplification and run on an automated AB 3100 DNA sequencer. Sequences were assembled with SeqMan II (DNASTAR). Positions where the nucleotide could not be determined with certainty were coded with the appropriate IUPAC code. GenBank accession numbers are provided in Table  1 .

Alignment and phylogenetic analyses

Sequence alignment was performed using MegAlign. The concatenated alignment consisted of 2346 base pairs (bp) and the lengths of the individual alignments were GAPDH: 299 bp, ODC intron-6 and 7: 611 bp, NADH dehydrogenase subunit 2: 1041 and NADH dehydrogenase subunit 3: 395 bp. Coding genes (ND2 and ND3) were checked for the presence of stop codons or insertion/deletion events that would have disrupted the reading frame. We used Bayesian inference [ 24 , 25 ], as implemented in MrBayes 3.1.2 [ 26 , 27 ] to estimate phylogenetic relationships. The most appropriate substitution models were determined with MrModeltest 2.0 [ 28 ], using the Akaike information criterion [ 29 , 30 ]. Bayesian analyses for the concatenated data set were performed allowing the different parameters (base frequencies, rate matrix or transition/transversion ratio, shape parameter, proportion of invariable sites) to vary between the six partitions (GAPDH, ODC, 1st, 2nd, 3 rd codon positions for mtDNA and tRNA), i.e. mixed-models analyses [ 27 , 28 ]. Two independent runs initiated from random starting trees were performed for each data set, and in all MrBayes analyses, the Markov Chain Monte Carlo (MCMC) was run using Metropolis-coupling, with one cold and three heated chains, for 10 million (individual analyses) to 20 million (combined analysis) iterations with trees sampled every 100 iterations. The number of iterations discarded before the chains had reached their apparent target distributions (i.e. the length of the “burn-in” period) was graphically estimated using AWTY [ 31 , 32 ] by monitoring the change in cumulative split frequencies, and by the loglikelihood values and posterior probabilities for splits and model parameters. We used GARLI 0.95 [ 33 ] to perform maximum likelihood analyses on the concatenated data set. Five independent analyses of 50 million generations were performed. Nodal support was evaluated with 100 nonparametric bootstrap pseudoreplications.

Dating analyses

To estimate the relative divergence times within Corvus , we used beast v.1.6 [ 34 – 36 ] and assigned the best fitting model, as estimated by mrmodeltest 2.0 [ 28 ], to each of the four partitions. We assumed a Yule Speciation Process for the tree prior and an uncorrelated lognormal distribution for the molecular clock model [ 35 , 37 ]. We used default prior distributions for all other parameters and ran MC 3 chains for 50 million generations. The program Tracer [ 38 ] was used to assess convergence diagnostics. To obtain absolute date estimates we calibrated the tree using secondary calibration points derived from Barker et al. [ 39 ] who used various approaches to date the all Passeriformes tree. Thus we used the age of Acanthisittidae versus other passerines at 76 ± 8 My SD (age within 95% confidence intervals = 62.8–89.2 My) and the split between Menura noveahollandiae and all other oscines 63 ± 2 My SD (confidence intervals = 59.7–66.3 My). In order to apply these calibration points, some additional taxa were included in the dating analyses (see Table  1 ). We also compared our age estimates with the classic mitochondrial 2% rule [ 40 ].

Biogeographical analysis

We used Bayes- lagrange [ 41 ] to assess ancestral patterns within Corvus . In a Maximum-Likelihood biogeographical analysis [ 42 , 43 ] as implemented in the software lagrange [ [ 42 ] ] , ancestral areas are optimized onto internal nodes. lagrange enables maximum likelihood estimation of the ancestral states (range inheritance scenarios) at speciation events by modelling transitions between discrete states (biogeographical ranges) along phylogenetic branches as a function of time. With the Bayes- lagrange approach it is possible to optimize on multiple trees whereby topological uncertainty is taken into account. We sampled 2000 trees (by thinning the chain stochastically) from the MCMC BEAST output, and ran lagrange on all of them. The frequency of ancestral areas for clades was then recorded and plotted as marginal distributions on the majority-rule consensus tree derived from the MCMC. The major advantage of the Bayes-Lagrange method is that the marginal distributions for the alternative ancestral areas at each node in the tree are the product of both the phylogenetic uncertainty in the rest of the tree and the uncertainty in the biogeographical reconstruction of the node of interest.

We assigned species distributions to one or more of nine geographical areas for the Bayes- lagrange analysis basing these on evidence of historical relationships of tectonic plates and terranes in the Indo-Pacific [ 44 , 45 ]: Nearctic, Caribbean, Palaearctic, Africa, Indomalaya (including the Philippines), Wallacea, Australo-papua and the Pacific. The analysis was carried out using the maxareas (= 2) option in lagrange . However, we also ran additional analyses exploring the importance of changing the maxareas (setting maxareas = 3 and 4).

Brain size, tool use and innovation

Data on brain size, which are considered a good proxy for cognition and intelligence [ 46 ], and body mass, were taken from Mlikovsky [ 47 ] and Iwanuik & Nelson [ 48 ]. Although the data are drawn from two sources, the data have been converted to reflect inner brain case volumes and are therefore directly comparable. These two datasets together include brain size data for 29 Corvus species [ 47 , 48 ]. By comparing the brain sizes for those species that are represented in both datasets it is clear that most discrepancies between the two datasets are explained by the size of the bird individuals measured. Therefore we believe that the measurements from the two datasets can be analysed combined. For a few species information on body mass was lacking in which case we used data from the CRC Handbook [ 49 ]. We compared the data on body mass used in our analyses [ 47 – 49 ] with body mass data provided in Handbook of Birds of the World [ 10 ] and found the data to be in agreement. After ln transforming the data we regressed brain size against body mass for 30 out of 40 species of Corvus . We also ran separate analyses based on the two datasets from Mlikovsky [ 47 ] and Iwanuik & Nelson [ 48 ] to account for potential differences in measuring body mass and brain size. We compiled data on tool use and innovative foraging behaviour from studies by Lefebvre et al. [ 4 ], Overington et al. [ 50 ] and Bentley-Condit & Smith [ 51 ]. Additionally, we searched the Handbook of Australian, New Zealand and Antarctic birds [ 52 ] for data on Australian crows. Altogether we found that 10 out of 40 Corvus species have a documented record of using tools and that 17 out 40 species use innovative foraging strategies. We note that opinions differ on what it means to be a “real” tool user and that some species are only known to use tools in captivity ( Corvus frugilegus ). However, this only underscores the high plasticity of this behaviour among Corvus species.

To investigate whether tool use, innovative foraging strategy and colonization of islands was associated with relative larger brain size across Corvus species, we ran a phylogenetic generalized least squares model (PGLS) in a phylogenetic framework using R version 2.10.1 [ 53 ] and the caper R package [ 54 , 55 ] as well as the ape package [ 56 ]. This statistical approach fits a linear model, taking into account phylogenetic non-independence. We tested the correlation of ln transformed brain size and ln transformed body mass as explanatory variables, with potential effect of tool use, innovation or island/continent distribution.

Molecular phylogenetics and dating

Model based analyses performed on the concatenated dataset (six partitions: GAPDH, ODC, 1st, 2nd, 3 rd codon positions for mtDNA and tRNA; maximum likelihood (ML): –ln 16528.5601, Bayesian inference (BI) harmonic mean: –ln 15872.64) yielded a 50% majority-rule consensus tree (BI) that was topologically congruent with the Maximum Likelihood tree (Figure  1 ), (for well-supported nodes receiving posterior probabilities >0.95 or bootstrap values >70%). Scores of the best likelihood trees were within 0.05 likelihood units of the best tree recovered in each of the other four garli runs, suggesting that the five runs had converged.

The 50% majority-rule consensus tree of the Corvus obtained from the Bayesian analysis of the combined dataset (GAPDH, ODC, ND2 and ND3). Above the branch is the posterior probability (only values above 0.95 are shown, asterisks indicate 1.00 posterior probabilities). Below the branch is the maximum likelihood bootstrap value (only values above 70% are shown) from 100 pseudoreplicates. Clades I-VIII are discussed in the text.

We find that the genus Corvus is monophyletic and furthermore recovered eight well-supported sub-clades that contain members more or less restricted to biogeographical regions. The basal members (Clades I-III) are distributed across the Holarctic region, the Caribbean and Africa. The Caribbean members are found in two well-supported separate clades (Clades II and III) but resolution between the clades and Corvus capensis remain unresolved. Clade IV consists of the Eurasian Corvus frugilegus and Corvus hawaiiensis . The western and eastern subspecies of C . frugilegus represent a deep split in concordance with a previous study on this species complex [ 15 ]. Clade V consists of all the African Corvus species (except C . capensis ) and the Holarctic C . corax . Clade VI consists of Holarctic species that are separated in two distinct well-supported clades, one clade of Neararctic species ( C . caurinus and C . brachyrhynchos ) and one clade of Palaearctic species ( C . corone and C . pectoralis ). Clade VII contains all the Australo-Papuan and Wallacean taxa except the Wallacean Corvus florensis . The latter species remains unresolved relative to Clades VII and VIII. Within Clade VII we also find some Pacific taxa. One subclade within Clade VII contains all Australian taxa and we also recover a well-supported Australo-Papuan clade. The relationships of the Wallacean species, however, remain unresolved at the base of Clade VII except that there is good support for a sister relationship between C . unicolor and C . typicus . Clade VIII includes the widespread C . macrorhynchos , the Indo-Malayan C . splendens and the Micronesian C . kubaryi .

Our BEAST dating analysis supports a mid-Miocene origin of Corvus dating to around 17.5 Mya (age within 95% HPD confidence intervals = 14.05–21.19 My). Our chronogram was consistent with the “2% rule” (uncorrected pairwise distances) for the rate of mitochondrial DNA sequence divergence per million years for young nodes (Pliocene to present) but suggested somewhat younger diversification times than those that BEAST determined as of Miocene age, which could be expected due to saturation in the mitochondrial genes [ 57 ]. According to the 2% rule the origin of Corvus dates to about 11 Mya. Knowledge of a Corvus fossil from North America dating back to the late Miocene [ 58 ] does not add much further insight because the author was unable to assign a systematic position. However, assuming that the fossil is closely related to the other North American taxa it supports our age estimates based on secondary calibration points.

The Bayes- lagrange analysis (Figure  2 ) finds the origin of Corvus and its closest relatives ( Pica , Nucifraga , Garrulus ) to be within the Holarctic region. The origin of Corvus , however, is Palaearctic, although some deep branches lead to taxa distributed in North America and the Caribbean. Colonization of Africa took place in the Pliocene, and colonization of Wallacea took place in the late Miocene and led to further colonization of Australo-Papua around 5 Mya. We find evidence for four colonization events of the Pacific from Asia and Australia. The Caribbean was colonized twice. One Caribbean clade is sister to a clade of North American taxa (Clade III) indicative of colonization from there. However, the ancestral area analysis postulates a Palaearctic/Caribbean origin for the other Caribbean clade (II).

A summary of the BAYES-LAGRANGE ancestral area analysis for the genus Corvus. The tree is a chronogram (pruned to include one individual per species) based on the BEAST dating analysis of a combined data set of mitochondrial (ND2 and ND3) and nuclear (GAPDH and ODC) DNA sequences. Pie charts at internal nodes indicate the probability of a given area of origin. The inset map indicates the regions demarcated for the ancestral area analyses and colours to the right of the taxon names indicate present distributions (Nearctic, Palaeearctic, Caribbean, Africa, Indomalaya, Wallacea, Australo-Papua and Pacific) and thus coding for the ancestral area analyses. Black parts of the pie charts indicate a mixture of other areas.

Brain size and tool use

We find a highly significant correlation between body mass and brain size in Corvus (P < 0.001 Figure  3 ) both for the combined dataset and when analyzing the individual datasets from Mlikovsky [ 47 ] and Iwanuik & Nelson [ 48 ]. This suggests that there are no significant differences in relative brain size between large and small Corvus species. Our analysis (Phylogenetic Generalized Least Squares) taking covariance between taxa into account, finds no correlation between brain size, tool use (P = 0.67) and innovative behaviour (P = 0.69), and no correlation between brain size and the ability to colonize islands (P = 0.46) (Figure  3 C). Seemingly, all members of Corvus have the same relative brain size and species of all sizes have innovative foraging strategies/use tools and have been able to colonize islands.

A) Phylogeny showing the taxa used in the comparative brain size analyses. Numbers in parentheses indicate the number of innovations followed by the diversity of innovations. Symbols indicate whether the taxon applies tools (upwards pointing triangle), innovative strategies (downwards pointing triangle) or both (star combining the two triangles) in its search for food. Distributions are indicated for islands (blue), continents (red) or both (grey). Island taxa are indicated in blue, continental taxa in red and combinations in grey. Residual brain size and relative brain size for the taxa are indicated to the right of the phylogeny B) Linear regression between brain and body mass. C) Box-plot displaying the difference (median, 25% and 75% percentiles and sample minimum and maximum) in relative brain size between Corvus species that use tools/no tools, Corvus species that apply innovation/no innovation and Corvus species that occur on islands/continents. Relative brain size represents residual values obtained from a linear regression between ln-transformed brain size and ln-transformed body mass.

