academic research methods

Techniques or tools used for gathering research data include:

SAGE research methods

• SAGE research methods online This link opens in a new window Research methods tool to help researchers gather full-text resources, design research projects, understand a particular method and write up their research. Includes access to collections of video, business cases and eBooks,

Help and Information

• Next: Finding qualitative research >>
• Last Updated: Aug 19, 2024 3:39 PM
• URL: https://libguides.newcastle.edu.au/researchmethods

Service update: Some parts of the Library’s website will be down for maintenance on August 11.

Secondary menu

• Log in to your Library account
• Hours and Maps
• Connect from Off Campus
• UC Berkeley Home

Search form

Research methods--quantitative, qualitative, and more: overview.

• Quantitative Research
• Qualitative Research
• Data Science Methods (Machine Learning, AI, Big Data)
• Text Mining and Computational Text Analysis
• Evidence Synthesis/Systematic Reviews
• Get Data, Get Help!

About Research Methods

This guide provides an overview of research methods, how to choose and use them, and supports and resources at UC Berkeley. 

As Patten and Newhart note in the book Understanding Research Methods , "Research methods are the building blocks of the scientific enterprise. They are the "how" for building systematic knowledge. The accumulation of knowledge through research is by its nature a collective endeavor. Each well-designed study provides evidence that may support, amend, refute, or deepen the understanding of existing knowledge...Decisions are important throughout the practice of research and are designed to help researchers collect evidence that includes the full spectrum of the phenomenon under study, to maintain logical rules, and to mitigate or account for possible sources of bias. In many ways, learning research methods is learning how to see and make these decisions."

The choice of methods varies by discipline, by the kind of phenomenon being studied and the data being used to study it, by the technology available, and more.  This guide is an introduction, but if you don't see what you need here, always contact your subject librarian, and/or take a look to see if there's a library research guide that will answer your question. 

Suggestions for changes and additions to this guide are welcome! 

START HERE: SAGE Research Methods

Without question, the most comprehensive resource available from the library is SAGE Research Methods.  HERE IS THE ONLINE GUIDE  to this one-stop shopping collection, and some helpful links are below:

• SAGE Research Methods
• Little Green Books  (Quantitative Methods)
• Little Blue Books  (Qualitative Methods)
• Dictionaries and Encyclopedias  
• Case studies of real research projects
• Sample datasets for hands-on practice
• Streaming video--see methods come to life
• Methodspace- -a community for researchers
• SAGE Research Methods Course Mapping

Library Data Services at UC Berkeley

Library Data Services Program and Digital Scholarship Services

The LDSP offers a variety of services and tools !  From this link, check out pages for each of the following topics:  discovering data, managing data, collecting data, GIS data, text data mining, publishing data, digital scholarship, open science, and the Research Data Management Program.

Be sure also to check out the visual guide to where to seek assistance on campus with any research question you may have!

Library GIS Services

Other Data Services at Berkeley

D-Lab Supports Berkeley faculty, staff, and graduate students with research in data intensive social science, including a wide range of training and workshop offerings Dryad Dryad is a simple self-service tool for researchers to use in publishing their datasets. It provides tools for the effective publication of and access to research data. Geospatial Innovation Facility (GIF) Provides leadership and training across a broad array of integrated mapping technologies on campu Research Data Management A UC Berkeley guide and consulting service for research data management issues

General Research Methods Resources

Here are some general resources for assistance:

• Assistance from ICPSR (must create an account to access): Getting Help with Data , and Resources for Students
• Wiley Stats Ref for background information on statistics topics
• Survey Documentation and Analysis (SDA) .  Program for easy web-based analysis of survey data.

Consultants

• D-Lab/Data Science Discovery Consultants Request help with your research project from peer consultants.
• Research data (RDM) consulting Meet with RDM consultants before designing the data security, storage, and sharing aspects of your qualitative project.
• Statistics Department Consulting Services A service in which advanced graduate students, under faculty supervision, are available to consult during specified hours in the Fall and Spring semesters.

Related Resourcex

• IRB / CPHS Qualitative research projects with human subjects often require that you go through an ethics review.
• OURS (Office of Undergraduate Research and Scholarships) OURS supports undergraduates who want to embark on research projects and assistantships. In particular, check out their "Getting Started in Research" workshops
• Sponsored Projects Sponsored projects works with researchers applying for major external grants.
• Next: Quantitative Research >>
• Last Updated: Aug 6, 2024 3:06 PM
• URL: https://guides.lib.berkeley.edu/researchmethods

Conducting effective academic research: 9 research methods to know

Choose the research methodology best suited to your situation

Academic research is a process of collecting and analysing scientific or social data in order to answer a question. It is also called basic research or scientific research. It is used by researchers and academics to produce quality work and reliable results . Literature research is the most familiar method for students, but there are many more. This article helps you to explore the different research methods and find the most relevant one for your work.

What is the importance of research methodology? What are the academic research methods? Quantitative research Qualitative research Empirical research  Historical research Documentary research Experimental research Conceptual research  Comparative research  Analytical research  How to choose the right research method? What are the academic research tools? What are the steps of a good research methodology?

What is the importance of research methodology?

Research methodology is an essential process to ensure that the results obtained are valid and reliable . It sets the framework for the research and ensures that the data collected is relevant and complete. Research methodology also determines the methods and tools to be used to analyse the data and to ensure that the conclusions are logical and consistent .

What are the academic research methods?

There are several study methodologies for conducting academic research:

• Quantitative research : research that relies on numerical data to test hypotheses.
• Qualitative research : research based on the analysis of behaviour to understand human actions.
• Empirical research : research based on observations, interviews and experiments.
• Historical research : research based on historical documents to understand the past.
• Documentary research : research in databases, libraries, archives and specialised collections to find relevant information.
• Experimental research : research based on experiments and tests to understand phenomena.
• Conceptual research : research that uses concepts and theories to understand phenomena.
• Comparative research : research that compares different elements to understand phenomena.
• Analytical research : research based on the analysis of data and information to understand complex phenomena.

Quantitative research

Quantitative research or quantitative study is a research methodology that focuses on researching data and statistics to determine trends and relationships between variables . It focuses on the use of tools such as statistical tests, surveys, questionnaires (open-ended and closed-ended), surveys and mathematical models to analyse data on a sample of individuals. Quantitative analysis is generally used to test hypotheses and theories and to predict future outcomes . For example, if you're interested in e-commerce and trying to compare the best solutions, you may want to compare Spryker vs Shopify . Researchers need to use quantitative research methods to objectively assess platform performance and user preferences.

Qualitative research

Qualitative research or qualitative study is a research methodology that focuses on understanding the opinions and attitudes of individuals . It is used to examine people's thoughts, feelings and motivations . It can include the use of techniques such as interviews, focus groups, observations and document analysis. The qualitative approach is generally used to understand human behaviour and to develop deeper insights into a subject.

The main techniques of qualitative research are:

• Semi-structured interview : a qualitative data collection method that combines structure and flexibility, using a pre-established interview guide while allowing for open-ended questions and in-depth explorations of participants' responses.
• The directive interview : a qualitative data collection method based on a structured and predefined questionnaire, where the interviewer asks precise and targeted questions, thus limiting the freedom of answers and discussions to obtain specific information.
• Non-directive interview : a qualitative data collection method characterised by an open and flexible approach, where the interviewer encourages the participant to speak freely and spontaneously about their experiences, opinions and feelings, without asking specific questions or following a predefined interview guide.
• Observation : A qualitative research method that collects data by carefully and systematically examining behaviours, interactions and situations in their natural context, without direct intervention by the researcher.
• Focus group : a qualitative research method that involves a small group of participants brought together to discuss a specific topic, under the guidance of a moderator, in order to obtain a variety of opinions, perceptions and ideas on the topic being studied.

Empirical research 

Empirical research or empirical study is a research method that focuses on observation and experimentation to understand and explain phenomena . It is generally used to study scientific or social issues and is often considered one of the most reliable methods of obtaining information. Empirical research can include field studies, case studies, surveys, experiments and statistical analysis. It can also include qualitative methods, such as interviews and observations. Researchers can use these methods to collect data and analyse it to draw conclusions.

Historical research 

Historical research is a method of research that focuses on the study of past events and their impact on the present . It can be used to understand the past and better understand the present. Historical research is an important method for understanding the world we live in and for understanding how past events have shaped the present . Historical research can be conducted using archives, documents, eyewitness accounts and other sources. It can also include interviews, surveys and case studies.

Desk research

Desk research is a method of investigation that involves gathering information by consulting documentary sources . Documentary sources can be books, scientific articles, reports, archival documents, databases, websites, social media, etc. Desk research is an important step in understanding a topic and obtaining accurate and up-to-date information. It can be used to study a variety of subjects, such as history, politics, science, technology, sociology, economics, etc. Desk research is a valuable tool for researchers, journalists, students and professionals .

Experimental research 

Experimental research involves manipulating variables and observing the effect of these manipulations on measurable results . It is used to test hypotheses and to study the causes and effects of phenomena. For example, experimental research is useful for studying the effects of drugs, psychological treatments and educational interventions. It is also used to study the effects of environmental variables on human and animal behaviour.