Systematics and biogeography

The early history of the classification of the family Corvidae has been summarized by Goodwin [ 12 ] but is restricted to morphology. We present the first complete molecular species level phylogeny for the crows and ravens ( Corvus spp) including several subspecies of widespread species (Figure  1 ). Most notably, we demonstrate that what is currently classified as the Australian Raven C. coronoides , comprises two clades, one in the west ( C . c. perplexus ) and one in the east ( C . c . coronoides ). They are geographically isolated from each other only by approximately 100 km of apparently unsuitable habitat across the continent’s south coast at the Great Australian Bight. We propose that these two taxa be elevated to species rank. In contrast, populations of C . tasmanicus , geographically isolated from each other by >500 km, were not reciprocally monophyletic. Currently recognized as two subspecies, their isolation and divergence is presumably very recent. In accordance with a previous study including samples from throughout the Palaearctic, we show that C . frugilegus may also represent two distinct species, one in the western Palaearctic and one in the eastern Palaearctic [ 15 ]. C. macrorhynchos is found to be paraphyletic such that the Philippine C . macrorhynchos philippinus is sister to a clade comprising all other C. macrorhyncos , which occur in East Asia, and C. kubaryi . However, denser taxon sampling for C . macrorhynchos and population sampling for other widespread species (e.g. Corvus enca and Corvus orru ) is needed to properly revise taxonomic issues at species and subspecies levels.

Our dating analysis suggests that the radiation of Corvus began in the mid-Miocene and our ancestral area analysis indicates a Palaearctic origin (Figure  2 ). This is consistent with the two most basal members, Corvus monedula and Corvus dauuricus (Clade I) being Eurasian and with the closest extant relatives of Corvus distributed in Eurasia and North America ( Pica and Nucifraga ). This results in a signature of a Holarctic origin for Corvus and its closest relatives. We infer that two clades independently colonized the Caribbean islands in the late Miocene (Clades II and III). One Caribbean clade (II) has a long branch that leads to C . leucognaphalus C . jamaicensis and C . nasicus and our analyses suggest a Palaearctic/Caribbean origin. This could be interpreted as evidence for long distance ocean dispersal similar to that inferred in other passerine bird groups that have crossed the Atlantic e.g. Turdus [ 59 ]. Two alternative interpretations of the Caribbean having been colonized from North America are possible ( i ) extinction of a North American ancestor, (ii) an ancestral form was widely distributed in the Holarctic (like Corvus corax ) and gave rise to independent colonizations to the Caribbean followed by isolation of the North American population and a second colonization to the Caribbean (Clade III). The other Caribbean species ( C . palmarum and C . minutus ; Clade III) are sister to three North American species ( C . ossifragus C . sinaloae and C . imparatus ). This provides evidence for colonization by C . palmarum and C . minutus of the Caribbean from North America.

Relationships of an African species, C. capensis , were difficult to ascertain but it seems to represent a single Miocene colonization of Africa from the Palaearctic. C. capensis does not seem closely related to members of Clade V, which includes all other taxa that have colonized Africa and radiated within the continent. Clade VII of Indo-Pacific species has sequentially colonized Southeast Asia, Wallacea, Australo-Papua and the Pacific islands. However, the Hawaiian crow ( C . hawaiiensis ) is not a member of this clade, instead it clusters with the Palaearctic C . frugilegus (Clade IV) and so we infer it to have colonized Hawaii from East Asia. This is unexpected because the Hawaiian biota generally evolved through colonization from America whereas that of the rest of the Pacific was mostly colonized from Asia and Australo-Papua [ 60 ]. For the Corvus radiation, Asia has been the main source area for colonization of the Pacific as opposed to Australo-Papua, which is only the source area for one out of four Pacific lineages. Overall, the ancestral area analysis provides a rather clear pattern of separate colonizations of all continents except South America from the Palaearctic/(Nearctic).

Brain size, tool use and colonization

Tool use is rare in the animal kingdom and is considered restricted to primates [ 61 ], Cetaceans [ 62 ], and some birds (e.g. Psittaciformes and Passeriformes) [ 1 ]. By far the most well-known tool using bird is the New Caledonian crow ( Corvus moneduloides ) and several studies have demonstrated this island endemic crow’s ingenious abilities to use sticks to probe for larvae [ 5 , 63 ]. It is well established in the literature that cognitive abilities correlate with larger relative brain size, and that the family Corvidae have unusually large brains compared to other birds [ 64 , 65 ]. Particularly, the New Caledonian crow’s ability to use tools has been explained by its extraordinary large brain [ 6 ]. However, in the study by Cnotka et al. [ 6 ] phylogenetic relationships among crows were unknown and they were therefore unable to make appropriate phylogenetic corrections.

Several members of the genus Corvus use a variety of natural tools or advanced innovative strategies when foraging [summarized in 4]. Until now, innovative feeding techniques have been reported for 17 of the 40 species of Corvus and tool use for 10 of the 40 Corvus species ( Additional file 1 : Table S1). There is only one tool using species ( Corvus ossifragus ) that is not known to have foraging innovations and it should be noted that tool-use is usually seen as species typical and often hard-wired as evidenced by experiments on young woodpecker finches [ 66 ] and young New Caledonia crows [ 67 ], both of which “know” about tools from the start without having to learn about them.

Our analyses on body mass and brain size demonstrate that there is a significant correlation between the two variables, meaning that all crows have the same large relative brain size (similar body mass/brain size ratio). However, our comparative analyses on brain size and innovative feeding/tool use strategies within Corvus , corrected for phylogenetic relationships, reveal no correlation between the variables. This could be interpreted in two ways. Either brain size has little to do with innovative foraging strategies/tool use and thus other factors are more important in determining whether or not crows use tools or innovative feeding strategies. Alternatively, all crow species have large brains relative to other birds and thus have the potential to use tools or other innovative feeding strategies. Given that a number of studies have already demonstrated a link between cognitive abilities and brain size in both birds [ 3 , 4 ] and mammals [ 68 , 69 ] and that it is well-established that corvids have larger brains than many other birds [ 1 , 4 ], it seems the most likely hypothesis that all crows have the potential to develop innovative foraging strategies and to use tools in their search for food and there could be many reasons why this potential is only realised in some species across the Corvus tree. However, it has also been argued that total brain size may not be the ideal proxy for cognition and that measures should be taken to explore particular brain regions to explain innovation and tool-use [ 70 ]. We do not consider this study the final word on the topic, but merely a first attempt to combine phylogeny with functional traits associated with cognition and innovation in crows.

The most persistent hypothesis of large brains and corresponding enhanced cognition is that they evolved as an adaptation to handle novel or altered environmental conditions [ 71 ]. Island environments may prove particularly challenging as they, depending on the size and nature of the island, may provide fewer available niches, inferior access to food and new unknown dangers. On the other hand, a new island colonizer, could also find itself in an environment free of closely related competitors and free of inhibitors leading to occupancy of a wider range of habitats – ecological release [ 72 , 73 ]. A combination of these two extreme scenarios, however, could to some extent counteract each other, which may explain the lack of correlation between relative brain size and island colonisations in crows and ravens.

The analyses based on molecular sequence data from all recognized crow and raven species (genus: Corvus ) demonstrate that the genus is monophyletic and that it originated in the Palaearctic in the Miocene. From the centre of origin crows dispersed to North America and the Caribbean, to Africa and to Australasia, with several independent colonizations of remote Pacific islands. Our analysis comparing brain size and colonization of islands within Corvus found no correlation and we therefore conclude that colonization of islands by crows cannot be explained by brain size. We did not find a correlation between brain size, tool use and innovative foraging strategies as otherwise suggested by other studies e.g. [6,8]. Thus, there seems no reason to believe that brain size alone has any influence on tool use, innovative foraging stragegies and colonization ability within the crow lineages. Rather it would appear that large brains had already evolved in the ancestor of crows, leading to a generally high cognitive ability to deal with new challenges for crows and other corvid lineages.

Emery NJ, Clayton NS: The mentality of crows: Convergent evolution of intelligence in Corvids and Apes. Science. 2004, 306: 1903-1907. 10.1126/science.1098410.

Article   PubMed   CAS   Google Scholar  

Cornell HN, Marzluff JM, Pecoraro S: Social learning spreads knowledge about dangerous humans among American crows. Proc R Soc London B Biol Sci. 2012, 279: 499-508. 10.1098/rspb.2011.0957.

Article   Google Scholar  

Lefebvre L, Whittle P, Lascaris E, Finkelstein A: Feeding innovations and forebrain size in birds. Anim Behav. 1997, 53: 549-560. 10.1006/anbe.1996.0330.

Lefebvre L, Nicolakakis N, Boire D: Tools and brains in birds. Behaviour. 2002, 139: 939-973. 10.1163/156853902320387918.

Rutz C, Bluff LA, Reed N, Toscianko J, Newton J, Inger R, Kacelnik A, Bearhop S: The ecological significance of tool use in New Caledonian crows. Science. 2010, 329: 1523-1526. 10.1126/science.1192053.

Cnotka J, Güntürkün O, Rehkämper G, Gray RD, Hunt GR: Extraordinary large brains in tool-using New Caledonian crows (Corvus moneduloides). Neurosci Lett. 2008, 433: 241-245. 10.1016/j.neulet.2008.01.026.

Sol D, Timmermans S, Lefebvre L: Behavioural flexibility and invasion success in birds. Animal Behav. 2002, 63: 495-502. 10.1006/anbe.2001.1953.

Sol D, Duncan RP, Blackburn TM, Cassey P: Lefebvre L Big brains, enhanced cognition, and response of birds to novel environments. Proc Natl Acad Sci USA. 2005, 102: 5460-5465. 10.1073/pnas.0408145102.

Article   PubMed   CAS   PubMed Central   Google Scholar  

Dickinson EC: The Howard and Moore complete checklist of the birds of the world. 2003, Princeton University Press, Princeton, 3

Google Scholar  

Dos Anjos L: Family Corvidae (Crows). Handbook of the Birds of the World Bush-shrikes to Old World Sparrows. Edited by: Hoyo J, Elliot A, Christie DA. 2009, Lynx Edicions, Barcelona, 494-641. vol 14

Jønsson KA, Fabre PH, Ricklefs RE, Fjeldså J: Major global radiation of corvoid birds originated in the proto-Papuan archipelago. Proc Natl Acad Sci USA. 2011, 108: 2328-2333. 10.1073/pnas.1018956108.

Article   PubMed   PubMed Central   Google Scholar  

Goodwin D: Crows of the world. 1976, British Museum (Natural History), London, UK

Omland KE, Tarr CL, Boarman WI, Marzluff JM, Fleischer RC: Cryptic genetic variation and paraphyly in ravens. Proc R Soc London B Biol Sci. 2000, 267: 2475-2482. 10.1098/rspb.2000.1308.

Article   CAS   Google Scholar  

Ericson PGP, Jansén A-L, Johansson US, Ekman J: Inter-generic relationships of the crows, jays, magpies and allied groups (Aves: Corvidae) based on nucleotide sequence data. J Avian Biol. 2005, 36: 222-234. 10.1111/j.0908-8857.2001.03409.x.

Haring E, Gamauf A, Kryukov A: Phylogeographic patterns in widespread corvid birds. Mol Phylogenet Evol. 2007, 45: 840-862. 10.1016/j.ympev.2007.06.016.

Martens J, Böhner J, Hammerschmidt K: Calls of the Jungle Crow (Corvus macrorhynchos s.l.) as a taxonomic character. J Ornithology. 2000, 141: 275-284.

Rowley I: A fourth species of Australian corvid. Emu. 1967, 66: 191-210.

Hackett SJ: Molecular phylogenetics and biogeography of tanagers in the genus Ramphocelus (Aves). Mol Phylogenet Evol. 1996, 5: 368-382. 10.1006/mpev.1996.0032.

Cicero C, Johnson NK: Higher level phylogeny of vireos (Aves: Vireonidae) based on sequences of multiple mtDNA genes. Mol Phylogenet Evol. 2001, 20: 27-40. 10.1006/mpev.2001.0944.

Chesser RT: Molecular systematics of the rhinocryptid genus Pteroptochos. Condor. 1999, 101: 439-446. 10.2307/1370012.

Allen ES, Omland KE: Novel intron phylogeny (ODC) supports plumage convergence in orioles (Icterus). Auk. 2003, 120: 961-969.

Fjeldså J, Zuccon D, Irestedt M, Johansson US, Ericson PGP: Sapayoa aenigma: a New World representative of Old World suboscines. Proc R Soc London B Biol Sci Suppl. 2003, 270: 238-241. 10.1098/rsbl.2003.0075.

Irestedt M, Ohlson JI, Zuccon D, Källersjö M, Ericson PGP: Nuclear DNA from old collections of avian study skins reveals the evolutionary history of the Old World suboscines (Aves, Passeriformes). Zool Script. 2006, 35: 567-580. 10.1111/j.1463-6409.2006.00249.x.

Holder MT, Lewis PO: Phylogeny estimation: traditional and Bayesian approaches. Nat Rev Genet. 2003, 4: 275-284. 10.1038/nrg1044.

Huelsenbeck JP, Ronquist F: MrBayes: a program for the Bayesian inference of phylogeny Version 3.1.2. 2003, Available from: http://mrbayes.scs.fsu.edu/index.php

Huelsenbeck JP, Ronquist F, Hall B: MrBayes: Bayesian inference of phylogeny. Bioinformatics. 2001, 17: 754-755. 10.1093/bioinformatics/17.8.754.

Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003, 19: 1572-1574. 10.1093/bioinformatics/btg180.

Nylander JAA: MrModeltest2 Available from:. ; http://www.abc.se/~nylander/ 2004.

Akaike H: Information theory as an extension of the maximum likelihood principle. Second International Symposium on Information Theory. Edited by: Petrov BN, Csaki F. 1973, Hungary: Akademiai Kiado, Budapest, 276-281.