Conceptual research 

Conceptual research focuses on identifying and analysing the key concepts underlying a problem or issue . It can be used to explore ideas, theories and hypotheses, and to understand the relationships between concepts and their implications. Conceptual research is often used to help solve complex problems and make strategic decisions.

Comparative research 

Comparative research is a research method that compares groups or individuals to determine their differences and similarities . It is used to explore issues such as cultural differences, similarities between groups, the effects of interventions and the effects of policies. Comparative research can be used to study groups or individuals across time or across different contexts.

Analytical research 

Analytical research is a research method that focuses on the analysis of data and information to understand and explain phenomena. It is often used to investigate complex issues and find solutions to problems . It can also be used to explore trends and patterns in data and information . Analytical research is an important method for understanding the world and making informed decisions.

Write your student work with peace of mind

With Compilatio Studium, make sure to cite all your sources and submit quality assignments, compliant with academic requirements . This way, you can easily avoid plagiarism penalties and prove the integrity of your work .

How to choose the right research method?

The research method you choose depends on the purpose of the research and the resources available . For example, if you want to collect qualitative data on consumer opinions, you might consider interviews or focus groups. To collect quantitative data on consumer habits, you might consider surveys or product testing. To increase your knowledge of a topic, you might consider doing a literature search on the net or in specialist journals. In all cases, it is important to take the time to think about the most appropriate research method to achieve your objectives .

What are the academic research tools?

1. Search engines: Google , Bing , Yahoo , DuckDuckGo , etc.

2. Monitoring tools: Google Alerts , Talkwalker , Mention , etc.

3. Social networks: Twitter , Facebook , LinkedIn , etc.

4. Databases: PubMed , Google Scholar , Web of Science , Archimag , CAIRN , etc.

5. Online forums and communities: Reddit , Quora , Stack Overflow , etc.

What are the steps of a good research methodology?

How to do scientific and academic research.

• Step 1: Define a research topic that motivates you
• Step 2: Choose an available and supportive supervisor
• Step 3: Formulate your problem and the limits of your subject
• Step 4: Construct a detailed plan
• Step 5: Search for relevant information
• Step 6: Write and structure your dissertation
• Step 7: Proofread and adjust your brief
• Step 8: Prepare the oral presentation

In conclusion, academic research methodology is a complex and demanding process that requires careful planning and attention to detail . It is essential to understand the different steps and to develop research, writing and presentation skills. By following these steps, student researchers can produce quality research that will contribute to the advancement of knowledge and improved decision making.

To go further: " Méthodologie de la recherche documentaire ", Université Aix Marseille. " La recherche en sciences de l'éducation. État des lieux et points de vue ", CAIRN. " Enseigner la méthodologie de la recherche en technologie éducative : des conceptions aux concepts seuils ", Open Edition Journals. " 28 meilleurs moteurs de recherche académiques pour la recherche en 2022 ", Testsiteforme, 14/09/2022, Gabriel Artega. " MÉTHODOLOGIE DE LA RECHERCHE SCIENTIFIQUE ", Friedrich Ebert Siftung.   Information : This informative article does not require any personal reflection and was written with the help of ChatGPT. On the basis of an outline that we constructed beforehand, we questioned ChatGPT. Then, we reworked these automatically generated contents to delete repetitions, add details, check the veracity of the information... The assistance of an AI allowed us to save time in writing and to enrich our good practices in using such a tool.

Studium Newsletter

Receive tips on writing and citations and don't miss our promotional offers by subscribing to the Studium newsletter.

By clicking "Subscribe", I agree that Compilatio processes the data provided in this form for the following purpose: "Information on the topic of plagiarism". Learn more about how we manage your data and your rights.

Educational resources and simple solutions for your research journey

What is Research? Definition, Types, Methods, and Examples

Academic research is a methodical way of exploring new ideas or understanding things we already know. It involves gathering and studying information to answer questions or test ideas and requires careful thinking and persistence to reach meaningful conclusions. Let’s try to understand what research is.   

Table of Contents

Why is research important?    

Whether it’s doing experiments, analyzing data, or studying old documents, research helps us learn more about the world. Without it, we rely on guesswork and hearsay, often leading to mistakes and misconceptions. By using systematic methods, research helps us see things clearly, free from biases. (1)   

What is the purpose of research?  

In the real world, academic research is also a key driver of innovation. It brings many benefits, such as creating valuable opportunities and fostering partnerships between academia and industry. By turning research into products and services, science makes meaningful improvements to people’s lives and boosts the economy. (2)(3)  

What are the characteristics of research?    

The research process collects accurate information systematically. Logic is used to analyze the collected data and find insights. Checking the collected data thoroughly ensures accuracy. Research also leads to new questions using existing data.   

Accuracy is key in research, which requires precise data collection and analysis. In scientific research, laboratories ensure accuracy by carefully calibrating instruments and controlling experiments. Every step is checked to maintain integrity, from instruments to final results. Accuracy gives reliable insights, which in turn help advance knowledge.   

Types of research    

The different forms of research serve distinct purposes in expanding knowledge and understanding:    

• Exploratory research ventures into uncharted territories, exploring new questions or problem areas without aiming for conclusive answers. For instance, a study may delve into unexplored market segments to better understand consumer behaviour patterns.   
• Descriptive research delves into current issues by collecting and analyzing data to describe the behaviour of a sample population. For instance, a survey may investigate millennials’ spending habits to gain insights into their purchasing behaviours.   
• Explanatory research, also known as causal research, seeks to understand the impact of specific changes in existing procedures. An example might be a study examining how changes in drug dosage over some time improve patients’ health.   
• Correlational research examines connections between two sets of data to uncover meaningful relationships. For instance, a study may analyze the relationship between advertising spending and sales revenue.   
• Theoretical research deepens existing knowledge without attempting to solve specific problems. For example, a study may explore theoretical frameworks to understand the underlying principles of human behaviour.   
• Applied research focuses on real-world issues and aims to provide practical solutions. An example could be a study investigating the effectiveness of a new teaching method in improving student performance in schools.  (4)

Types of research methods

• Qualitative Method: Qualitative research gathers non-numerical data through interactions with participants. Methods include one-to-one interviews, focus groups, ethnographic studies, text analysis, and case studies. For example, a researcher interviews cancer patients to understand how different treatments impact their lives emotionally.    
• Quantitative Method: Quantitative methods deal with numbers and measurable data to understand relationships between variables. They use systematic methods to investigate events and aim to explain or predict outcomes. For example, Researchers study how exercise affects heart health by measuring variables like heart rate and blood pressure in a large group before and after an exercise program. (5)  

Basic steps involved in the research process    

Here are the basic steps to help you understand the research process:   

• Choose your topic: Decide the specific subject or area that you want to study and investigate. This decision is the foundation of your research journey.   
• Find information: Look for information related to your research topic. You can search in journals, books, online, or ask experts for help.   
• Assess your sources: Make sure the information you find is reliable and trustworthy. Check the author’s credentials and the publication date.   
• Take notes: Write down important information from your sources that you can use in your research.   
• Write your paper: Use your notes to write your research paper. Broadly, start with an introduction, then write the body of your paper, and finish with a conclusion.   
• Cite your sources: Give credit to the sources you used by including citations in your paper.   
• Proofread: Check your paper thoroughly for any errors in spelling, grammar, or punctuation before you submit it. (6)

How to ensure research accuracy?  

Ensuring accuracy in research is a mix of several essential steps:    

• Clarify goals: Start by defining clear objectives for your research. Identify your research question, hypothesis, and variables of interest. This clarity will help guide your data collection and analysis methods, ensuring that your research stays focused and purposeful.   
• Use reliable data: Select trustworthy sources for your information, whether they are primary data collected by you or secondary data obtained from other sources. For example, if you’re studying climate change, use data from reputable scientific organizations with transparent methodologies.   
• Validate data: Validate your data to ensure it meets the standards of your research project. Check for errors, outliers, and inconsistencies at different stages, such as during data collection, entry, cleaning, or analysis.    
• Document processes: Documenting your data collection and analysis processes is essential for transparency and reproducibility. Record details such as data collection methods, cleaning procedures, and analysis techniques used. This documentation not only helps you keep track of your research but also enables others to understand and replicate your work.   
• Review results: Finally, review and verify your research findings to confirm their accuracy and reliability. Double-check your analyses, cross-reference your data, and seek feedback from peers or supervisors. (7) 

Research is crucial for better understanding our world and for social and economic growth. By following ethical guidelines and ensuring accuracy, researchers play a critical role in driving this progress, whether through exploring new topics or deepening existing knowledge.   

References:  

• Why is Research Important – Introductory Psychology – Washington State University  
• The Role Of Scientific Research In Driving Business Innovation – Forbes  
• Innovation – Royal Society  
• Types of Research – Definition & Methods – Bachelor Print  
• What Is Qualitative vs. Quantitative Study? – National University  
• Basic Steps in the Research Process – North Hennepin Community College  
• Best Practices for Ensuring Data Accuracy in Research – LinkedIn  

Researcher.Life is a subscription-based platform that unifies the best AI tools and services designed to speed up, simplify, and streamline every step of a researcher’s journey. The Researcher.Life All Access Pack is a one-of-a-kind subscription that unlocks full access to an AI writing assistant, literature recommender, journal finder, scientific illustration tool, and exclusive discounts on professional publication services from Editage.  

Based on 21+ years of experience in academia, Researcher.Life All Access empowers researchers to put their best research forward and move closer to success. Explore our top AI Tools pack, AI Tools + Publication Services pack, or Build Your Own Plan. Find everything a researcher needs to succeed, all in one place –  Get All Access now starting at just $17 a month !    

Related Posts

Back to School – Lock-in All Access Pack for a Year at the Best Price

Research Paper Appendix: Format and Examples

• Research Process
• Manuscript Preparation
• Manuscript Review
• Publication Process
• Publication Recognition
• Language Editing Services
• Translation Services

Choosing the Right Research Methodology: A Guide for Researchers

• 3 minute read
• 50.2K views

Table of Contents

Choosing an optimal research methodology is crucial for the success of any research project. The methodology you select will determine the type of data you collect, how you collect it, and how you analyse it. Understanding the different types of research methods available along with their strengths and weaknesses, is thus imperative to make an informed decision.

Understanding different research methods:

There are several research methods available depending on the type of study you are conducting, i.e., whether it is laboratory-based, clinical, epidemiological, or survey based . Some common methodologies include qualitative research, quantitative research, experimental research, survey-based research, and action research. Each method can be opted for and modified, depending on the type of research hypotheses and objectives.

Qualitative vs quantitative research:

When deciding on a research methodology, one of the key factors to consider is whether your research will be qualitative or quantitative. Qualitative research is used to understand people’s experiences, concepts, thoughts, or behaviours . Quantitative research, on the contrary, deals with numbers, graphs, and charts, and is used to test or confirm hypotheses, assumptions, and theories. 

Qualitative research methodology:

Qualitative research is often used to examine issues that are not well understood, and to gather additional insights on these topics. Qualitative research methods include open-ended survey questions, observations of behaviours described through words, and reviews of literature that has explored similar theories and ideas. These methods are used to understand how language is used in real-world situations, identify common themes or overarching ideas, and describe and interpret various texts. Data analysis for qualitative research typically includes discourse analysis, thematic analysis, and textual analysis. 

Quantitative research methodology:

The goal of quantitative research is to test hypotheses, confirm assumptions and theories, and determine cause-and-effect relationships. Quantitative research methods include experiments, close-ended survey questions, and countable and numbered observations. Data analysis for quantitative research relies heavily on statistical methods.

Analysing qualitative vs quantitative data:

The methods used for data analysis also differ for qualitative and quantitative research. As mentioned earlier, quantitative data is generally analysed using statistical methods and does not leave much room for speculation. It is more structured and follows a predetermined plan. In quantitative research, the researcher starts with a hypothesis and uses statistical methods to test it. Contrarily, methods used for qualitative data analysis can identify patterns and themes within the data, rather than provide statistical measures of the data. It is an iterative process, where the researcher goes back and forth trying to gauge the larger implications of the data through different perspectives and revising the analysis if required.

When to use qualitative vs quantitative research:

The choice between qualitative and quantitative research will depend on the gap that the research project aims to address, and specific objectives of the study. If the goal is to establish facts about a subject or topic, quantitative research is an appropriate choice. However, if the goal is to understand people’s experiences or perspectives, qualitative research may be more suitable. 

Conclusion:

In conclusion, an understanding of the different research methods available, their applicability, advantages, and disadvantages is essential for making an informed decision on the best methodology for your project. If you need any additional guidance on which research methodology to opt for, you can head over to Elsevier Author Services (EAS). EAS experts will guide you throughout the process and help you choose the perfect methodology for your research goals.

Why is data validation important in research?

When Data Speak, Listen: Importance of Data Collection and Analysis Methods

You may also like.

Descriptive Research Design and Its Myriad Uses

Five Common Mistakes to Avoid When Writing a Biomedical Research Paper

Making Technical Writing in Environmental Engineering Accessible

To Err is Not Human: The Dangers of AI-assisted Academic Writing

Writing a good review article

Scholarly Sources: What are They and Where can You Find Them?

Input your search keywords and press Enter.

15 Types of Research Methods

Chris Drew (PhD)

Dr. Chris Drew is the founder of the Helpful Professor. He holds a PhD in education and has published over 20 articles in scholarly journals. He is the former editor of the Journal of Learning Development in Higher Education. [Image Descriptor: Photo of Chris]

Learn about our Editorial Process

Research methods refer to the strategies, tools, and techniques used to gather and analyze data in a structured way in order to answer a research question or investigate a hypothesis (Hammond & Wellington, 2020).

Generally, we place research methods into two categories: quantitative and qualitative. Each has its own strengths and weaknesses, which we can summarize as:

• Quantitative research can achieve generalizability through scrupulous statistical analysis applied to large sample sizes.
• Qualitative research achieves deep, detailed, and nuance accounts of specific case studies, which are not generalizable.

Some researchers, with the aim of making the most of both quantitative and qualitative research, employ mixed methods, whereby they will apply both types of research methods in the one study, such as by conducting a statistical survey alongside in-depth interviews to add context to the quantitative findings.

Below, I’ll outline 15 common research methods, and include pros, cons, and examples of each .

Types of Research Methods

Research methods can be broadly categorized into two types: quantitative and qualitative.

• Quantitative methods involve systematic empirical investigation of observable phenomena via statistical, mathematical, or computational techniques, providing an in-depth understanding of a specific concept or phenomenon (Schweigert, 2021). The strengths of this approach include its ability to produce reliable results that can be generalized to a larger population, although it can lack depth and detail.
• Qualitative methods encompass techniques that are designed to provide a deep understanding of a complex issue, often in a specific context, through collection of non-numerical data (Tracy, 2019). This approach often provides rich, detailed insights but can be time-consuming and its findings may not be generalizable.

These can be further broken down into a range of specific research methods and designs:

Combining the two methods above, mixed methods research mixes elements of both qualitative and quantitative research methods, providing a comprehensive understanding of the research problem . We can further break these down into:

• Sequential Explanatory Design (QUAN→QUAL): This methodology involves conducting quantitative analysis first, then supplementing it with a qualitative study.
• Sequential Exploratory Design (QUAL→QUAN): This methodology goes in the other direction, starting with qualitative analysis and ending with quantitative analysis.

Let’s explore some methods and designs from both quantitative and qualitative traditions, starting with qualitative research methods.

Qualitative Research Methods

Qualitative research methods allow for the exploration of phenomena in their natural settings, providing detailed, descriptive responses and insights into individuals’ experiences and perceptions (Howitt, 2019).

These methods are useful when a detailed understanding of a phenomenon is sought.

1. Ethnographic Research

Ethnographic research emerged out of anthropological research, where anthropologists would enter into a setting for a sustained period of time, getting to know a cultural group and taking detailed observations.

Ethnographers would sometimes even act as participants in the group or culture, which many scholars argue is a weakness because it is a step away from achieving objectivity (Stokes & Wall, 2017).

In fact, at its most extreme version, ethnographers even conduct research on themselves, in a fascinating methodology call autoethnography .

The purpose is to understand the culture, social structure, and the behaviors of the group under study. It is often useful when researchers seek to understand shared cultural meanings and practices in their natural settings.

However, it can be time-consuming and may reflect researcher biases due to the immersion approach.

Example of Ethnography

Liquidated: An Ethnography of Wall Street  by Karen Ho involves an anthropologist who embeds herself with Wall Street firms to study the culture of Wall Street bankers and how this culture affects the broader economy and world.

2. Phenomenological Research

Phenomenological research is a qualitative method focused on the study of individual experiences from the participant’s perspective (Tracy, 2019).

It focuses specifically on people’s experiences in relation to a specific social phenomenon ( see here for examples of social phenomena ).

This method is valuable when the goal is to understand how individuals perceive, experience, and make meaning of particular phenomena. However, because it is subjective and dependent on participants’ self-reports, findings may not be generalizable, and are highly reliant on self-reported ‘thoughts and feelings’.

Example of Phenomenological Research

A phenomenological approach to experiences with technology  by Sebnem Cilesiz represents a good starting-point for formulating a phenomenological study. With its focus on the ‘essence of experience’, this piece presents methodological, reliability, validity, and data analysis techniques that phenomenologists use to explain how people experience technology in their everyday lives.

3. Historical Research

Historical research is a qualitative method involving the examination of past events to draw conclusions about the present or make predictions about the future (Stokes & Wall, 2017).

As you might expect, it’s common in the research branches of history departments in universities.

This approach is useful in studies that seek to understand the past to interpret present events or trends. However, it relies heavily on the availability and reliability of source materials, which may be limited.

Common data sources include cultural artifacts from both material and non-material culture , which are then examined, compared, contrasted, and contextualized to test hypotheses and generate theories.

Example of Historical Research

A historical research example might be a study examining the evolution of gender roles over the last century. This research might involve the analysis of historical newspapers, advertisements, letters, and company documents, as well as sociocultural contexts.

4. Content Analysis

Content analysis is a research method that involves systematic and objective coding and interpreting of text or media to identify patterns, themes, ideologies, or biases (Schweigert, 2021).

A content analysis is useful in analyzing communication patterns, helping to reveal how texts such as newspapers, movies, films, political speeches, and other types of ‘content’ contain narratives and biases.

However, interpretations can be very subjective, which often requires scholars to engage in practices such as cross-comparing their coding with peers or external researchers.