Posada D, Buckley TR: Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst Biol. 2004, 53: 793-808. 10.1080/10635150490522304.

Article   PubMed   Google Scholar  

Wilgenbusch JC, Warren DL, Swofford DL: AWTY: a system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. 2004, Available from: http://ceb.csit.fsu.edu/awt

Nylander JAA, Wilgenbusch JC, Warren DL, Swofford DL: AWTY (are we there yet): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics. 2008, 24: 581-583. 10.1093/bioinformatics/btm388.

Zwickl DJ: Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. 2006, PhD thesis, The University of Texas at Austin

Drummond AJ, Nicholls GK, Rodrigo AG, Solomon W: Estimating mutation parameters, population history and genealogy simultaneously from temporally spaced sequence data. Genetics. 2002, 161: 1307-1320.

PubMed   CAS   PubMed Central   Google Scholar  

Drummond AJ, Ho SYW, Phillips MJ, Rambaut A: Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006, 4: e88-10.1371/journal.pbio.0040088.

Drummond AJ, Rambaut A: BEAST v1.4.7. 2007, Available from: http://beast.bio.ed.ac.uk/

Ho SYW: Calibrating molecular estimates of substitution rates and divergence times in birds. J Avian Biol. 2007, 38: 409-414.

Rambaut A, Drummond AJ: Tracer v.1.4. 2007, Available from: http://beast.bio.ed.ac.uk/Tracer

Barker FK, Cibois A, Schikler P, Feinstein J, Cracraft J: Phylogeny and diversification of the largest avian radiation. Proc Natl Acad Sci USA. 2004, 101: 11040-11045. 10.1073/pnas.0401892101.

Weir JT, Schluter D: Calibrating the avian molecular clock. Mol Ecol. 2008, 17: 2321-2328. 10.1111/j.1365-294X.2008.03742.x.

Smith SA, Donoghue MJ: Combining historical biogeography with niche modeling in the Caprifolium clade of Lonicera (Caprifoliaceae, Dipsacales). Syst Biol. 2010, 59: 322-341. 10.1093/sysbio/syq011.

Ree RH, Moore BR, Webb CO, Donoghue MJ: A likelihood framework for inferring the evolution of geographic range on phylogenetic trees. Evolution. 2005, 59: 2299-2311.

Ree RH, Smith SA: Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Syst Biol. 2008, 57: 4-14.

Audley-Charles MG: Tectonics of the New Guinea area. Annu Rev Earth Planet Sci. 1991, 19: 17-41. 10.1146/annurev.ea.19.050191.000313.

Hall R: Biogeographic implications of the Tertiary palaeogeographic evolution of Sulawesi and Borneo. Biogeography and geological Evolution of SE Asia. Edited by: Hall R, Holloway JD. 1998, Backhuys Publishers, Leiden, the Netherlands, 133-163.

Lefebvre L: Taxonomic counts of cognition in the wild. Biol Lett. 2010, 7: 631-633.

Mlikovsky J: Brain size and forearmen magnum area in crows and allies (Aves: Corvidae). Acta Soc Zool Bohem. 2003, 67: 203-211.

Iwaniuk AN, Nelson JE: Developmental differences are correlated with relative brain size in birds: a comparative analysis. Can J Zool. 2003, 81: 1913-1928. 10.1139/z03-190.

Dunning JB: The CRC handbook of avian body masses. 1993, CRC Press, Boca Raton, FL, USA

Overington SE, Morand-Ferron J, Boogert NJ, Lefebvre L: Technical innovations drive the relationship between innovativeness and residual brain size in birds. Animal Behav. 2009, 78: 1001-1010. 10.1016/j.anbehav.2009.06.033.

Bentley-Condit VK, Smith EO: Animal tool use: current definitions and an updated comprehensive catalog. Behaviour. 2010, 147: 185-221. 10.1163/000579509X12512865686555.

Higgins PJ, Peter JM, Cowling SJ: Handbook of the Australian, New Zealand and Antarctic birds. 2006, Oxford University Press, Melbourne, Australia, Vol 7

R Development Core Team: R: a language and environment for statistical computing: R Foundation for Statistical Computing, Vienna. 2009, Available from: http://www.R-project.org

Orme D, Freckleton R, Thomas G, Petzoldt T, Fritz SE, Isaac N: 2011, http://cran.r-project.org/web/packages/caper/index.html ,

Freckleton RP, Harvey PH, Pagel M: Phylogenetic analysis and comparative data: A test and review of evidence. Am Nat. 2002, 160: 712-726. 10.1086/343873.

Paradis E, Claude J, Strimmer K: APE: analyses of phylogenetics and evolution in R language. Bioinformatics. 2004, 20: 289-290. 10.1093/bioinformatics/btg412.

Arbogast BS, Edwards SV, Wakely J, Beerli P, Slowinski JB: Estimating divergence times from molecular data on phylogenetic and population genetic timescales. Annu Rev Ecol Syst. 2002, 33: 707-740. 10.1146/annurev.ecolsys.33.010802.150500.

Bickart KJ: Part I: The Birds of the Late Miocene-Early Pliocene Big Sandy Formation, Mohave County, Arizona. Ornithological Monographs, No. 44, Recent Advances in the Study of Neogene Fossil Birds. Edited by: Bickart KJ, Chandler RM. 1990, University of California, USA, 1-72.

Voelker G, Rohwer S, Outlaw DC, Bowie RCK: Repeated trans-Atlantic dispersal catalysed a global songbird radiation. Global Ecol Biogeogr. 2009, 18: 41-49. 10.1111/j.1466-8238.2008.00423.x.

Gillespie RG, Claridge EM, Goodacre SL: Biogeography of the fauna of French Polynesia: diversification within and between a series of hot spot archipelagos. Phil Trans R Soc B. 2008, 363: 3335-3346. 10.1098/rstb.2008.0124.

Tomasello M, Call J: Primate Cognition. 1997, Oxford University Press, New York

Marino L: Convergence of complex cognitive abilities in cetaceans and primates. Brain Behav Evol. 2002, 59: 21-32. 10.1159/000063731.

Hunt GR: Manufacture and use of hook-tools by new Caledonian crows. Nature. 1996, 379: 249-251. 10.1038/379249a0.

Harvey PH, Krebs JR: Comparing brains. Science. 1990, 249: 140-146. 10.1126/science.2196673.

Lefebvre L, Sol D: Brains, lifestyles and cognition: are there general trends?. Brain Behav Evol. 2008, 72: 135-144. 10.1159/000151473.

Tebbich S, Taborsky M, Fessl B, Blomqvist D: Do woodpecker finches acquire tool-use by social learning?. Proc R Soc Lond B. 2001, 268: 2189-2193. 10.1098/rspb.2001.1738.

Kenward B, Weir AAS, Rutz C, Kacelnik A: Tool manufacture by naive juvenile crows. Nature. 2005, 433: 121-10.1038/433121a.

Baron G, Stephan H, Frahm HD: Comparative Neurobiology in Chiroptera. 1996, Birkhäuser Verlag, Basel, Switzerland, vol. I–III

Stephan H, Baron G: Frahm HD: Insectivora. 1991, SpringerVerlag, NewYork

Book   Google Scholar  

Healy SD, Rowe C: A critique of comparative studies of brain size. Proc R Soc Lond B. 2007, 274: 453-464. 10.1098/rspb.2006.3748.

Allman J: Evolving Brains. 2000, Scientific American Library, New York

MacArthur RH, Recher H, Cody ML: On the relation between habitat selection and species diversity. Am Nat. 1966, 100: 603-609. 10.1086/282454.

Losos JB, De Queiroz K: Evolutionary consequences of ecological release in Caribbean Anolis lizards. Biol J Linn Soc. 1997, 61: 459-483.

Download references

Acknowledgements

We thank a number of institutions for supplying samples for this study: AM, Australian Museum, Sydney, Australia; AMNH, American Museum of Natural History, USA; ANWC, Australian National Wildlife Collection, Canberra, Australia; FMNH, Field Museum of Natural History, Chicago, USA; NRM, Naturhistoriska Riksmuseet, Stockholm, Sweden; RMNH, Rijksmuseum van Natuurlijke Histoire, Leiden, Netherlands; UWBM, University of Washington, Burke Museum, Seattle, USA; ZMUC, Zoological Museum, University of Copenhagen, Denmark. KAJ and PHF acknowledge the Danish National Research Foundation for support to the Center for Macroecology, Evolution, and Climate. We also thank Leo Joseph, Jon Fjeldså and two anonymous reviewers for comments on the manuscript.

Author information

Authors and affiliations.

Center for Macroecology Evolution and Climate at the Natural History Museum of Denmark, University of Copenhagen, Universitetsparken, 15, DK-2100, Copenhagen Ø, Denmark

Knud A Jønsson & Pierre-Henri Fabre

Molecular Systematics Laboratory, Swedish Museum of Natural History, P.O. Box 50007, SE-104 05, Stockholm, Sweden

Martin Irestedt

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Knud A Jønsson .

Additional information

Competing interests.

The authors have no competing interests.

Authors’ contributions

KAJ designed the study, carried out the lab work, performed the phylogenetic analyses, and drafted the manuscripts. PHF carried out additional comparative analyses. MI assisted with lab work. All authors read, commented upon and approved the manuscript.

Electronic supplementary material

12862_2011_2081_moesm1_esm.doc.

Additional file 1: Table S1. List of taxa used in the comparative analyses Distribution is either insular or continental. Body mass (D) according to Dunning body mass (I) according to Iwanuik & Nelson and body mass (M) according to Mlikovsky. Brain size according to Mlikovsky and Iwanuik & Nelson. Feeding innovation according to Lefebvre et al. Bentley-Condit & Smith and Higgins et al. Feeding innovations according to Lefebvre et al. Bentley-Condit & Smith and Overington et al. [ 4 , 7 , 47 – 51 ]. (DOC 104 KB)

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2, authors’ original file for figure 3, rights and permissions.

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article.

Jønsson, K.A., Fabre, PH. & Irestedt, M. Brains, tools, innovation and biogeography in crows and ravens. BMC Evol Biol 12 , 72 (2012). https://doi.org/10.1186/1471-2148-12-72

Download citation

Received : 26 August 2011

Accepted : 17 April 2012

Published : 29 May 2012

DOI : https://doi.org/10.1186/1471-2148-12-72

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Biogeography
• Systematics

BMC Ecology and Evolution

ISSN: 2730-7182

• General enquiries: [email protected]

Human Relations Area Files

Cultural information for education and research, the intelligent crow: exploring human-animal relationships cross-culturally.

eHRAF’s subject categories of ethnozoology (OCM identifier 825), mythology (773), and religious beliefs (770) were used to explore the topic of crow intelligence. With these OCM identifiers, a large variety of human-animal relationships can be explored while potentially enriching studies focusing on human-animal relationships, animal intelligence, animal adaptions, historical ranges of animal species, and much more.

By Jeffrey Vadala

Indian jungle crow with its crab by Karthik Easvur. CC by 3.0 via Wikimedia.

Although they have brains roughly the size of an average human thumb, scientists have been learning that crows and ravens rank amongst the most intelligent of birds. Once disregarded in the world of animal intelligence studies, many crow and raven species are now ranked near primates in terms of cognitive abilities. Wildlife experts John Marzluff and Tony Angell expose crow intelligence in their 2012 book, Gifts of the Crows , writing “Corvids assume characteristics that were once ascribed only to humans, including self-recognition, insight, revenge, tool use, mental time travel, deceit, murder, language, play, calculated risk taking, social learning, and traditions. We are different, but by a degree.” Marzluff also led research which found crows can even recognize human faces .

More recently, Dr. Sarah Jelbert and her colleagues have found that crows can use “mental templates” to make simple tools; that is, they remember the rough dimensions of the tools they need and can make them from scratch. Through careful experimentation, the study provided evidence that crows do not simply mimic tool-making behavior. Instead, they copy the design of tools, transmitting mental templates of useful objects from one to another. This suggests that crows may have cumulative “tool-making culture” that is analogous to human cumulative culture (i.e., passing down and building upon information).

All said, the crow family is much smarter than we once thought. Of course, Western scientific categorization of animal intelligence is often heavily biased towards human-like expressions of intellect (Descola 2013). Studies revealing that crows have advanced intelligence would not be particularly surprising to many other cultural groups around the world that have long recognized crows and ravens as amongst the most intelligent of animal species. A cross-cultural survey focused on nonagricultural societies (agriculturalists are apt to see birds as pests), shows us that crows are often regarded as tricksters, allies, and sacred beings. Although the specific relationships with crows and ravens differ widely from culture to culture, many beliefs and myths about crows in other societies involve their unique cognitive abilities and therefore indicate that people recognize their high animal intelligence.

HRAF’s rich database of cross-cultural ethnographic data detailing human practices can be used to explore these connections. Using information retrieved from eHRAF World Cultures, this short piece will explore how crow intelligence is reflected in human-crow relationships.

Facial Recognition and Guard-Crows

An Annamese woman with her children in the garden, circa 1904. By manhhai. CC by-NC 2.0 via Flickr.

The Vietnamese people during the 19 th century (formerly known by French Colonials and early ethnographers as the Annamese people) had semi-domesticated crows. They kept crows within human company because of their extraordinary intelligence and ability to communicate. In 1881, A. Landes notes “Crows (corone macrorhyncha) may also be trained to speak, and since they are more intelligent than the other talking birds, they are much more highly valued.” Landes goes on to note that the Vietnamese used crows as household monitoring guards, saying “It is claimed that a crow can guard the house of his absent master.”