Content analysis can be further broken down in to other specific methodologies such as semiotic analysis, multimodal analysis , and discourse analysis .

Example of Content Analysis

How is Islam Portrayed in Western Media?  by Poorebrahim and Zarei (2013) employs a type of content analysis called critical discourse analysis (common in poststructuralist and critical theory research ). This study by Poorebrahum and Zarei combs through a corpus of western media texts to explore the language forms that are used in relation to Islam and Muslims, finding that they are overly stereotyped, which may represent anti-Islam bias or failure to understand the Islamic world.

5. Grounded Theory Research

Grounded theory involves developing a theory  during and after  data collection rather than beforehand.

This is in contrast to most academic research studies, which start with a hypothesis or theory and then testing of it through a study, where we might have a null hypothesis (disproving the theory) and an alternative hypothesis (supporting the theory).

Grounded Theory is useful because it keeps an open mind to what the data might reveal out of the research. It can be time-consuming and requires rigorous data analysis (Tracy, 2019).

Grounded Theory Example

Developing a Leadership Identity   by Komives et al (2005) employs a grounded theory approach to develop a thesis based on the data rather than testing a hypothesis. The researchers studied the leadership identity of 13 college students taking on leadership roles. Based on their interviews, the researchers theorized that the students’ leadership identities shifted from a hierarchical view of leadership to one that embraced leadership as a collaborative concept.

6. Action Research

Action research is an approach which aims to solve real-world problems and bring about change within a setting. The study is designed to solve a specific problem – or in other words, to take action (Patten, 2017).

This approach can involve mixed methods, but is generally qualitative because it usually involves the study of a specific case study wherein the researcher works, e.g. a teacher studying their own classroom practice to seek ways they can improve.

Action research is very common in fields like education and nursing where practitioners identify areas for improvement then implement a study in order to find paths forward.

Action Research Example

Using Digital Sandbox Gaming to Improve Creativity Within Boys’ Writing   by Ellison and Drew was a research study one of my research students completed in his own classroom under my supervision. He implemented a digital game-based approach to literacy teaching with boys and interviewed his students to see if the use of games as stimuli for storytelling helped draw them into the learning experience.

7. Natural Observational Research

Observational research can also be quantitative (see: experimental research), but in naturalistic settings for the social sciences, researchers tend to employ qualitative data collection methods like interviews and field notes to observe people in their day-to-day environments.

This approach involves the observation and detailed recording of behaviors in their natural settings (Howitt, 2019). It can provide rich, in-depth information, but the researcher’s presence might influence behavior.

While observational research has some overlaps with ethnography (especially in regard to data collection techniques), it tends not to be as sustained as ethnography, e.g. a researcher might do 5 observations, every second Monday, as opposed to being embedded in an environment.

Observational Research Example

A researcher might use qualitative observational research to study the behaviors and interactions of children at a playground. The researcher would document the behaviors observed, such as the types of games played, levels of cooperation , and instances of conflict.

8. Case Study Research

Case study research is a qualitative method that involves a deep and thorough investigation of a single individual, group, or event in order to explore facets of that phenomenon that cannot be captured using other methods (Stokes & Wall, 2017).

Case study research is especially valuable in providing contextualized insights into specific issues, facilitating the application of abstract theories to real-world situations (Patten, 2017).

However, findings from a case study may not be generalizable due to the specific context and the limited number of cases studied (Walliman, 2021).

See More: Case Study Advantages and Disadvantages

Example of a Case Study

Scholars conduct a detailed exploration of the implementation of a new teaching method within a classroom setting. The study focuses on how the teacher and students adapt to the new method, the challenges encountered, and the outcomes on student performance and engagement. While the study provides specific and detailed insights of the teaching method in that classroom, it cannot be generalized to other classrooms, as statistical significance has not been established through this qualitative approach.

Quantitative Research Methods

Quantitative research methods involve the systematic empirical investigation of observable phenomena via statistical, mathematical, or computational techniques (Pajo, 2022). The focus is on gathering numerical data and generalizing it across groups of people or to explain a particular phenomenon.

9. Experimental Research

Experimental research is a quantitative method where researchers manipulate one variable to determine its effect on another (Walliman, 2021).

This is common, for example, in high-school science labs, where students are asked to introduce a variable into a setting in order to examine its effect.

This type of research is useful in situations where researchers want to determine causal relationships between variables. However, experimental conditions may not reflect real-world conditions.

Example of Experimental Research

A researcher may conduct an experiment to determine the effects of a new educational approach on student learning outcomes. Students would be randomly assigned to either the control group (traditional teaching method) or the experimental group (new educational approach).

10. Surveys and Questionnaires

Surveys and questionnaires are quantitative methods that involve asking research participants structured and predefined questions to collect data about their attitudes, beliefs, behaviors, or characteristics (Patten, 2017).

Surveys are beneficial for collecting data from large samples, but they depend heavily on the honesty and accuracy of respondents.

They tend to be seen as more authoritative than their qualitative counterparts, semi-structured interviews, because the data is quantifiable (e.g. a questionnaire where information is presented on a scale from 1 to 10 can allow researchers to determine and compare statistical means, averages, and variations across sub-populations in the study).

Example of a Survey Study

A company might use a survey to gather data about employee job satisfaction across its offices worldwide. Employees would be asked to rate various aspects of their job satisfaction on a Likert scale. While this method provides a broad overview, it may lack the depth of understanding possible with other methods (Stokes & Wall, 2017).

11. Longitudinal Studies

Longitudinal studies involve repeated observations of the same variables over extended periods (Howitt, 2019). These studies are valuable for tracking development and change but can be costly and time-consuming.

With multiple data points collected over extended periods, it’s possible to examine continuous changes within things like population dynamics or consumer behavior. This makes a detailed analysis of change possible.

Perhaps the most relatable example of a longitudinal study is a national census, which is taken on the same day every few years, to gather comparative demographic data that can show how a nation is changing over time.

While longitudinal studies are commonly quantitative, there are also instances of qualitative ones as well, such as the famous 7 Up study from the UK, which studies 14 individuals every 7 years to explore their development over their lives.

Example of a Longitudinal Study

A national census, taken every few years, uses surveys to develop longitudinal data, which is then compared and analyzed to present accurate trends over time. Trends a census can reveal include changes in religiosity, values and attitudes on social issues, and much more.

12. Cross-Sectional Studies

Cross-sectional studies are a quantitative research method that involves analyzing data from a population at a specific point in time (Patten, 2017). They provide a snapshot of a situation but cannot determine causality.

This design is used to measure and compare the prevalence of certain characteristics or outcomes in different groups within the sampled population.

The major advantage of cross-sectional design is its ability to measure a wide range of variables simultaneously without needing to follow up with participants over time.

However, cross-sectional studies do have limitations . This design can only show if there are associations or correlations between different variables, but cannot prove cause and effect relationships, temporal sequence, changes, and trends over time.

Example of a Cross-Sectional Study

Our longitudinal study example of a national census also happens to contain cross-sectional design. One census is cross-sectional, displaying only data from one point in time. But when a census is taken once every few years, it becomes longitudinal, and so long as the data collection technique remains unchanged, identification of changes will be achievable, adding another time dimension on top of a basic cross-sectional study.

13. Correlational Research

Correlational research is a quantitative method that seeks to determine if and to what degree a relationship exists between two or more quantifiable variables (Schweigert, 2021).

This approach provides a fast and easy way to make initial hypotheses based on either positive or  negative correlation trends  that can be observed within dataset.

While correlational research can reveal relationships between variables, it cannot establish causality.

Methods used for data analysis may include statistical correlations such as Pearson’s or Spearman’s.

Example of Correlational Research

A team of researchers is interested in studying the relationship between the amount of time students spend studying and their academic performance. They gather data from a high school, measuring the number of hours each student studies per week and their grade point averages (GPAs) at the end of the semester. Upon analyzing the data, they find a positive correlation, suggesting that students who spend more time studying tend to have higher GPAs.

14. Quasi-Experimental Design Research

Quasi-experimental design research is a quantitative research method that is similar to experimental design but lacks the element of random assignment to treatment or control.

Instead, quasi-experimental designs typically rely on certain other methods to control for extraneous variables.

The term ‘quasi-experimental’ implies that the experiment resembles a true experiment, but it is not exactly the same because it doesn’t meet all the criteria for a ‘true’ experiment, specifically in terms of control and random assignment.

Quasi-experimental design is useful when researchers want to study a causal hypothesis or relationship, but practical or ethical considerations prevent them from manipulating variables and randomly assigning participants to conditions.

Example of Quasi-Experimental Design

A researcher wants to study the impact of a new math tutoring program on student performance. However, ethical and practical constraints prevent random assignment to the “tutoring” and “no tutoring” groups. Instead, the researcher compares students who chose to receive tutoring (experimental group) to similar students who did not choose to receive tutoring (control group), controlling for other variables like grade level and previous math performance.

Related: Examples and Types of Random Assignment in Research

15. Meta-Analysis Research

Meta-analysis statistically combines the results of multiple studies on a specific topic to yield a more precise estimate of the effect size. It’s the gold standard of secondary research .

Meta-analysis is particularly useful when there are numerous studies on a topic, and there is a need to integrate the findings to draw more reliable conclusions.

Some meta-analyses can identify flaws or gaps in a corpus of research, when can be highly influential in academic research, despite lack of primary data collection.

However, they tend only to be feasible when there is a sizable corpus of high-quality and reliable studies into a phenomenon.

Example of a Meta-Analysis

The power of feedback revisited (Wisniewski, Zierer & Hattie, 2020) is a meta-analysis that examines 435 empirical studies research on the effects of feedback on student learning. They use a random-effects model to ascertain whether there is a clear effect size across the literature. The authors find that feedback tends to impact cognitive and motor skill outcomes but has less of an effect on motivational and behavioral outcomes.

Choosing a research method requires a lot of consideration regarding what you want to achieve, your research paradigm, and the methodology that is most valuable for what you are studying. There are multiple types of research methods, many of which I haven’t been able to present here. Generally, it’s recommended that you work with an experienced researcher or research supervisor to identify a suitable research method for your study at hand.

Hammond, M., & Wellington, J. (2020). Research methods: The key concepts . New York: Routledge.

Howitt, D. (2019). Introduction to qualitative research methods in psychology . London: Pearson UK.

Pajo, B. (2022). Introduction to research methods: A hands-on approach . New York: Sage Publications.

Patten, M. L. (2017). Understanding research methods: An overview of the essentials . New York: Sage

Schweigert, W. A. (2021). Research methods in psychology: A handbook . Los Angeles: Waveland Press.

Stokes, P., & Wall, T. (2017). Research methods . New York: Bloomsbury Publishing.

Tracy, S. J. (2019). Qualitative research methods: Collecting evidence, crafting analysis, communicating impact . London: John Wiley & Sons.

Walliman, N. (2021). Research methods: The basics. London: Routledge.

• Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd-2/ 21 Montessori Homeschool Setups
• Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd-2/ 101 Hidden Talents Examples
• Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd-2/ 15 Green Flags in a Relationship
• Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd-2/ 15 Signs you're Burnt Out, Not Lazy

Leave a Comment Cancel Reply

Your email address will not be published. Required fields are marked *

• Privacy Policy

Home » Research Methodology – Types, Examples and writing Guide

Research Methodology – Types, Examples and writing Guide

Table of Contents

Research Methodology

Definition:

Research Methodology refers to the systematic and scientific approach used to conduct research, investigate problems, and gather data and information for a specific purpose. It involves the techniques and procedures used to identify, collect , analyze , and interpret data to answer research questions or solve research problems . Moreover, They are philosophical and theoretical frameworks that guide the research process.

Structure of Research Methodology

Research methodology formats can vary depending on the specific requirements of the research project, but the following is a basic example of a structure for a research methodology section:

I. Introduction

• Provide an overview of the research problem and the need for a research methodology section
• Outline the main research questions and objectives

II. Research Design

• Explain the research design chosen and why it is appropriate for the research question(s) and objectives
• Discuss any alternative research designs considered and why they were not chosen
• Describe the research setting and participants (if applicable)

III. Data Collection Methods

• Describe the methods used to collect data (e.g., surveys, interviews, observations)
• Explain how the data collection methods were chosen and why they are appropriate for the research question(s) and objectives
• Detail any procedures or instruments used for data collection

IV. Data Analysis Methods

• Describe the methods used to analyze the data (e.g., statistical analysis, content analysis )
• Explain how the data analysis methods were chosen and why they are appropriate for the research question(s) and objectives
• Detail any procedures or software used for data analysis

V. Ethical Considerations

• Discuss any ethical issues that may arise from the research and how they were addressed
• Explain how informed consent was obtained (if applicable)
• Detail any measures taken to ensure confidentiality and anonymity

VI. Limitations

• Identify any potential limitations of the research methodology and how they may impact the results and conclusions

VII. Conclusion

• Summarize the key aspects of the research methodology section
• Explain how the research methodology addresses the research question(s) and objectives

Research Methodology Types

Types of Research Methodology are as follows:

Quantitative Research Methodology

This is a research methodology that involves the collection and analysis of numerical data using statistical methods. This type of research is often used to study cause-and-effect relationships and to make predictions.

Qualitative Research Methodology

This is a research methodology that involves the collection and analysis of non-numerical data such as words, images, and observations. This type of research is often used to explore complex phenomena, to gain an in-depth understanding of a particular topic, and to generate hypotheses.

Mixed-Methods Research Methodology

This is a research methodology that combines elements of both quantitative and qualitative research. This approach can be particularly useful for studies that aim to explore complex phenomena and to provide a more comprehensive understanding of a particular topic.

Case Study Research Methodology

This is a research methodology that involves in-depth examination of a single case or a small number of cases. Case studies are often used in psychology, sociology, and anthropology to gain a detailed understanding of a particular individual or group.

Action Research Methodology

This is a research methodology that involves a collaborative process between researchers and practitioners to identify and solve real-world problems. Action research is often used in education, healthcare, and social work.

Experimental Research Methodology

This is a research methodology that involves the manipulation of one or more independent variables to observe their effects on a dependent variable. Experimental research is often used to study cause-and-effect relationships and to make predictions.

Survey Research Methodology

This is a research methodology that involves the collection of data from a sample of individuals using questionnaires or interviews. Survey research is often used to study attitudes, opinions, and behaviors.

Grounded Theory Research Methodology

This is a research methodology that involves the development of theories based on the data collected during the research process. Grounded theory is often used in sociology and anthropology to generate theories about social phenomena.

Research Methodology Example

An Example of Research Methodology could be the following:

Research Methodology for Investigating the Effectiveness of Cognitive Behavioral Therapy in Reducing Symptoms of Depression in Adults

Introduction:

The aim of this research is to investigate the effectiveness of cognitive-behavioral therapy (CBT) in reducing symptoms of depression in adults. To achieve this objective, a randomized controlled trial (RCT) will be conducted using a mixed-methods approach.

Research Design:

The study will follow a pre-test and post-test design with two groups: an experimental group receiving CBT and a control group receiving no intervention. The study will also include a qualitative component, in which semi-structured interviews will be conducted with a subset of participants to explore their experiences of receiving CBT.

Participants:

Participants will be recruited from community mental health clinics in the local area. The sample will consist of 100 adults aged 18-65 years old who meet the diagnostic criteria for major depressive disorder. Participants will be randomly assigned to either the experimental group or the control group.

Intervention :

The experimental group will receive 12 weekly sessions of CBT, each lasting 60 minutes. The intervention will be delivered by licensed mental health professionals who have been trained in CBT. The control group will receive no intervention during the study period.

Data Collection:

Quantitative data will be collected through the use of standardized measures such as the Beck Depression Inventory-II (BDI-II) and the Generalized Anxiety Disorder-7 (GAD-7). Data will be collected at baseline, immediately after the intervention, and at a 3-month follow-up. Qualitative data will be collected through semi-structured interviews with a subset of participants from the experimental group. The interviews will be conducted at the end of the intervention period, and will explore participants’ experiences of receiving CBT.

Data Analysis:

Quantitative data will be analyzed using descriptive statistics, t-tests, and mixed-model analyses of variance (ANOVA) to assess the effectiveness of the intervention. Qualitative data will be analyzed using thematic analysis to identify common themes and patterns in participants’ experiences of receiving CBT.

Ethical Considerations:

This study will comply with ethical guidelines for research involving human subjects. Participants will provide informed consent before participating in the study, and their privacy and confidentiality will be protected throughout the study. Any adverse events or reactions will be reported and managed appropriately.

Data Management:

All data collected will be kept confidential and stored securely using password-protected databases. Identifying information will be removed from qualitative data transcripts to ensure participants’ anonymity.

Limitations:

One potential limitation of this study is that it only focuses on one type of psychotherapy, CBT, and may not generalize to other types of therapy or interventions. Another limitation is that the study will only include participants from community mental health clinics, which may not be representative of the general population.

Conclusion:

This research aims to investigate the effectiveness of CBT in reducing symptoms of depression in adults. By using a randomized controlled trial and a mixed-methods approach, the study will provide valuable insights into the mechanisms underlying the relationship between CBT and depression. The results of this study will have important implications for the development of effective treatments for depression in clinical settings.

How to Write Research Methodology

Writing a research methodology involves explaining the methods and techniques you used to conduct research, collect data, and analyze results. It’s an essential section of any research paper or thesis, as it helps readers understand the validity and reliability of your findings. Here are the steps to write a research methodology:

• Start by explaining your research question: Begin the methodology section by restating your research question and explaining why it’s important. This helps readers understand the purpose of your research and the rationale behind your methods.
• Describe your research design: Explain the overall approach you used to conduct research. This could be a qualitative or quantitative research design, experimental or non-experimental, case study or survey, etc. Discuss the advantages and limitations of the chosen design.
• Discuss your sample: Describe the participants or subjects you included in your study. Include details such as their demographics, sampling method, sample size, and any exclusion criteria used.
• Describe your data collection methods : Explain how you collected data from your participants. This could include surveys, interviews, observations, questionnaires, or experiments. Include details on how you obtained informed consent, how you administered the tools, and how you minimized the risk of bias.
• Explain your data analysis techniques: Describe the methods you used to analyze the data you collected. This could include statistical analysis, content analysis, thematic analysis, or discourse analysis. Explain how you dealt with missing data, outliers, and any other issues that arose during the analysis.
• Discuss the validity and reliability of your research : Explain how you ensured the validity and reliability of your study. This could include measures such as triangulation, member checking, peer review, or inter-coder reliability.
• Acknowledge any limitations of your research: Discuss any limitations of your study, including any potential threats to validity or generalizability. This helps readers understand the scope of your findings and how they might apply to other contexts.
• Provide a summary: End the methodology section by summarizing the methods and techniques you used to conduct your research. This provides a clear overview of your research methodology and helps readers understand the process you followed to arrive at your findings.