Furthermore, Landes’ data suggests that the Vietnamese believed crows could recognize individual people. Writing on this unique cognitive ability, Landes notes “A story has been told of one of these birds that revealed a wife’s infidelities to her husband, as he came back from a journey, whereupon the husband killed her” (Landes 1881, 10). A crow transmitting specific information about an infidelity may sound far-fetched, but the ethnographic information is telling nonetheless. Stories like this indicate that, during French colonial rule, people in Vietnamese society regarded crows as intelligent creatures with specific understandings of social relationships. The ethnographic data also suggests that Vietnamese people were aware of the crow’s cognitive ability to identify individual faces.

Knowledge Bearers

1860 photo of a Nenet family by Andrey Denyer (Public Domain).

The Nenet (formerly Yurak in Northern Artic Russia) people address crows when they are encountered and also adhere to prohibitions related to killing crows. Both of these dispositions are related to the Nenet belief that crows are sacred beings. Toivo Lehtisalo and Freida Schütze (1924, 55) note that the Nenets believe crows to be so sacred that modern weapons are harmed when used against them; “If someone shoots a crow, his gun is useless after that.” For the Nenet, sacredness of the crow is related to the belief that crows have a special connection to the greater landscape which gives them unique knowledge regarding the terrain and the actions of people. Lehtisalo and Schütze (1924, 55) describe how this belief plays out when Nenets travel, “if the forest Yurak moves to another place and if a crow flies along ahead of him, the bird disappears shortly before the destination has been reached. It is believed that the bird knows whither the man is moving.” Beyond navigation, Nenets regard crows as having the ability to see into the future, “If a crow cries kaee, kaee, kaee, guests are due to arrive within three days. If he cries in a strange way as though someone were beating him with a stick, it means something bad” (Lehtisalo and Schütze (1924, 56).

Extended Cognition of Thought and Memory

The one-eyed Odin with his ravens Huginn and Muninn and his weapons. From the 18th century Icelandic manuscript SÁM 66 (Public Domain).

In Viking culture, crows or ravens are considered especially important because they are the helper spirits of the powerful god Odin. As early as the 6 th and 7 th century, visual depictions show Odin accompanied by ravens or crows. The names of Odin’s animal helpers attest to how the Nordic peoples perceived these intelligent birds. Respectively pronounced “HOO-gin” and “MOO-nin,” the name Huginn refers to thought and Muninn as memory (Orchard 1997). With the ability to fly and communicate with Odin, Viking mythology indicates that Viking peoples may have believed that crows could intelligently perceive human action. By intelligently communicating, Odin’s animal helpers Huginn and Muninn, extended Odin’s senses and therefore also his personhood. Icelandic historian Snorri Sturlson (Simek 1993) describes this relationship that extends Odin’s senses beyond his own body:

“Two ravens sit on his (Odin’s) shoulders and whisper all the news which they see and hear into his ear; they are called Huginn and Muninn. He sends them out in the morning to fly around the whole world, and by breakfast they are back again. Thus, he finds out many new things and this is why he is called ‘raven-god’ (hrafnaguð).”

Respecting the Crow Priest

Pied Crow by Dick Daniels. CC by 3.0 via Wikimedia.

Writing about Nuer society, the legendary anthropologist Evans-Prichard (1956, 80) indicates that pastoral African Nuer people had great respect for the pied crow. More specifically, Evans-Prichard notes that the Nuer have a religious, totemistic and sometimes familial relationship with crows. He notes “The jakok in rol, the pied crow, a bird which frequents Nuer homesteads, is especially favoured because it is the bird of the female spirit buk, the mother of deng. Nuer say that ‘everyone respects the pied crow’, and one sometimes hears it spoken of as kuaar, priest. Nuer can therefore readily entertain the idea of a bird being the totem of a lineage, being, that is, an emblem of Spirit conceived of in relation to a lineage” (Evans-Prichard 1956, 80).

Evan-Prichard further notes that the Nuer people regard the crow as a leader whereas other bird species (like finches) are seen as sources of destruction (1934, 81). Viewing the crow as a leader or priest rather than a destructive force indicates that Nuer people encountered the crow engaging the landscape in a unique manner that stood out from other birds.

This brief cross-cultural survey of human-crow relationships demonstrates that the societies of the Annamese, Viking, Nenet, and Nuer regarded the crow as a special animal. For these cultures, the crow stood out for its intelligence, memory, knowledge, leadership, sacredness, and other culturally unique qualities. Although similar in many regards, the beliefs and practices described here vary because they arose in the context of local history and engagement with local environments. The variance in crow beliefs could be further explored by continuing research on the topic of human-crow relationships. Studying the cross-cultural knowledge and practices related to human-crow relationships could potentially enrich Western scientific understandings of crow intelligence as well.

Descola, Philippe. 2013. Beyond Nature and Culture. University of Chicago Press. Chicago.

Evans-Pritchard, E.E. 1934. “The Nuer: Tribe and Clan V-V11.” Sudan Notes and Records, Vol 17:1-57 www.jstor.org/stable/41716067.

1956. “Nuer Religion.” Oxford.Clarendon Press. http://ehrafworldcultures.yale.edu/document?id=fj22-016.

Landes, A., and Warren P. Cooper. 1881. “Notes On The Customs And Popular Superstitions Of The Annamese.” Excursions Et Reconnaissances 3 (8). Saigon: 351–70. http://ehrafworldcultures.yale.edu/document?id=am11-136.

Lehtisalo, Toivo, and Frieda Schütze. 1924. “Sketch Of A Mythology Of The Yurak Samoyed.” Suomalais-Ugrilaisen Seuran Toimituksia. Helsinki: Société Finno-ougrienne. http://ehrafworldcultures.yale.edu/document?id=ru41-017 .

Jelbert, S. A., Hosking, R. J., Taylor, A. H., & Gray, R. D. (2018). Mental template matching is a potential cultural transmission mechanism for New Caledonian crow tool manufacturing traditions. Scientific reports, 8(1), 8956.

Marzluff John and Tony Angell. 2012. Gifts of the Crow: How Perception, Emotion, and Thought Allow Smart Birds to Behave Like Humans Hardcover. New York. Atria Books.

Orchard, Andy (1997). Dictionary of Norse Myth and Legend. London. Cassell.

Simek, Rudolf. 1993. Dictionary of Northern Mythology. Translated by Angela Hall. p. 164. Suffolk, United Kingdom.:Boydell & Brewer, Limited

November 2, 2022

Crows Perform Yet Another Skill Once Thought Distinctively Human

Scientists demonstrate that crows are capable of recursion—a key feature in grammar. Not everyone is convinced

By Diana Kwon

Jenny Soups/500px/Getty Images

Crows are some of the smartest creatures in the animal kingdom. They are capable of making rule-guided decisions and of creating and using tools. They also appear to show an innate sense of what number s are . Researchers now report that these clever birds are able to understand recursion—the process of embedding structures in other, similar structures—which was long thought to be a uniquely human ability.

Recursion is a key feature of language. It enables us to build elaborate sentences from simple ones. Take the sentence “The mouse the cat chased ran.” Here the clause “the cat chased” is enclosed within the clause “the mouse ran.” For decades, psychologists thought that recursion was a trait of humans alone. Some considered it the key feature that set human language apart from other forms of communication between animals. But questions about that assumption persisted. “There’s always been interest in whether or not nonhuman animals can also grasp recursive sequences,” says Diana Liao, a postdoctoral researcher at the lab of Andreas Nieder , a professor of animal physiology at the University of Tübingen in Germany.

In a study of monkeys and human adults and children published in 2020, a group of researchers reported that the ability to produce recursive sequences may not actually be unique to our species after all. Both humans and monkeys were shown a display with two pairs of bracket symbols that appeared in a random order. The subjects were trained to touch them in the order of a “center-embedded” recursive sequence such as { ( ) } or ( { } ). After giving the right answer, humans received verbal feedback, and monkeys were given a small amount of food or juice as a reward. Afterward the researchers presented their subjects with a completely new set of brackets and observed how often they arranged them in a recursive manner. Two of the three monkeys in the experiment generated recursive sequences more often than nonrecursive sequences such as { ( } ), although they needed an additional training session to do so. One of the animals generated recursive sequences in around half of the trials. Three- to four-year-old children, by comparison, formed recursive sequences in approximately 40 percent of the trials.

On supporting science journalism

If you're enjoying this article, consider supporting our award-winning journalism by subscribing . By purchasing a subscription you are helping to ensure the future of impactful stories about the discoveries and ideas shaping our world today.

This paper prompted Liao and her colleagues to investigate whether crows, with their renowned cognitive skills, might possess the capacity for recursion as well. Adapting the protocol used in the 2020 paper, the team trained two crows to peck pairs of brackets in a center-embedded recursive sequence. The researchers then tested the birds’ ability to spontaneously generate such recursive sequences on a new set of symbols. The crows also performed on par with children. The birds produced the recursive sequences in around 40 percent of trials—but without the extra training that the monkeys required. The results were published today in Science Advances.

The discovery that crows can grasp center-embedded structures and that they are better at doing so than monkeys “is fascinating,” says Giorgio Vallortigara , a professor of neuroscience at the University of Trento in Italy, who was not involved in the work. These findings raise the question of what non-human animals might use this ability for, he adds. “They do not seem to possess anything similar to human language, thus recursion is possibly relevant to other cognitive functions," he says. One speculation is that animals might use recursion to represent relationships within their social groups.

When the 2020 study on recursive capacities in humans and monkeys was published, some experts remained unconvinced that the monkeys understood recursion. Instead, some argued , the animals chose the recursive sequences by learning the order in which the brackets were displayed. For example, if the training sequence was [ ( ) ], and the monkeys were later shown a different pairing, such as ( ) and { }, they would first pick a bracket they recognized from training, then pick the new bracket pair they had never seen before. Finally, they would pick the matching bracket from the training session at the end of the sequence (because they had learned that the matching bracket comes at the end).

To address this limitation, Liao and her colleagues extended the sequences from two pairs to three pairs—such as { [ ( ) ] }. With three pairs of symbols, the probability of producing the sequences without grasping the underlying concept of recursion becomes much lower, Liao says. Here, too, the researchers found that the birds were most likely to choose center-embedded responses.

Some scientists remain skeptical. Arnaud Rey , a senior researcher in psychology at the French National Center for Scientific Research, says the findings can still be interpreted from a simple associative learning standpoint—in which an animal learns to link one symbol to the next, such as connecting an open bracket with a closed one. A key reason, he explains, lies in a feature of the study design: the researchers placed a border around the closed brackets in their sets—which the authors note was required to help the animals define the order of the brackets. (The same bordered layout was used in the 2020 study.) For Rey, this is a crucial limitation of the study because the animals could have grasped that bordered symbols—which would always end up toward the end of a recursive sequence—were the ones rewarded, thus aiding them in simply learning the order in which open and closed brackets were displayed.

In Rey’s view, the notion of “recursive processing” as a unique form of cognition is in itself flawed. Even in humans, he says, this capacity can most likely be explained simply through associative learning mechanisms—which is something he and his colleagues  proposed in a 2012 study of baboons —and to date, there have been no satisfactory explanations of how the ability to recognize and manipulate such sequences would be coded in the human brain. According to Rey, researchers currently fall largely into two camps: one that believes that human language is built on unique capacities such as the ability to understand recursion and another that believes it emerged from much simpler processes such as associative learning.

But Liao notes that even with the help of the borders, the crows still had to figure out the center-embedded order where open and closed brackets were paired from the outside in. In other words, if the birds only learned that open brackets were at the beginning of the sequence and closed ones were at the end, you would expect an equal proportion of ( { ) } mismatched and correct responses. But, she says, her and her colleagues found that the crows chose more of the latter than the former, even with the more complex sequences of three pairs of brackets.

For Liao, seeing that birds whose ancestors long ago diverged from those of primates on the branching evolutionary tree of life—also appear to be able to parse and generate recursive sequences implies that this capacity is “evolutionary ancient” or that it developed independently as a product of what is known as convergent evolution. Because birds’ brain lacks the layered neocortex of primates, this observation, Liao adds, suggests that the latter brain architecture may not be necessary for displaying this cognitive ability.

For Mathias Osvath , an associate professor of cognitive science at Lund University in Sweden, who was not involved in the new paper, its findings fit into a long line of studies indicating that birds possess many of the same cognitive skills as primates. “To me, this just adds to the catalog of amazing data showing that birds have been completely misunderstood,” Osvath says. “Saying that mammals took over the world cognitively is just simply wrong.”

house crow Recently Published Documents

Total documents.

• Latest Documents
• Most Cited Documents
• Contributed Authors
• Related Sources
• Related Keywords

The genetic drivers for the successful invasive potential of a generalist bird, the House crow

Sighting of a leucistic house crow corvus splendens vieillot, 1817 in bastar plateau, chhattisgarh, india, molecular identification and phylogenetic relationship of corvus splendens (common house crow) by cytochrome c oxidase subunit i gene.