When to Write Research Methodology

Research methodology is typically written after the research proposal has been approved and before the actual research is conducted. It should be written prior to data collection and analysis, as it provides a clear roadmap for the research project.

The research methodology is an important section of any research paper or thesis, as it describes the methods and procedures that will be used to conduct the research. It should include details about the research design, data collection methods, data analysis techniques, and any ethical considerations.

The methodology should be written in a clear and concise manner, and it should be based on established research practices and standards. It is important to provide enough detail so that the reader can understand how the research was conducted and evaluate the validity of the results.

Applications of Research Methodology

Here are some of the applications of research methodology:

• To identify the research problem: Research methodology is used to identify the research problem, which is the first step in conducting any research.
• To design the research: Research methodology helps in designing the research by selecting the appropriate research method, research design, and sampling technique.
• To collect data: Research methodology provides a systematic approach to collect data from primary and secondary sources.
• To analyze data: Research methodology helps in analyzing the collected data using various statistical and non-statistical techniques.
• To test hypotheses: Research methodology provides a framework for testing hypotheses and drawing conclusions based on the analysis of data.
• To generalize findings: Research methodology helps in generalizing the findings of the research to the target population.
• To develop theories : Research methodology is used to develop new theories and modify existing theories based on the findings of the research.
• To evaluate programs and policies : Research methodology is used to evaluate the effectiveness of programs and policies by collecting data and analyzing it.
• To improve decision-making: Research methodology helps in making informed decisions by providing reliable and valid data.

Purpose of Research Methodology

Research methodology serves several important purposes, including:

• To guide the research process: Research methodology provides a systematic framework for conducting research. It helps researchers to plan their research, define their research questions, and select appropriate methods and techniques for collecting and analyzing data.
• To ensure research quality: Research methodology helps researchers to ensure that their research is rigorous, reliable, and valid. It provides guidelines for minimizing bias and error in data collection and analysis, and for ensuring that research findings are accurate and trustworthy.
• To replicate research: Research methodology provides a clear and detailed account of the research process, making it possible for other researchers to replicate the study and verify its findings.
• To advance knowledge: Research methodology enables researchers to generate new knowledge and to contribute to the body of knowledge in their field. It provides a means for testing hypotheses, exploring new ideas, and discovering new insights.
• To inform decision-making: Research methodology provides evidence-based information that can inform policy and decision-making in a variety of fields, including medicine, public health, education, and business.

Advantages of Research Methodology

Research methodology has several advantages that make it a valuable tool for conducting research in various fields. Here are some of the key advantages of research methodology:

• Systematic and structured approach : Research methodology provides a systematic and structured approach to conducting research, which ensures that the research is conducted in a rigorous and comprehensive manner.
• Objectivity : Research methodology aims to ensure objectivity in the research process, which means that the research findings are based on evidence and not influenced by personal bias or subjective opinions.
• Replicability : Research methodology ensures that research can be replicated by other researchers, which is essential for validating research findings and ensuring their accuracy.
• Reliability : Research methodology aims to ensure that the research findings are reliable, which means that they are consistent and can be depended upon.
• Validity : Research methodology ensures that the research findings are valid, which means that they accurately reflect the research question or hypothesis being tested.
• Efficiency : Research methodology provides a structured and efficient way of conducting research, which helps to save time and resources.
• Flexibility : Research methodology allows researchers to choose the most appropriate research methods and techniques based on the research question, data availability, and other relevant factors.
• Scope for innovation: Research methodology provides scope for innovation and creativity in designing research studies and developing new research techniques.

Research Methodology Vs Research Methods

About the author

Muhammad Hassan

Researcher, Academic Writer, Web developer

You may also like

Research Methods – Types, Examples and Guide

Scope of the Research – Writing Guide and...

References in Research – Types, Examples and...

Research Summary – Structure, Examples and...

Research Paper Format – Types, Examples and...

Ethical Considerations – Types, Examples and...

Reference management. Clean and simple.

What is research methodology?

The basics of research methodology

Why do you need a research methodology, what needs to be included, why do you need to document your research method, what are the different types of research instruments, qualitative / quantitative / mixed research methodologies, how do you choose the best research methodology for you, frequently asked questions about research methodology, related articles.

When you’re working on your first piece of academic research, there are many different things to focus on, and it can be overwhelming to stay on top of everything. This is especially true of budding or inexperienced researchers.

If you’ve never put together a research proposal before or find yourself in a position where you need to explain your research methodology decisions, there are a few things you need to be aware of.

Once you understand the ins and outs, handling academic research in the future will be less intimidating. We break down the basics below:

A research methodology encompasses the way in which you intend to carry out your research. This includes how you plan to tackle things like collection methods, statistical analysis, participant observations, and more.

You can think of your research methodology as being a formula. One part will be how you plan on putting your research into practice, and another will be why you feel this is the best way to approach it. Your research methodology is ultimately a methodological and systematic plan to resolve your research problem.

In short, you are explaining how you will take your idea and turn it into a study, which in turn will produce valid and reliable results that are in accordance with the aims and objectives of your research. This is true whether your paper plans to make use of qualitative methods or quantitative methods.

The purpose of a research methodology is to explain the reasoning behind your approach to your research - you'll need to support your collection methods, methods of analysis, and other key points of your work.

Think of it like writing a plan or an outline for you what you intend to do.

When carrying out research, it can be easy to go off-track or depart from your standard methodology.

Tip: Having a methodology keeps you accountable and on track with your original aims and objectives, and gives you a suitable and sound plan to keep your project manageable, smooth, and effective.

With all that said, how do you write out your standard approach to a research methodology?

As a general plan, your methodology should include the following information:

• Your research method.  You need to state whether you plan to use quantitative analysis, qualitative analysis, or mixed-method research methods. This will often be determined by what you hope to achieve with your research.
• Explain your reasoning. Why are you taking this methodological approach? Why is this particular methodology the best way to answer your research problem and achieve your objectives?
• Explain your instruments.  This will mainly be about your collection methods. There are varying instruments to use such as interviews, physical surveys, questionnaires, for example. Your methodology will need to detail your reasoning in choosing a particular instrument for your research.
• What will you do with your results?  How are you going to analyze the data once you have gathered it?
• Advise your reader.  If there is anything in your research methodology that your reader might be unfamiliar with, you should explain it in more detail. For example, you should give any background information to your methods that might be relevant or provide your reasoning if you are conducting your research in a non-standard way.
• How will your sampling process go?  What will your sampling procedure be and why? For example, if you will collect data by carrying out semi-structured or unstructured interviews, how will you choose your interviewees and how will you conduct the interviews themselves?
• Any practical limitations?  You should discuss any limitations you foresee being an issue when you’re carrying out your research.

In any dissertation, thesis, or academic journal, you will always find a chapter dedicated to explaining the research methodology of the person who carried out the study, also referred to as the methodology section of the work.

A good research methodology will explain what you are going to do and why, while a poor methodology will lead to a messy or disorganized approach.

You should also be able to justify in this section your reasoning for why you intend to carry out your research in a particular way, especially if it might be a particularly unique method.

Having a sound methodology in place can also help you with the following:

• When another researcher at a later date wishes to try and replicate your research, they will need your explanations and guidelines.
• In the event that you receive any criticism or questioning on the research you carried out at a later point, you will be able to refer back to it and succinctly explain the how and why of your approach.
• It provides you with a plan to follow throughout your research. When you are drafting your methodology approach, you need to be sure that the method you are using is the right one for your goal. This will help you with both explaining and understanding your method.
• It affords you the opportunity to document from the outset what you intend to achieve with your research, from start to finish.

A research instrument is a tool you will use to help you collect, measure and analyze the data you use as part of your research.

The choice of research instrument will usually be yours to make as the researcher and will be whichever best suits your methodology.

There are many different research instruments you can use in collecting data for your research.

Generally, they can be grouped as follows:

• Interviews (either as a group or one-on-one). You can carry out interviews in many different ways. For example, your interview can be structured, semi-structured, or unstructured. The difference between them is how formal the set of questions is that is asked of the interviewee. In a group interview, you may choose to ask the interviewees to give you their opinions or perceptions on certain topics.
• Surveys (online or in-person). In survey research, you are posing questions in which you ask for a response from the person taking the survey. You may wish to have either free-answer questions such as essay-style questions, or you may wish to use closed questions such as multiple choice. You may even wish to make the survey a mixture of both.
• Focus Groups.  Similar to the group interview above, you may wish to ask a focus group to discuss a particular topic or opinion while you make a note of the answers given.
• Observations.  This is a good research instrument to use if you are looking into human behaviors. Different ways of researching this include studying the spontaneous behavior of participants in their everyday life, or something more structured. A structured observation is research conducted at a set time and place where researchers observe behavior as planned and agreed upon with participants.

These are the most common ways of carrying out research, but it is really dependent on your needs as a researcher and what approach you think is best to take.

It is also possible to combine a number of research instruments if this is necessary and appropriate in answering your research problem.

There are three different types of methodologies, and they are distinguished by whether they focus on words, numbers, or both.

➡️ Want to learn more about the differences between qualitative and quantitative research, and how to use both methods? Check out our guide for that!

If you've done your due diligence, you'll have an idea of which methodology approach is best suited to your research.

It’s likely that you will have carried out considerable reading and homework before you reach this point and you may have taken inspiration from other similar studies that have yielded good results.

Still, it is important to consider different options before setting your research in stone. Exploring different options available will help you to explain why the choice you ultimately make is preferable to other methods.

If proving your research problem requires you to gather large volumes of numerical data to test hypotheses, a quantitative research method is likely to provide you with the most usable results.

If instead you’re looking to try and learn more about people, and their perception of events, your methodology is more exploratory in nature and would therefore probably be better served using a qualitative research methodology.

It helps to always bring things back to the question: what do I want to achieve with my research?

Once you have conducted your research, you need to analyze it. Here are some helpful guides for qualitative data analysis:

➡️  How to do a content analysis

➡️  How to do a thematic analysis

➡️  How to do a rhetorical analysis

Research methodology refers to the techniques used to find and analyze information for a study, ensuring that the results are valid, reliable and that they address the research objective.

Data can typically be organized into four different categories or methods: observational, experimental, simulation, and derived.

Writing a methodology section is a process of introducing your methods and instruments, discussing your analysis, providing more background information, addressing your research limitations, and more.

Your research methodology section will need a clear research question and proposed research approach. You'll need to add a background, introduce your research question, write your methodology and add the works you cited during your data collecting phase.

The research methodology section of your study will indicate how valid your findings are and how well-informed your paper is. It also assists future researchers planning to use the same methodology, who want to cite your study or replicate it.

Research Methodologies

• What are research designs?
• What are research methodologies?

What are research methods?

Quantitative research methods, qualitative research methods, mixed method approach, selecting the best research method.

• Additional Sources

Research methods are different from research methodologies because they are the ways in which you will collect the data for your research project.  The best method for your project largely depends on your topic, the type of data you will need, and the people or items from which you will be collecting data.  The following boxes below contain a list of quantitative, qualitative, and mixed research methods.

• Closed-ended questionnaires/survey: These types of questionnaires or surveys are like "multiple choice" tests, where participants must select from a list of premade answers.  According to the content of the question, they must select the one that they agree with the most.  This approach is the simplest form of quantitative research because the data is easy to combine and quantify.
• Structured interviews: These are a common research method in market research because the data can be quantified.  They are strictly designed for little "wiggle room" in the interview process so that the data will not be skewed.  You can conduct structured interviews in-person, online, or over the phone (Dawson, 2019).

Constructing Questionnaires

When constructing your questions for a survey or questionnaire, there are things you can do to ensure that your questions are accurate and easy to understand (Dawson, 2019):

• Keep the questions brief and simple.
• Eliminate any potential bias from your questions.  Make sure that they do not word things in a way that favor one perspective over another.
• If your topic is very sensitive, you may want to ask indirect questions rather than direct ones.  This prevents participants from being intimidated and becoming unwilling to share their true responses.
• If you are using a closed-ended question, try to offer every possible answer that a participant could give to that question.
• Do not ask questions that assume something of the participant.  The question "How often do you exercise?" assumes that the participant exercises (when they may not), so you would want to include a question that asks if they exercise at all before asking them how often.
• Try and keep the questionnaire as short as possible.  The longer a questionnaire takes, the more likely the participant will not complete it or get too tired to put truthful answers.
• Promise confidentiality to your participants at the beginning of the questionnaire.

Quantitative Research Measures

When you are considering a quantitative approach to your research, you need to identify why types of measures you will use in your study.  This will determine what type of numbers you will be using to collect your data.  There are four levels of measurement:

• Nominal: These are numbers where the order of the numbers do not matter.  They aim to identify separate information.  One example is collecting zip codes from research participants.  The order of the numbers does not matter, but the series of numbers in each zip code indicate different information (Adamson and Prion, 2013).
• Ordinal: Also known as rankings because the order of these numbers matter.  This is when items are given a specific rank according to specific criteria.  A common example of ordinal measurements include ranking-based questionnaires, where participants are asked to rank items from least favorite to most favorite.  Another common example is a pain scale, where a patient is asked to rank their pain on a scale from 1 to 10 (Adamson and Prion, 2013).
• Interval: This is when the data are ordered and the distance between the numbers matters to the researcher (Adamson and Prion, 2013).  The distance between each number is the same.  An example of interval data is test grades.
• Ratio: This is when the data are ordered and have a consistent distance between numbers, but has a "zero point."  This means that there could be a measurement of zero of whatever you are measuring in your study (Adamson and Prion, 2013).  An example of ratio data is measuring the height of something because the "zero point" remains constant in all measurements.  The height of something could also be zero.

Focus Groups

This is when a select group of people gather to talk about a particular topic.  They can also be called discussion groups or group interviews (Dawson, 2019).  They are usually lead by a moderator  to help guide the discussion and ask certain questions.  It is critical that a moderator allows everyone in the group to get a chance to speak so that no one dominates the discussion.  The data that are gathered from focus groups tend to be thoughts, opinions, and perspectives about an issue.

Advantages of Focus Groups

• Only requires one meeting to get different types of responses.
• Less researcher bias due to participants being able to speak openly.
• Helps participants overcome insecurities or fears about a topic.
• The researcher can also consider the impact of participant interaction.

Disadvantages of Focus Groups

• Participants may feel uncomfortable to speak in front of an audience, especially if the topic is sensitive or controversial.
• Since participation is voluntary, not every participant may contribute equally to the discussion.
• Participants may impact what others say or think.
• A researcher may feel intimidated by running a focus group on their own.
• A researcher may need extra funds/resources to provide a safe space to host the focus group.
• Because the data is collective, it may be difficult to determine a participant's individual thoughts about the research topic.

Observation

There are two ways to conduct research observations:

• Direct Observation: The researcher observes a participant in an environment.  The researcher often takes notes or uses technology to gather data, such as a voice recorder or video camera.  The researcher does not interact or interfere with the participants.  This approach is often used in psychology and health studies (Dawson, 2019).
• Participant Observation:  The researcher interacts directly with the participants to get a better understanding of the research topic.  This is a common research method when trying to understand another culture or community.  It is important to decide if you will conduct a covert (participants do not know they are part of the research) or overt (participants know the researcher is observing them) observation because it can be unethical in some situations (Dawson, 2019).

Open-Ended Questionnaires

These types of questionnaires are the opposite of "multiple choice" questionnaires because the answer boxes are left open for the participant to complete.  This means that participants can write short or extended answers to the questions.  Upon gathering the responses, researchers will often "quantify" the data by organizing the responses into different categories.  This can be time consuming because the researcher needs to read all responses carefully.

Semi-structured Interviews

This is the most common type of interview where researchers aim to get specific information so they can compare it to other interview data.  This requires asking the same questions for each interview, but keeping their responses flexible.  This means including follow-up questions if a subject answers a certain way.  Interview schedules are commonly used to aid the interviewers, which list topics or questions that will be discussed at each interview (Dawson, 2019).

Theoretical Analysis

Often used for nonhuman research, theoretical analysis is a qualitative approach where the researcher applies a theoretical framework to analyze something about their topic.  A theoretical framework gives the researcher a specific "lens" to view the topic and think about it critically. it also serves as context to guide the entire study.  This is a popular research method for analyzing works of literature, films, and other forms of media.  You can implement more than one theoretical framework with this method, as many theories complement one another.

Common theoretical frameworks for qualitative research are (Grant and Osanloo, 2014):

• Behavioral theory
• Change theory
• Cognitive theory
• Content analysis
• Cross-sectional analysis
• Developmental theory
• Feminist theory
• Gender theory
• Marxist theory
• Queer theory
• Systems theory
• Transformational theory

Unstructured Interviews

These are in-depth interviews where the researcher tries to understand an interviewee's perspective on a situation or issue.  They are sometimes called life history interviews.  It is important not to bombard the interviewee with too many questions so they can freely disclose their thoughts (Dawson, 2019).

• Open-ended and closed-ended questionnaires: This approach means implementing elements of both questionnaire types into your data collection.  Participants may answer some questions with premade answers and write their own answers to other questions.  The advantage to this method is that you benefit from both types of data collection to get a broader understanding of you participants.  However, you must think carefully about how you will analyze this data to arrive at a conclusion.

Other mixed method approaches that incorporate quantitative and qualitative research methods depend heavily on the research topic.  It is strongly recommended that you collaborate with your academic advisor before finalizing a mixed method approach.