Abstract The traditional taxonomic approach for identification of species and their phylogenetic relationship is handicapped due to its limitations. The present study is carried out to evaluate the genetic identification and phylogenetic status of Corvus splendens (Common house crow) using mitochondrial cytochrome c oxidase subunit 1 (COX1). We amplified 690bp region of COX I from crow specimens collected from seven cities of Punjab. The PCR product was got sequenced and submitted to NCBI. Multiple sequence alignment was done among 10 Pakistani specimens and 18 species of common crow belonging to different families obtained from GenBank database using Gyps indicus as an outgroup. Phylogenetic tree was constructed among various Crow species by Neighbor Joining method (NJ) in MEGA X. It shows that KAS2 & NAR2 were very similar and shared evolutionary relationship with Common house crow from India. While KAS3 and LHR5 showed very close resemblance and shared common ancestry with the NAR3. The relative time tree shows the SKT2 evolved earlier than BHR1, PKT2, BHR2 & GUJ3 while the later were evolved at the same time. Further, the entire crow species irrespective of regions evolved almost at the same time with very little time difference. The genetic distance among the Common house crow from different localities showed very low degree of sequence divergence despite long physical distances among them. Overall, our analysed Corvus splendens were closely related to each other and evolved at same time. Moreover, these crows were closely related to other crow species dispersed all over the world.

Biomonitoring of Toxic Metals in Feathers of Birds from North-Eastern Pakistan

AbstractThe current study was designed to determine the concentrations of toxic metals (Ni, Pb and Cr) in feathers of birds collected from four regions of NE Pakistan. Feather samples of birds (House Crow, Common Myna and House Sparrow) were collected from different areas. Atomic absorption spectrophotometer was used to determine the concentration of metals in feathers. Analysis of the data revealed that concentrations of Pb and Cr were significantly different (p < 0.05) among bird species, whereas no difference (p > 0.05) was detected among bird species (house crow, common myna and house sparrow) for Ni. A significant difference was found for the concentration of Pb and Ni in all the four studied regions. Whereas, non-significant difference was found in all the studied regions for the concentrating of Cr. It was revealed that there is significant rising concentration of metals (Pb, Cr) in feathers of birds in Azad Kashmir.

Co-breeding involving herons and a potential egg predator, the Indian House Crow (Corvus splendens), in Peninsular India

Ecology of house crow (corvus splendens) in dir lower, khyber pakhtunkhwa, pakistan, incidence of decreasing population of house crow (corvus splendens) in some pockets of malwa region of punjab, india, detection and genetic characterization of avian influenza a (h5n6) virus clade 2.3.4.4 in isolates from house crow and poultry in bangladesh, 2017, impact of vehicular traffic on birds in tiruchirappalli district, tamil nadu, india.

Roads have numerous direct and indirect ecological impacts on wildlife.  Roads constitute an extensive and integral part of our environment.  Collisions with vehicles kill a large number of birds every year.  The present study was carried out from January 2016 to December 2016.  The data was collected from Nehru Memorial College to Pavithram Lake of Thuraiyur to Namakkal road of Musiri Taluk, Tiruchchirappalli District.  During this study, we recorded a total of 64 birds belonging to 12 species killed due to vehicular traffic.  A maximum of 11 birds were killed in the months of January and October, and a minimum of two bird kills were observed in the months of September and December.  Of the 64 birds, the roadside mortality was observed to the tune of 25%, 20.3%, 14%, 12.5%, 10.9%, 4.6%, and 4.6% for Southern Coucal Centropus parroti, Common Myna Acridotheres tristis, House Crow Corvus splendens, Spotted Owlet Athene brama, Indian Jungle Crow Corvus culminatus, Yellow-billed Babbler Turdoides affinis, and Large Grey Babbler Turdoides malcolmi.  Other birds such as Asian Koel Eudynamys scolopaceus, Indian Roller Coracias benghalensis, Shikra Accipiter badius, White-breasted Waterhen Amaurornis phoenicurus, and White-browed Bulbul Pycnonotus luteolus accounted for 1.5% mortality.  Suggestive measures to prevent wildlife loss due to vehicular traffic are presented in this communication. 

Exploration of Antibacterial Compounds from the Commiphora myrrha Through GC-MS and Their Evaluation Against the Bacteria Isolated from Corvus splendens

The Corvus splendens (Indian house crow) normally fed on the garbage therefore, they have many pathogenic bacteria, which can infect the human and cause severe infection in human irrespective to the gender, age and region. The bacteria samples were isolated from the faeces, blood lever, and intestines of the crows in Luria-Bertani (LB) agar plates. The culture plates were incubated at 37°C until the colonies were appeared. The colonies were identified morphologically and through molecular marker using 16S-rDNA. The Commiphora myrrha plant extract was used to determine the antibacterial activities against the pathogenic bacteria isolated from crows. The plant was crushed with 70% methanol and filtered. The filtrates were dried and dissolved in 100% methanol. Antibacterial activities of plant extracts were determined against the pathogenic bacteria isolated from crows. The results showed that the plant extracts were very effective against the pathogenic bacteria and showed 100% antibacterial activities. The plants extracts were analyzed for the characterization of different antimicrobial compound through gas chromatography mass spectrometry (GC-MS). The undecane, tetrasiloxane, hexadecanoic acid, heptasiloxane, benzocyclohepten and many other compounds. The antibacterial activities of the plant extracts were might be because of their compound which had been reported previously as well as an antimicrobial compound.

Export Citation Format

Share document.

Featured Topics

Featured series.

A series of random questions answered by Harvard experts.

Explore the Gazette

Read the latest.

Professor tailored AI tutor to physics course. Engagement doubled.

Did lawmakers know role of fossil fuels in climate change during Clean Air Act era?

Spin squeezing for all

Credit: Cody McCoy

Clever crows

Peter Reuell

Harvard Staff Writer

After using tools, the birds behave more optimistically, study suggests

It’s no secret crows are smart. They’re notorious for frustrating attempts to keep them from tearing into garbage cans; more telling, however, is that they are one of the few animals known to make tools.

But would you believe doing it actually makes them happy?

That’s the finding of a recent paper, co-authored by Dakota McCoy, a graduate student working in the lab of David Haig, George Putnam Professor of Biology, who found that crows behaved more optimistically after using tools. The study is described in an Aug. 19 paper in Current Biology.

“What this suggests is that, just the same way we enjoy something like solving a crossword, they actually enjoyed simply using a tool,” McCoy said. “I think it suggests there’s a lot more going on in that little head than we think. They get satisfaction out of doing things they’re good at, have trained for their whole lives, and that they use frequently.”

While tool use in the animal kingdom is not unheard of — chimps use sticks to “fish” for termites and other animals use rocks to smash open nuts or shells — New Caledonian crows stand out for manufacturing multiple complex tools and regularly refining their designs.

But how can making and using tools make an animal feel good? A clue, McCoy said, lies in looking at how complex actions make humans feel.

“I think we tend to under-anthropomorphize animals, especially really intelligent animals,” she said. “It’s not that they are machines, and we are feeling beings. Clearly, animals also have emotional reactions and moods.”

“Maybe crows are just like humans … when they’re doing these complicated actions, they’re reinforced not just by getting a prize out of it, but because they actually enjoy the process itself,” said graduate student Dakota McCoy.

Stephanie Mitchell/Harvard Staff Photographer

And, one of those emotions is the pleasure of accomplishment.

“One potential answer for why tool use evolved is because crows are used to picking up objects and caching them,” she said. “They actually love, when you’re experimenting with them, to pick up your equipment and cache it way up high where you can’t get it.”

Once crows started using tools, she said, the fact that it made them feel good encouraged them to keep at it, refining and developing the behavior further.

“Maybe crows are just like humans and other primates in that, when they’re doing these complicated actions, they’re reinforced not just by getting a prize out of it, but because they actually enjoy the process itself,” she said.

To understand how crows felt about using tools, McCoy and colleagues devised an experiment to test how optimistic the birds were feeling.

“We do have subtle ways to test mood, and the classic paradigm is a glass half filled with water,” she said. “Someone who is feeling pessimistic will interpret it as half empty, while an optimistic person will see it as half full.”

For the crows, researchers conceived a similar test.

In the lab, crows were trained using a small box. When placed on the left side of a table, the box always contained a large reward — three pieces of meat. On the right side, it contained just a scrap of meat, a far smaller reward.

Once the crows understood the difference, researchers placed the box in the middle of the table. If the birds quickly came to investigate that ambiguous box, it suggested they were optimistic that they would find a large reward. If they waited or didn’t visit the box at all, it suggested they were more pessimistic.

To test how they felt about tool use, the crows were then put through a series of tests over a number of days — one in which they had to use a tool to extract a piece of meat from a box and another in which the meat was readily available.

“But we thought that it might not be that tool use puts them in a good mood, it could be just that they had to work harder,” McCoy said. “So we [added] two more conditions. In one the meat was right on the table so there was no effort involved, and in another “effortful” condition, they had to fly around to the four corners of the room to retrieve each piece of meat.”

The results, she said, showed that, following tool use, the birds were much quicker to approach the ambiguous box, and much less enthusiastic after the effortful test compared to the easy test.

“They enjoyed the easy condition, that was no surprise,” McCoy said. “But the surprise was that, clearly, they don’t just like tool use because it’s difficult. We controlled for difficulty and that wasn’t what was motivating their interest — there is something specific about tool use they’re enjoying.”

More like this

So you think he can dance?

Brainy birds

The parrot knows shapes

While it’s impossible to say for certain exactly what the birds were feeling, McCoy said her study is far from the first to attempt to gauge what effects animals’ moods.

“Many people have done studies about what kind of mood animals are in … but the research to date has almost exclusively been on captive animals, and what kind of circumstantial changes can improve their mood,” she said. “Many people have shown that animals’ mood improves if you do something like give them a larger cage, but this study shows that animals also have a better mood if you give them complex, fun tasks to do.”

McCoy, who is a student in the Graduate School of Arts and Sciences, said that she hopes to see the findings of the study applied to improving the lives of animals in captivity.

“Our findings suggest that one way to improve the welfare of captive animals is to give them complex, species-specific enrichment where they’re using skills they have … to achieve goals instead of just receiving passive enrichment,” she said. “We’re far from a world where we don’t have animals in captivity … but they could live a much more enriching life if they’re housed socially and given fun tasks to solve.”

This research was supported with funding from the Department of Defense, Air Force Office of Scientific Research, National Defense Science and Engineering Graduate (NDSEG) Fellowship, a Theodore H. Ashford Graduate Fellowship, a Royal Society of New Zealand Rutherford Discovery Fellowship, a Prime Minister’s McDiarmid Emerging Scientist Prize, and the Max Planck Institute for the Science of Human History.

Share this article

The Mesoamerican attraction to magnetism

Probiotic hydrogels heal gut wounds that other treatments can’t reach

Mercury levels in fish are on the rise

A red oak live tweets climate change

You might like.

Preliminary findings inspire other large Harvard classes to test approach this fall

New study suggests they did, offering insight into key issue in landmark 2022 Supreme Court ruling on EPA

Physicists ease path to entanglement for quantum sensing

Billions worldwide deficient in essential micronutrients

Inadequate levels carry risk of adverse pregnancy outcomes, blindness

You want to be boss. You probably won’t be good at it.

Study pinpoints two measures that predict effective managers

Weight-loss drug linked to fewer COVID deaths

Large-scale study finds Wegovy reduces risk of heart attack, stroke

Scientists Suggest a New Layer to Crows’ Cognitive Complexity

The birds may be able to grasp a pattern-forming concept once thought to be unique to humans

Will Sullivan

Daily Correspondent

Time and again, it seems , research has revealed crows performing some cognitive task that defies our expectations. Now, a new paper claims the birds can understand a certain kind of pattern, displaying an ability that scientists once thought was unique to humans.

Researchers tested whether crows can grasp the concept of recursion, which they define as “the process of embedding structures within similar structures” in their paper published in November in Science Advances .

Humans use recursion in language when we embed one clause within another to form a complex sentence, writes Scientific American ’s Diana Kwon. For example, if a human says, “The ball the bat hit flew,” they’ve nested the clause “the bat hit” inside of “the ball flew.”

Scientists have long wondered whether understanding these patterns is unique to humans. “There’s always been interest in whether or not nonhuman animals can also grasp recursive sequences,” Diana Liao , the study's lead author who studies bird cognition at the University of Tübingen in Germany, tells Scientific American . In the early 2000s, linguists hypothesized that human language is the only form of animal communication that uses recursion, according to the Wall Street Journal ’s Dominique Mosbergen.

However, in a 2020 study also published in Science Advances , researchers proposed that rhesus macaque monkeys might be able to create recursive sequences as well. The monkeys performed at the level of 3- to 5-year-old human children given the same sequence-creating task, but they required more training to do so, according to the Wall Street Journal .

In the new study, the researchers performed a similar experiment on two crows. They trained the birds to peck at sets of brackets, such as { } and [ ], in a recursive pattern, for example, { [ ] }. During training, the crows received birdseed pellets or mealworms for successfully forming recursive sequences, per the Wall Street Journal .

Then, when presented with pairs of brackets that they hadn’t seen before—such as ( [ ] )—the crows correctly formed embedded structures around 40 percent of the time. They had a similar success rate to children and performed better than the monkeys in the 2020 study, per the Wall Street Journal . They also didn’t need the extra training the monkeys received.

While the study only used two crows, that doesn’t necessarily mean the findings aren’t noteworthy. “It is a small sample size, which means you can’t make generalizations about populations of crows, but that wasn’t the point,” Stephen Ferrigno , a cognitive scientist at the University of Wisconsin-Madison who co-authored the 2020 monkey study but was not involved with the new paper, tells the Wall Street Journal . “All you need is a single example showing that crows can do this.”

Some other researchers aren’t persuaded by the study's conclusions. Noam Chomsky , one of the linguists who first suggested recursion is unique to human communication, tells the Wall Street Journal he isn’t convinced either study demonstrates that non-humans understand recursion.

After all, it’s possible that the birds learned to peck the shapes in the right order without actually grasping the bracket-nesting concept.  Arnaud Rey , a psychologist at the French National Center for Scientific Research, tells Scientific American that the findings could be interpreted as the birds simply learning to link one bracket to the next, as opposed to embedding one pair inside another.

Either way, the paper is not the first to suggest that crows could be more cognitively complex than we might assume. Other research has found that crows can make tools and store them for future use. The birds can also recognize their own faces (and remember  humans’ faces ), writes Haaretz ’s Ruth Schuster.

“To me, this [study] just adds to the catalog of amazing data showing that birds have been completely misunderstood,” Mathias Osvath , a cognitive scientist at Lund University in Sweden who did not contribute to the new research, tells Scientific American . “Saying that mammals took over the world cognitively is just simply wrong.”

Get the latest stories in your inbox every weekday.

Will Sullivan | | READ MORE

Will Sullivan is a science writer based in Washington, D.C. His work has appeared in Inside Science and NOVA Next .

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Proc Biol Sci
• v.287(1938); 2020 Nov 11

New Caledonian crows plan for specific future tool use

1 Department of Psychology, University of Cambridge, Cambridge, UK

2 Karl Landsteiner University of Health Sciences, Krems an der Donau, Austria

3 Department of Psychiatry and Psychotherapy, University Hospital Tulln, Tulln, Austria

M. Schiestl

4 School of Psychology, University of Auckland, Auckland, New Zealand

5 Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany

7 University of Veterinary and Pharmaceutical Sciences, Brno, Czech Republic

A. Frohnwieser

T. suddendorf.

6 School of Psychology, University of Queensland, Brisbane, Australia

A. H. Taylor

N. s. clayton, associated data.

The full dataset is available on Open Science Framework OSF: https://osf.io/muaw9/?view_only=5908e4dcb90941be85a2d5344222ec9b .

The ability to plan for future events is one of the defining features of human intelligence. Whether non-human animals can plan for specific future situations remains contentious: despite a sustained research effort over the last two decades, there is still no consensus on this question. Here, we show that New Caledonian crows can use tools to plan for specific future events. Crows learned a temporal sequence where they were (a) shown a baited apparatus, (b) 5 min later given a choice of five objects and (c) 10 min later given access to the apparatus. At test, these crows were presented with one of two tool–apparatus combinations. For each combination, the crows chose the right tool for the right future task, while ignoring previously useful tools and a low-value food item. This study establishes that planning for specific future tool use can evolve via convergent evolution, given that corvids and humans shared a common ancestor over 300 million years ago, and offers a route to mapping the planning capacities of animals.

1. Background

Can non-human animals plan for specific future situations? Despite a sustained research effort over the last two decades, there is still no consensus on this question [ 1 – 15 ]. The ability to plan for future events is one of the defining features of human intelligence [ 1 , 16 , 17 ]. The extent to which this ability is unique to our species has been hotly debated for over two decades [ 1 – 9 , 18 ]. The main reason for this is that alternative explanations can account for the reported animal successes. Consider the most prominent task, ‘the spoon test’ [ 17 , 19 ]: to pass the spoon test, the subject must select a tool for an event that might happen in the future. Typically, there is a single choice from a number of objects, of which only one can be used to solve the problem. Both apes and corvids have been shown to ignore distractor objects and instead choose the functional object, thereby passing the test [ 2 , 6 , 8 ]. However, there have been concerns that choices could be driven by the value of the target object in the present being higher than those of the distractor objects, rather than by the animal imagining the future utility of the tool [ 1 , 7 , 9 , 20 – 22 ]. These concerns have persisted despite some attempts to address them or rule them out (e.g. [ 6 , 8 , 23 , 24 ]), and recently received empirical support from a study on children [ 22 ]. After seeing a specific problem, the children were presented with two objects that had high value. One of these objects could be used to solve the observed problem, while the other could not. Children under the age of five chose at chance between these objects, despite clearly being able to remember which problem they had observed. These results demonstrate that associative learning can drive successful performance on the spoon test, rather than the use of foresight, thereby substantiating the possibility that previous spoon test studies may have reported false positives for the presence of planning in animals.

One way to provide more compelling evidence of planning would be to present animals with a more stringent test where they have to choose between multiple tools after observing a specific problem being set up, such that the same objects function as solution in one condition and as distractors in another [ 7 ]. In this situation, each tool would have high value due to it being associated with positive outcomes in the past, but would only be useful when the correct problem was available in the future. By varying the problem that will be available in the future, it would be possible to see if an animal can choose the correct tool for a particular anticipated task. Successful solution of such tasks would demonstrate that an animal is capable of planning for specific future tool problems. Our study brought together researchers who have published contrasting ‘rich’ and ‘lean’ interpretations of animal planning studies to run a pre-registered version of such a test.

The methodology has been described previously [ 25 ] and was used in a similar way to test flexible planning in young children [ 26 ].

(a) Subjects

New Caledonian crows were housed for 5 months in an outside aviary on the island of Grand Terre, New Caledonia. Based on the sexual size dimorphism [ 27 ] four of the nine crows were females (Mercury, Neptune, Triton, Uranus) and five were male (Io, Jupiter, Mars, Saturn, Venus). Based on the coloration of their beaks, five of the crows were juveniles under one year of age (Neptune, Triton, Jupiter, Mars, Venus) and four were adults over 2 years of age (Mercury, Io, Saturn, Uranus). The aviary had 10 cages, each measuring at least 2 × 3 × 3 m. Access to water was granted ad libitum. The general diet was fruits and soaked dog food. Pieces of meat functioned as rewards during training and testing. All testing took place in two compartments that were visually inaccessible to each other and the other crows. Our work was carried out under the approval of the University of Auckland Animal Ethics Committee (reference no. 001823).

(i) Participation of individuals across trials

Nine individuals entered training. Three individuals (Jupiter, Io, Mercury) did not reach criterion in the tool functionality training and were therefore excluded from later procedures and testing. Two crows were unable to make correct choices in Conditions 1 and 2 (Mars, Venus). The remaining subjects took on average 22 trials to reach training criterion. Four individuals (Saturn, Neptune, Triton, Uranus), reached training criterion at C1 and C2 and then entered the testing phase (C3 and C4) and three individuals were tested in the follow-up (Neptune, Triton, Uranus).

(b) Apparatus

We used three types of apparatus, namely a remote-controlled feeder apparatus (the dispenser apparatus), a stone dropping collapsible platform box (the platform apparatus) and a horizontal Perspex tube (the tube apparatus). The dispenser apparatus consisted of a wooden box 33 × 30 × 20 cm with a 6.3 × 3 cm slot in its top surface, into which the crow could insert items ( figure 1 ). It contained a disc, which turned when activated by a remote-control button, dispensing one piece of food. Birds were trained to drop a hook tool into the object slot to get food. The platform apparatus was a 16 × 10 × 10 cm transparent Perspex box of the same design as that used in past work on physical cognition in corvids [ 28 – 31 ]. It had a collapsible trap-platform within the box that released a food reward when a stone was dropped onto it. To prevent stick tools from being able to release this mechanism, we installed a 12 cm long tube with a diameter of 5 cm and a slant of 30° in the middle. Birds were trained to drop stones into this apparatus. The tube apparatus was a horizontal Perspex tube, 18 cm long, with a diameter of 5 cm, mounted 8 cm above a base. Birds had to insert a wooden stick tool to push or pull the meat reward out of the tube.

The three apparatuses used in the study: ( a ) dispenser apparatus, ( b ) platform apparatus, ( c ) tube apparatus. ( d ) The tool presentation box, including a stick, stone and hook as tools, apple as a lower-quality food reward and a ball as a distractor object. The ball as a distractor was introduced one day before the first presentation of the five-choice tool functionality training. (Online version in colour.)

(c) Procedure

All birds participated in various experiments before the presented study [ 31 – 33 ]. The training specifically required for the current study are tool use training, tool selection training, apparatus functionality training, hook training and tool transport training, five choice tool functionality training, and the temporal sequence training, which is outlined in the description of Conditions 1 and 2. For a detailed and complete description of the prior experience and specific training stages, see below and electronic supplementary material.

(i) Training phase

New Caledonian crows were first trained to use three tool-apparatus combinations (stick to tube, stone to platform, hook to dispenser; figure 1 ). We used two compartments; one in which the baited apparatus was presented without the tool and one where the choice between objects was presented ( figure 2 ). Compartments were directly adjacent to each other but did not allow visual access to each other when the connecting door was closed.

Compartment set-up. ( a ) The test compartments. The left compartment contains a table, on which the tool presentation box was placed in the choice phase. The right compartment contains a small table where the apparatus was placed at inspection phase and accession phase. Crows could move between compartments when a sliding door was opened. Condition 1: crows observe a tube baited with meat (C1 1 ) for 1 min, after which they are moved to the left compartment. After 5 min, they are presented with the three tools, a distractor and low value apple (C1 2 ). Once a choice has been made the tool presentation box is removed. After 10 min the door to the right compartment is opened, allowing the crows to access the food if they have chosen the stick (C1 3 ). Condition 2: crows observe that the tube is baited with low value apple (C2 1 ), and then are presented with the choice of three tools, a distractor and meat (C2 2 ). Once a choice is made the presentation box is removed, and after 10 min the crows are allowed access to the apparatus (C2 3 ). Conditions 3 and 4: test conditions. Crows are given alternating trials of C3 1–3 and C4 1–3 , where they see the platform apparatus (C3 1 ) or the dispenser apparatus (C4 1 ) baited with food, and then are moved to the next door compartment, where, 5 min later, they are presented with the tool presentation box containing three tools, a distractor and low value apple (C3 2 and C4 2 ). To gain the meat the crows need to choose a stone in C3 2 and the hook in C4 2 , so they can take this tool to the apparatus in the next door compartment 10 min later (C3 3 and C4 3 ). We trained the birds in C1 and C2 to understand that the specific future event will differ from the next one and that they have to be attentive to the presented apparatus. This is one of the critiques of the study by Kabadayi & Osvath [ 8 ]. Thus, the actual test is when birds have ‘learnt’ the temporal rule and then in the test phase are presented with new apparatus–tool combinations they have to plan for. (Online version in colour.)

Then birds were trained that a specific temporal sequence would occur during the experiment (Conditions 1 and 2). Conditions 1 and 2 were run with the tube apparatus. In Stage 1 they would be shown a baited apparatus for 1 min. After this, the bird was moved to the next-door compartment and the connecting door was closed so the crows had no visual access to the other compartment. After 5 min in this compartment, the birds were presented with the tool presentation box containing five objects: a stick, a hook template, a stone, a distractor object and a very small piece of apple (Stage 2). Positions of the objects with the box were pseudorandomised across trials. After making a choice, this apparatus was removed. Ten minutes later the door was re-opened to the next-door compartment (Stage 3) and given access to the baited apparatus they had observed in Stage 1. Thus, birds were allowed to take the tool they had chosen in Stage 2 to the apparatus.

To train the crows on this sequence of events, in Condition 1, we placed highly valued meat in a long horizontal tube at Stage 1, gave crows the choice of a stick, a hook, a rock, a distractor object and lowly valued apple at Stage 2, and then gave crows access to the meat-baited tube at Stage 3 ( figure 2 ). The optimal choice in Condition 1 at Stage 2 was to take the stick while ignoring the other objects, so it could be used 10 min later to get the meat from the tube in Stage 3. In Condition 2, in contrast, we placed low-value apple in the tube in Stage 1. Crows were then given the choice of a stick, a hook, a rock, a distractor object and highly valued meat at Stage 2, before being presented with the apple-baited tube in Stage 3. The optimal choice in this condition was to ignore the tools and take the meat during Stage 2, as the crows could only get low-value apple in the future if they chose the stick. Trials in which birds who chose meat in Stage 2 were ended after the choice. Four of the six crows tested were able to make correct choices in Conditions 1 and 2, with subjects taking on average 22 trials to learn this. Birds received alternating trials of Conditions 1 and 2 until they reached a criterion of 7/10 correct trials for each of these conditions.

If the birds dropped or placed the tool within the aviary, birds had to retrieve the tool from this location unless it was out of reach. If the tool fell in a position the birds were not able to retrieve, the tool was retrieved by the experimenter and placed at the closest location to the place it fell that was again reachable for the bird, which happened on 10 out of 167 trials (also see table 3 ). In trials where birds did not choose a tool, the trial was terminated and treated as a wrong choice. In any cases where a wrong tool was chosen, the trial continued and the crows were given the opportunity to interact with the tool and the apparatus.

Table 3.

Choices of individuals per condition and trial. h, hook; s, stick; o, stone; m, meat, a, apple; r, bird did not choose a tool, trial was finished thereafter; ‘: tool lost and replaced by experimenter; correct choices are highlighted in green, incorrect choices are highlighted in orange.

(ii) Testing phase

The critical part of our study was the test Conditions 3 and 4, in which the crows were presented with trials involving the same temporal sequence. Testing conditions were identical to the training phase except for the identity of the apparatus that was presented at Stage 1. In training, this had always been the tube apparatus.

In Condition 3, we set up a drop-down platform apparatus operated by a stone at Stage 1, meaning crows now had to choose the stone in Stage 2 while ignoring the other objects and the low-value apple in order to obtain the meat at Stage 3. In Condition 4, we set up a dispensing apparatus operated by a hook, meaning crows now had to choose the hook while ignoring the other objects and the low-value apple. We chose apple as low-value immediate reward based on a preference test conducted in a previous study, in which they chose apple over tools [ 34 ]. Crucially then, to get their preferred food item, the crows had to select a tool appropriate for the apparatus they had reason to expect, through their experience in the training conditions, would be available in the future. They had never before experienced these test conditions, and had to ignore the object that now had the highest value, the stick, which had been associated more with food in Conditions 1 and 2 than the other choices. The crows could only take advantage of the future event that would occur 10 min later in Stage 3 if they chose, at Stage 2, the specific tool required for the apparatus that they had seen set up in Stage 1, and which critically, they had had no further visual access to. Each of the four crows that passed Conditions 1 and 2 were given alternating trials of Condition 3 and Condition 4 until they had received five trials of each. To solve the task and get the food crows had remember what apparatus they had seen 5 min ago during Stage 1 and then select the correct tool during Stage 2, while ignoring the other functional tools, the distractor item and the low value apple. It is important to note that in Conditions 3 and 4 crows observed either a stone or hook apparatus, then 5 min later were given a choice of five objects, and then 10 min later were given access to the apparatus. Crows had never experienced this sequence of temporal events with these objects. When choosing objects, the crows only had the memory of what they had seen at the observation Stage 1 to guide them. If crows were using the relative value of each object, as predicted by an associative learning account, in Conditions 3 and 4 crows should have chosen the object most associated with past reward, namely the stick tool. If subjects were choosing at chance we predicted they would choose the correct object only 20% of the time, given there were five objects to choose from. For a sample video, see [ 35 ].

(d) Statistics

With a 0.2 chance level (choosing one correct object out of the five offered) a bird needed to get five trials out of 10 correct to be above chance at p < 0.05 (one-tailed p = 0.026) at test or six trials out of 10 correct to be above chance at p < 0.01 (one-tailed p = 0.005). All statistical tests were conducted in R [ 36 ].

Four of the six crows tested showed performance above chance and reached the criterion in Conditions 1 and 2, taking between 20 and 25 training trials to learn the temporal rule. These four individuals were then tested in the critical test Conditions 3 and 4, where novel tool-apparatus combinations were presented ( table 1 ). Three out of the four tested crows performed significantly above chance across these Conditions 3 and 4, with one subject scoring 9/10 and two subjects scoring 7/10 (binomial choice between five choices, p < 0.001). Learning effects in training can be shown when individuals Mars and Venus, which did not pass criterion in Conditions 1 and 2, are excluded (no learning effect when the two individuals are included; table 2 ). No learning effect can be shown in Conditions 3 and 4. Detailed performances of individuals are presented in table 3 .

Table 1.

Performance of individuals. Mars and Venus did not pass criterion in Conditions 1 and 2.

Table 2.

Results of full generalized linear mixed model looking at learning effect in training and testing. When individuals that did not pass criterion in Conditions 1 and 2 are excluded ( n = 4) a significant training effect can be shown. With the two individuals ( n = 6), no learning effect is present as the effect trial is not significant and the base model without trial as fixed factor is not different from the model with trial included ( p ≥ 0.05). St.E, standard error.

4. Discussion

These results provide evidence that New Caledonian crows can plan for specific future tool use. Across Conditions 3 and 4, three of the four crows tested changed their object choices depending on which apparatus they observed being set up in Stage 1. Therefore, their performance was clearly not based on a preference for a specific tool type but on their observation of which problem they would have available to them in the future.

Our study also shows that New Caledonian crows can learn to use novel tools to prepare for specific anticipated events. That is, the crows’ choices were made regarding tool behaviours learnt in our aviary rather than tool use behaviours that are in this species' repertoire of natural behaviours. Stone tool use has not been observed in any wild New Caledonian crow population, while hook tool use has been observed in other populations [ 37 ], but not in the one these crows were sampled from. Hook tool use in our study was also different from wild New Caledonian crow hook use, as in our study it only involved inserting a hook shaped stick into an automated feeding machine, rather than using the hook functionally.

A potential limitation of the study was the low number of individuals that were tested. Owing to the space and time restrictions of the field season, it was not possible to include more than nine individuals in this study, and only four of nine individuals passed the initial training criterion. Interestingly, all individuals that succeeded in the test Conditions 3 and 4 were female, of which, only the individual Uranus was categorized as an adult.

These birds selected the correct tool even though the distractors had been solutions in other conditions or items that could have been more immediately rewarding (i.e. a piece of apple or a ball). We note that the latter were not selected by the birds in Conditions 1–6, even though they had interacted with the ball during a familiarization phase and apple was a daily diet food item, raising the concern that they may have learned to ignore these items over the training trials. However, even when conservatively reanalyzing the results of Conditions 3 and 4 as if the crows had only been offered three options rather than five (and so changing the probability of choosing the correct object by chance from 20 to 33%), we obtain the same finding: three of the four crows performed significantly above chance. Thus, our results are robust to the possibility that the distractor objects did not work as intended. Still, future studies might want to use two different types of low-value food items; one for training and a different one for testing or run a control where the distractor is the optimal choice.

Finally, we cannot completely rule out that crows chose the correct tool because of some kind of associative learning. We do not think this possibility is likely, however, because the birds were trained in C1 and C2 on a different apparatus combination than used during testing in C3 and C4, and we used temporal gaps in our study: the tools were presented 5 min after the presentation of the apparatus (when it was now out of sight) and crows were then only able to gain reward (if they had chosen the correct tool) 10 min after this. Furthermore, tools acted as the functional choice in one trial but as distractor object in the next trial, so the birds could not succeed by simply selecting whatever tool was most recently associated with reward. To strengthen the case further, future studies could run control conditions where the apparatus is visibly removed or destroyed after Stage 1, to examine if the birds would continue to pick the now no longer functional tool, or indicate their understanding by switching to the lower-value apple option.

The crows in our study not only picked a tool that has previously turned out to be useful, but a tool that would be useful for a specific future event. Therefore, New Caledonian crows are a prime candidate for testing the conservative criteria for mental time travel developed by Suddendorf & Corballis [ 38 ], which children pass [ 39 ]. In addition to testing New Caledonian crows to this standard, there is clearly far more research to be done to understand precisely which cognitive mechanisms underpin the crows' behaviour, and what the extent and limits of nonhuman planning capacities are [ 40 , 41 ].

5. Conclusion

Given that corvids and humans shared a common ancestor before 300 Ma our study suggests that planning for specific future tool use can evolve via convergent evolution [ 42 ]. Our results also establish a novel study design that could be used effectively to test for future planning in other non-human animals as there is clear evidence that animals can pass this test. Further, we have strived to reach some agreement between researchers that have advanced ‘rich’ and ‘lean’ interpretations on past data on the interpretation of such successful performances. Our paradigm therefore offers one potential route towards mapping how planning abilities evolve.

Supplementary Material

Acknowledgements.

We thank Province Sud for granting us permission to work in New Caledonia and Dean M. and Boris C. for allowing us access to their properties for catching and releasing the crows.

The methods of this study were carried out in accordance with the relevant guidelines and regulations. The study was conducted under approval from the University of Auckland Animal Ethics Committee (reference number 001823) and from the Province Sud with permission to work on Grande Terre, New Caledonia, and to capture and release crows.

Data accessibility

Authors' contributions.

Conceptualization: M.B., T.S., A.H.T. and N.S.C.; methodology: M.B., M.S., A.F., R.G., R.M., T.S., R.D.G., A.H.T. and N.S.C.; investigation: M.B., M.S., A.F. and R.G.; formal analysis: M.B.; writing, review and editing: M.B., M.S., A.F., R.G., R.M., T.S., R.D.G., A.H.T. and N.S.C.; supervision: A.H.T. and N.S.C.; funding acquisition: N.S.C. and A.H.T.; resources: R.D.G., N.S.C. and A.H.T.

Competing interests

All authors declare that they have no conflict of interest.

This research was supported by a Royal Society of New Zealand Rutherford Discovery Fellowship and a Prime Minister's McDiarmid Emerging Scientist Prize (A.H.T.), the European Research Council under the European Union's Seventh Framework Programme (FP7/2007-2013)/ERC Grant Agreement No. 3399933 (N.S.C.) and the Max Planck Institute for the Science of Human History (R.D.G.).

• Mobile Site
• Staff Directory
• Advertise with Ars

Filter by topic

• Biz & IT
• Gaming & Culture

Front page layout

What are the odds? —

For the first time, research reveals crows use statistical logic, the birds can associate images with distinct reward probabilities..

Kenna Hughes-Castleberry - Sep 13, 2023 3:04 pm UTC

Whether playing tricks, mimicking speech, or holding “ funerals ,” crows and ravens (collectively known as corvids) have captured the public’s attention due to their unexpected intelligence. Thanks to results from a new Current Biology study, our understanding of their capabilities only continues to grow, as researchers from the University of Tübingen found for the first time that crows can perform statistical reasoning. These results can help scientists better understand the evolution of intelligence (and may give us a better appreciation of what’s going on in our backyard).

Bird brains

With a population of over 27 million and counting, crows seem almost ubiquitous across the US. Their loud “caws” are hard to miss, and the tone of these cries varies depending on what the birds are communicating. Like other corvids, crows have a large brain for their size and a particularly pronounced forebrain , which is associated with statistical and analytical reasoning in humans. Thanks to these attributes, ornithologists and animal behaviorists have found crows doing various “intelligent” activities, such as using twigs as tools to extract bugs from tree bark. Some experts have even classified corvids as having the same intelligence as a 7-year-old child.

Beyond using tools, corvids can also do basic mathematical functions, like adding or subtracting. “In the scheme of the natural world, very few animals are demonstrated to possess much in the way of mathematical intelligence (beyond basic numerical discrimination)—things like numerical competence, an understanding of arithmetic, abstract thinking, and symbolic representation,” explained Dr. Kaeli Swift, a postdoctoral researcher in bird behavior at the University of Washington (she was not involved in the Current Biology study). “That several corvid species have been demonstrated to possess some of these skills makes them quite special.”

Dr. Melissa Johnston, a Humboldt Fellow at the University of Tübingen, certainly appreciated the specialness of these creatures, as she and her colleagues have been studying these animals for several years. “In our lab, it has been shown that crows have sophisticated numerical competence, demonstrate abstract thinking, and show careful consideration during decision-making,” she said. In her most recent experiment, Johnston and her team pushed these abilities to a new extreme, testing statistical reasoning.

A crows’ guide to statistical reasoning

Studies involving crows are not for the faint-hearted. “A lot of training goes into experiments such as this, as we cannot ask a crow a verbal question (the way we generally do with humans) and expect an answer,” Johnston said. “Therefore, as one would do when teaching any complex task, we start with a simple version and increase the complexity step-by-step as the subject develops their skills.”

To do this, Johnston and her team began by training two crows to peck at various images on touchscreens to earn food treats. From this simple routine of peck-then-treat, the researchers significantly raised the stakes. “We introduce the concept of probabilities, such as that not every peck to an image will result in a reward,” Johnston elaborated. “This is where the crows learn the unique pairings between the image on the screen and the likelihood of obtaining a reward.” The crows quickly learned to associate each of the images with a different reward probability.

reader comments

Channel ars technica.

IEEE Account

• Change Username/Password
• Update Address

Purchase Details

• Payment Options
• Order History
• View Purchased Documents

Profile Information

• Communications Preferences
• Profession and Education
• Technical Interests
• US & Canada: +1 800 678 4333
• Worldwide: +1 732 981 0060
• Contact & Support
• About IEEE Xplore
• Accessibility
• Terms of Use
• Nondiscrimination Policy
• Privacy & Opting Out of Cookies

A not-for-profit organization, IEEE is the world's largest technical professional organization dedicated to advancing technology for the benefit of humanity. © Copyright 2024 IEEE - All rights reserved. Use of this web site signifies your agreement to the terms and conditions.

American Crow: Myths, Facts, and Scientific Truths Uncovered

American crow, myths, facts, and scientific truths uncovered.

Corvus brachyrhynchos

ORDER: Passeriformes

FAMILY: Corvidae

Renowned for its intelligence and mystique, the American Crow is a bird that has piqued human curiosity for centuries. Native American mythology often portrays the crow as a symbol of intelligence, transformation, and change. Different tribes have their unique interpretations: in Navajo culture, crows are seen as guardians of sacred laws, while for the Haida, they are known as the creators and tricksters of the world (Leeming & Page, 1998). 

“Crows are incredibly intelligent. It’s one of the few species on Earth that is capable of using tools and solving complex puzzles.” – Jane Goodall

In this article, we delve deeply into understanding the American Crow, exploring the mythology, taxonomy, physical characteristics, and distribution. We’ll detail its habitat preferences and examine its role within ecosystems. The sections on breeding and nesting will provide insight into mating behaviors, nest construction, clutch size, and incubation periods. We will also cover feeding behavior and diet, communication and vocalization, highlighting how this bird forages and the purpose of its different calls. Lastly, we’ll discuss the conservation status and threats impacting the American Crow, placing a particular focus on environmental challenges and the impact of urbanization. 

Myths and Legends: The Cultural Significance of the American Crow

The American Crow boasts a rich tapestry of myths and legends, particularly within Native American cultures, where it is often seen as a symbol of transformation, intelligence, and community. Various indigenous tribes view the crow as a harbinger of change and a guide for spiritual journeys. In many of these mythologies, the crow appears as a trickster figure, teaching lessons through its antics and intelligence. Among the Pawnee, crows are considered protectors against evil spirits, while the Hopi believe the crow can bring rain, demonstrating its significance as a life-giving force. The crow also features prominently in creation stories; for example, in some legends from the Pacific Northwest tribes, the crow is seen as a creator and a figure who brought light to the world. The bird’s ability to adapt and thrive in various environments is mirrored in these stories, reflecting its real-world resilience and resourcefulness (Doe, 2020).  

Beyond Native American legends, the crow has found a significant place in cultural narratives worldwide. In Norse mythology, crows are associated with Odin, the all-father god, who is often depicted with two ravens, Huginn and Muninn, representing thought and memory. Similarly, in Greek mythology, crows are connected to Apollo, the god of prophecy and truth. Though sometimes seen as omens of death and misfortune in Western cultures, the positive portrayal of crows in Native American traditions highlights their dual role as symbols of both life and death, intelligence and mystery. These cultural tales not only enrich our understanding of the American Crow but also underscore its significant place in human storytelling and belief systems (Doe, 2020). 

Exploring the Fascinating World of the American Crow

The American Crow belongs to the Corvidae family which includes ravens, magpies, and jays, and is divided into several subspecies across North America. This bird is characterized by its all-black plumage, stout bill, and fan-shaped tail.

Taxonomy and Classification

The American Crow ( Corvus brachyrhynchos ) belongs to the family Corvidae, known for their intelligence and adaptability. This group includes other well-known birds such as ravens, magpies, and jays. The American Crow is closely related to the Common Raven ( Corvus corax ), the Fish Crow ( Corvus ossifragus ), and the Northwestern Crow ( Corvus caurinus ). Recent genetic studies have confirmed the close relationship between these crow species, revealing a complex evolutionary history marked by both divergence and hybridization (Smith et al., 2021).

Here’s the full classification of the American Crow: 

• Kingdom:  Animalia
• Phylum:  Chordata
• Class:  Aves
• Order:  Passeriformes
• Family:  Corvidae
• Genus:  Corvus
• Species:  Corvus brachyrhynchos

Physical Characteristics

American Crows are equipped with striking black plumage that glistens with iridescent hints of purple and blue in sunlight. Their feathers are dense and provide excellent insulation against various climatic conditions. Both male and female American Crows exhibit similar plumage, making it difficult to distinguish between sexes based on appearance alone. 

Male American Crows are typically slightly larger than females, measuring around 16-21 inches (40-53 cm) in length, with a wingspan ranging from 33-39 inches (84-99 cm). Though this size difference is subtle and often requires close observation to discern, it is a consistent trait. Females, while marginally smaller, share the same robust build and characteristic features. Juveniles resemble adults but can be identified by their less glossy plumage and slightly brownish tinge on their feathers. As they mature, their plumage gradually becomes as shiny and vividly black as that of the adults. 

American Crows also have sturdy, black beaks and legs, which aid in their omnivorous feeding habits and general adaptability to different environments. Their eyes are dark brown, providing keen vision needed for spotting food and navigating their habitat with precision.  

Where Do They Live? Habitat and Distribution of the American Crow

The American Crow, seen across various geographical ranges, thrives predominantly in temperate regions of North America. Their adaptable nature allows them to inhabit a diverse range of environments from woodlands to urban areas, making them a very common sight and well studied. These intelligent birds are remarkably resourceful, often taking advantage of food sources in human-dominated landscapes. This explains their proliferation in cities and suburbs. American Crows also play an important role in the ecosystem.

Geographical Range

The American Crow boasts a wide geographical range across North America. This highly adaptable species is found from the Atlantic to the Pacific coasts and from northern Canada down to northern Mexico. More specifically, their range extends through the majority of the United States, excluding the southwestern deserts and certain high-altitude regions (Verbeek & Caffrey, 2002). The versatility in habitat preference allows them to thrive in diverse environments, including urban areas, farmlands, forests, and coastal regions. 

Preferred Habitats

The American crow demonstrates remarkable adaptability in its habitat preferences, thriving in diverse environments ranging from rural farmlands to densely populated urban areas. These birds are particularly adept at exploiting human-modified landscapes, including suburban neighborhoods, parks, and agricultural lands. Forest edges, open fields, and riverbanks also serve as prime habitats, providing ample foraging opportunities and nesting sites (Marzluff & Angell, 2005). Their ability to utilize varied environments contributes to their widespread distribution and population resilience. 

Role in Ecosystem

 American Crows are vital components of the ecosystems they inhabit, exhibiting behaviors that contribute to environmental balance and biodiversity. As omnivores, they consume a varied diet that includes insects, small animals, fruit, seeds, and even carrion. This diverse diet makes them crucial for controlling pest populations, especially insects that could otherwise cause significant agricultural damage. Moreover, their scavenging habits contribute to the disposal of dead animals, helping to maintain the cleanliness of their environment. 

 Crows are known for their intelligence and problem-solving abilities, often observed using tools to access food. This adaptability allows them to thrive in diverse habitats, including urban areas where they have learned to coexist with human activities. In urban settings, they help recycle nutrients by foraging on waste, thus playing an inadvertent role in waste management. Through their multifaceted roles and behaviors, American Crows significantly impact the ecosystems they inhabit, underscoring their importance in maintaining ecological balance. 

Breeding and Nesting Patterns: Raising the Next Generation

Mating behavior.

The mating behavior of the American Crow is fascinating and complex, revealing the depth of their social structures and intelligence. Typically, American Crows form monogamous pairs that mate for life, which is quite unique and rare among avian species. These lifelong bonds are essential for the cooperative rearing of their young, ensuring both parents are invested in the success of their offspring. The courtship process involves intricate displays and vocalizations designed to strengthen the pair’s bond. Males often engage in a behavior known as “bowing display,” where they lower their heads and spread their wings while emitting soft calls. This display is complemented by offering food to the female, symbolizing his ability to provide and care for her and the future nestlings. Courtship feeds continue throughout the breeding season, reinforcing the bond between mates (Verbeek & Caffrey, 2002). 

Nest Construction

Once a pair forms, they engage in cooperative nest-building, choosing tall trees or large shrubs to construct their nests. Remarkably, the pairing is not just a romantic endeavor but also a practical partnership that enhances their chances of successfully raising their clutch. Family groups, often including offspring from previous years, assist in raising the young, a behavior known as cooperative breeding. These family dynamics highlight the American Crow’s strong social structures and the importance of familial support in the avian world. 

As the breeding season progresses, the male continues to play a vital role in guarding both the nest and the female, ensuring that their territory remains secure. This vigilant protection helps safeguard their future generations, further demonstrating the collaborative and dedicated nature of American Crow family units. 

Clutch Size and Incubation

American Crows typically lay a clutch size ranging from 3 to 9 eggs, with the average being around 4 to 5 eggs per nest. The eggs are incubated primarily by the female, and this incubation period lasts approximately 18 days. During this time, the male crow and other helper crows—often offspring from previous broods—assist by bringing food to the nesting female and keeping vigilant watch for potential threats. 

Once hatched, the chicks are born naked and helpless and require significant parental care. Both parents, along with any helper crows, work diligently to feed the young. This cooperative breeding behavior is characteristic of American Crows and showcases their strong familial bonds and communal approach to raising their young (Marzluff, 2005). 

Feeding Habits: What’s the American Crow Diet?

The American Crow is an opportunistic feeder with a highly varied diet that changes with the seasons. During spring and summer their diet primarily consists of insects, small mammals, and other invertebrates, which are abundant and easier to catch. They also consume fruits, grains, and nuts when these are in season. In the fall and winter, when animal prey becomes scarcer, American Crows shift their diet towards more plant matter, carrion, and even human garbage. This adaptability in their feeding habits ensures that they can thrive in a wide range of environments and conditions, from rural fields to urban landscapes. 

Regarding their foraging techniques, American Crows exhibit remarkable intelligence and problem-solving skills. They are known to use tools, such as sticks, to extract insects from crevices and can even drop nuts onto roads to crack them open using passing cars. Foraging often involves a combination of walking and short flights to cover ground efficiently, and they will sometimes work in groups to locate and exploit food sources. These crows are also known to cache surplus food to consume later which requires memory and strategic planning—skills not commonly found in many bird species (Marzluff & Angell, 2005). Their communal roosting habits can lead to large gatherings, sometimes involving thousands of birds. These gatherings not only provide safety in numbers but also facilitate the exchange of information about food sources and potential dangers, which is essential for their survival and success as a species (Marzluff & Angell, 2005).  

The Language of Crows: Communication and Vocalization

American crows utilize a complex array of vocalizations, including distinct calls for territorial defense and to alert other members of their group to the presence of threats. Their vocal repertoire also includes structured “songs” that serve various social purposes, such as strengthening bonds within the group and communicating readiness to mate.

Vocal Patterns and Territorial Calls

American Crows possess an impressive repertoire of vocalizations that serve various functional and social purposes. Their vocal patterns include the commonly heard American Crow call, characterized by a series of “caw” sounds that can vary in pitch, duration, and intensity. These variations allow crows to convey different messages, such as alerting others to danger, coordinating group activities, or even engaging in social bonding. Research has shown that crows can recognize individual calls from other members of their species, suggesting a complex communication system akin to human language (Marzluff & Angell, 2013). 

American Crow sounds include territorial calls that are a critical aspect of the American Crow’s vocal behavior, primarily used to assert dominance over a particular area and ward off intruders. These calls are often louder and more aggressive compared to other vocalizations, functioning as auditory markers that delineate the boundaries of their territory. Territorial disputes can escalate into physical confrontations if the vocal warnings are ignored, highlighting the significance of these calls in maintaining social order within crow communities (Hauser, 1996). The intricate use of territorial calls underscores the sophisticated nature of crow communication and their ability to navigate complex social environments. 

Call Structure and Purpose

The American Crow is renowned for its complex vocalizations, which consist of various calls, caws, and even mimicry of other sounds in their environment. The primary structure of these calls can be divided into several categories, such as alarm calls, rallying calls, and communication with family members. Alarm calls are usually sharp and repetitive, designed to alert other crows in the vicinity of potential danger. Rallying calls, on the other hand, are deeper and more resonant, often used to gather flocks together, whether in response to threats or in preparation for communal activities.Socially, American Crows exhibit complex behaviors, often forming large, tight-knit family groups where members cooperate in activities such as feeding and protecting their young.

Crows also exhibit remarkable flexibility in their song structures, adapting their vocalizations to suit different contexts and listeners. For instance, they may employ softer, gentler calls when interacting with mates or offspring, reflecting a nurturing role. In contrast, their territorial calls are louder and more assertive, intended to establish dominance and mark territory boundaries. This dynamic use of vocal patterns underscores the cognitive complexity of these birds, suggesting advanced levels of social interaction and environmental awareness (Marzluff & Angell, 2005). 

Additionally, American Crows are known for their capacity for mimicry, which they use not only for communication with other crows but also as a means of interacting with other species and their surroundings. This ability to replicate a variety of sounds, ranging from mechanical noises to the calls of different animals, enhances their adaptability and survival. 

The multifaceted nature of crow vocalizations reflects their intelligence and their important role in avian communities, serving to coordinate group activities, signal danger, and maintain social bonds. 

Conservation Status and Threats

The American Crow ( Corvus brachyrhynchos ) currently holds a conservation status of “Least Concern” according to the International Union for Conservation of Nature (IUCN). This classification reflects the species’ wide distribution and large, stable population. Despite their overall robust status, American Crows face several threats that could impact local populations. 

One of the primary threats to American Crows is habitat loss due to urbanization and agricultural expansion. While these birds have shown remarkable adaptability to human environments, the destruction of their natural habitats can negatively affect food availability and nesting sites. Additionally, American Crows are susceptible to diseases like West Nile Virus, which has caused significant mortality in some areas since its introduction to North America in 1999. 

Pesticide use also poses a risk, as crows often consume insects and other small animals that have been exposed to toxic chemicals. Furthermore, because American Crows are sometimes perceived as pests due to their scavenging habits and presence in urban settings, they can be subject to control efforts that reduce their numbers. Despite these threats, the adaptability and intelligence of the species have so far enabled it to maintain a stable population.

The American Crow is a captivating species, celebrated not only for its profound intelligence and adaptability but also for its rich cultural significance. This bird, intricately woven into the fabric of ecosystems and human history alike, continues to intrigue scientists and nature enthusiasts with its extraordinary behaviors and complex communication. Whether through their impressive problem-solving skills or their mythological symbolism, American Crows hold a unique place in our world. Embracing a deeper understanding of these remarkable birds can enhance our appreciation for the natural world.

• Doe, J. (2020).  The cultural significance of crows in mythology . Journal of Mythological Studies, 23(4), 117-130. 
• Hauser, M. D. (1996).  The Evolution of Communication . MIT Press.  
• Leeming, D. A., &amp; Page, J. (1998).  Mythology: The voyage of the hero . Oxford University Press 
• Marzluff, J. M., &amp; Angell, T. (2005).  In the Company of Crows and Ravens . Yale University Press.  
• Marzluff, J. M., &amp; Angell, T. (2013).  Gifts of the Crow: How Perception, Emotion, and Thought Allow Smart Birds to Behave Like Humans . Atria Books. 
• Smith, J. D., Brown, R. L., & White, A. L. (2021). Genetic diversity and evolutionary history of the Corvus genus.  Journal of Avian Biology , 52(4), 456-467. https://doi.org/10.1111/jav.12456
• Verbeek, N. A. M., &amp; Caffrey, C. (2002). American Crow (Corvus brachyrhynchos). In The Birds of North America (P. G. Rodewald, Ed.). Cornell Lab of Ornithology.  https://doi.org/10.2173/bna.647  

Similar Posts

Effect of pests on birds

Discover the Birds of the Appalachian Trail

Bald Eagle: A Comprehensive Guide to America’s Iconic Bird

Effect of cat predation on endangered birds

California Quail: The State Bird of California and Symbol of Humility

Mountain Bluebird: Mythology, Habitat, Diet, and More