How do you determine which research method would be best for your proposal?  This heavily depends on your research objective.  According to Dawson (2019), there are several questions to ask yourself when determining the best research method for your project:

• Are you good with numbers and mathematics?
• Would you be interested in conducting interviews with human subjects?
• Would you enjoy creating a questionnaire for participants to complete?
• Do you prefer written communication or face-to-face interaction?
• What skills or experiences do you have that might help you with your research?  Do you have any experiences from past research projects that can help with this one?
• How much time do you have to complete the research?  Some methods take longer to collect data than others.
• What is your budget?  Do you have adequate funding to conduct the research in the method you  want?
• How much data do you need?  Some research topics need only a small amount of data while others may need significantly larger amounts.
• What is the purpose of your research? This can provide a good indicator as to what research method will be most appropriate.
• << Previous: What are research methodologies?
• Next: Additional Sources >>
• Last Updated: Aug 2, 2022 2:36 PM
• URL: https://library.tiffin.edu/researchmethodologies

The 10 Elements of Academic Research (10P s )

• First Online: 07 January 2023

Cite this chapter

• Candauda Arachchige Saliya 2  

426 Accesses

The focus of this book is not only on doing research as course work, but also to organise and conduct the whole research process with a view to publishing important results.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Subscribe and save.

• Get 10 units per month
• Download Article/Chapter or eBook
• 1 Unit = 1 Article or 1 Chapter
• Cancel anytime
• Available as PDF
• Read on any device
• Instant download
• Own it forever
• Available as EPUB and PDF
• Compact, lightweight edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info
• Durable hardcover edition

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

References/Further Reading

Alvesson, M., & Sköldberg, K. (2009). Reflexive methodology: New vistas for qualitative research . Sage.

Google Scholar  

Denzin, N. K. & Lincoln, Y. S. (2005). Introduction: The discipline and practice of qualitative research. In: N. K. Denzin, Y. S. Lincoln (Eds.), The landscape of qualitative Research: theories and issues . London. Sage, 1–6.

Gournelos, T., Hammonds, J. R., & Wilson, M. A. (2019). Doing academic research: A practical guide to research methods and analysis . Thousand Oak, Taylor & Francis Group/Routledge.

Gray, E. D. (2018). Doing research in the real world (4th ed.). Sage.

van Rooij, E., Fokkens-Bruinsma, M., & Jansen, E. (2019). Factors that influence PhD candidates’ success: The importance of PhD project characteristics. Studies in Continuing Education . https://doi.org/10.1080/0158037X.2019.1652158 .

Saliya, C. A. (2021a). Conducting case study research: Practical guidance for management students. International Journal of KIU , 2(1), 1–13. https://ij.kiu.ac.lk/article/read/9 .

Varga, L. (2018). Mixed methods research: A method for complex systems. In E. Mitleton-Kelly, A. Paraskevas, & C. Day (Eds.), Edward Elgar handbook of research methods in complexity science (pp. 34–39). Edward Elgar Publishing.

Download references

Author information

Authors and affiliations.

Sri Lanka Institute of Information Technology, Malabe, Colombo, Sri Lanka

Candauda Arachchige Saliya

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Candauda Arachchige Saliya .

Rights and permissions

Reprints and permissions

Copyright information

© 2022 The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd.

About this chapter

Saliya, C.A. (2022). The 10 Elements of Academic Research (10P s ). In: Doing Social Research and Publishing Results. Springer, Singapore. https://doi.org/10.1007/978-981-19-3780-4_5

Download citation

DOI : https://doi.org/10.1007/978-981-19-3780-4_5

Published : 07 January 2023

Publisher Name : Springer, Singapore

Print ISBN : 978-981-19-3779-8

Online ISBN : 978-981-19-3780-4

eBook Packages : Social Sciences Social Sciences (R0)

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

Organizing Academic Research Papers: 6. The Methodology

• Purpose of Guide
• Design Flaws to Avoid
• Glossary of Research Terms
• Narrowing a Topic Idea
• Broadening a Topic Idea
• Extending the Timeliness of a Topic Idea
• Academic Writing Style
• Choosing a Title
• Making an Outline
• Paragraph Development
• Executive Summary
• Background Information
• The Research Problem/Question
• Theoretical Framework
• Citation Tracking
• Content Alert Services
• Evaluating Sources
• Primary Sources
• Secondary Sources
• Tertiary Sources
• What Is Scholarly vs. Popular?
• Qualitative Methods
• Quantitative Methods
• Using Non-Textual Elements
• Limitations of the Study
• Common Grammar Mistakes
• Avoiding Plagiarism
• Footnotes or Endnotes?
• Further Readings
• Annotated Bibliography
• Dealing with Nervousness
• Using Visual Aids
• Grading Someone Else's Paper
• How to Manage Group Projects
• Multiple Book Review Essay
• Reviewing Collected Essays
• About Informed Consent
• Writing Field Notes
• Writing a Policy Memo
• Writing a Research Proposal
• Acknowledgements

The methods section of a research paper provides the information by which a study’s validity is judged. The method section answers two main questions: 1) How was the data collected or generated? 2) How was it analyzed? The writing should be direct and precise and written in the past tense.

Importance of a Good Methodology Section

You must explain how you obtained and analyzed your results for the following reasons:

• Readers need to know how the data was obtained because the method you choose affects the results and, by extension, how you likely interpreted those results.
• Methodology is crucial for any branch of scholarship because an unreliable method produces unreliable results and it misappropriates interpretations of findings .
• In most cases, there are a variety of different methods you can choose to investigate a research problem. Your methodology section of your paper should make clear the reasons why you chose a particular method or procedure .
• The reader wants to know that the data was collected or generated in a way that is consistent with accepted practice in the field of study. For example, if you are using a questionnaire, readers need to know that it offered your respondents a reasonable range of answers to choose from.
• The research method must be appropriate to the objectives of the study . For example, be sure you have a large enough sample size to be able to generalize and make recommendations based upon the findings.
• The methodology should discuss the problems that were anticipated and the steps you took to prevent them from occurring . For any problems that did arise, you must describe the ways in which their impact was minimized or why these problems do not affect the findings in any way that impacts your interpretation of the data.
• Often in social science research, it is useful for other researchers to adapt or replicate your methodology. Therefore, it is important to always provide sufficient information to allow others to use or replicate the study . This information is particularly important when a new method had been developed or an innovative use of an existing method has been utilized.

Bem, Daryl J. Writing the Empirical Journal Article . Psychology Writing Center. University of Washington; Lunenburg, Frederick C. Writing a Successful Thesis or Dissertation: Tips and Strategies for Students in the Social and Behavioral Sciences . Thousand Oaks, CA: Corwin Press, 2008.

Structure and Writing Style

I. Groups of Research Methods

There are two main groups of research methods in the social sciences:

• The empirical-analytical group approaches the study of social sciences in a similar manner that researchers study the natural sciences. This type of research focuses on objective knowledge, research questions that can be answered yes or no, and operational definitions of variables to be measured. The empirical-analytical group employs deductive reasoning that uses existing theory as a foundation for hypotheses that need to be tested. This approach is focused on explanation .
• The interpretative group is focused on understanding phenomenon in a comprehensive, holistic way . This research method allows you to recognize your connection to the subject under study. Because the interpretative group focuses more on subjective knowledge, it requires careful interpretation of variables.

II. Content

An effectively written methodology section should:

• Introduce the overall methodological approach for investigating your research problem . Is your study qualitative or quantitative or a combination of both (mixed method)? Are you going to take a special approach, such as action research, or a more neutral stance?
• Indicate how the approach fits the overall research design . Your methods should have a clear connection with your research problem. In other words, make sure that your methods will actually address the problem. One of the most common deficiencies found in research papers is that the proposed methodology is unsuited to achieving the stated objective of your paper.
• Describe the specific methods of data collection you are going to use , such as, surveys, interviews, questionnaires, observation, archival research. If you are analyzing existing data, such as a data set or archival documents, describe how it was originally created or gathered and by whom.
• Explain how you intend to analyze your results . Will you use statistical analysis? Will you use specific theoretical perspectives to help you analyze a text or explain observed behaviors?
• Provide background and rationale for methodologies that are unfamiliar for your readers . Very often in the social sciences, research problems and the methods for investigating them require more explanation/rationale than widely accepted rules governing the natural and physical sciences. Be clear and concise in your explanation.
• Provide a rationale for subject selection and sampling procedure . For instance, if you propose to conduct interviews, how do you intend to select the sample population? If you are analyzing texts, which texts have you chosen, and why? If you are using statistics, why is this set of statisics being used? If other data sources exist, explain why the data you chose is most appropriate.
• Address potential limitations . Are there any practical limitations that could affect your data collection? How will you attempt to control for potential confounding variables and errors? If your methodology may lead to problems you can anticipate, state this openly and show why pursuing this methodology outweighs the risk of these problems cropping up.

NOTE :  Once you have written all of the elements of the methods section, subsequent revisions should focus on how to present those elements as clearly and as logically as possibly. The description of how you prepared to study the research problem, how you gathered the data, and the protocol for analyzing the data should be organized chronologically. For clarity, when a large amount of detail must be presented, information should be presented in sub-sections according to topic.

III.  Problems to Avoid

Irrelevant Detail The methodology section of your paper should be thorough but to the point. Don’t provide any background information that doesn’t directly help the reader to understand why a particular method was chosen, how the data was gathered or obtained, and how it was analyzed. Unnecessary Explanation of Basic Procedures Remember that you are not writing a how-to guide about a particular method. You should make the assumption that readers possess a basic understanding of how to investigate the research problem on their own and, therefore, you do not have to go into great detail about specific methodological procedures. The focus should be on how you applied a method , not on the mechanics of doing a method. NOTE: An exception to this rule is if you select an unconventional approach to doing the method; if this is the case, be sure to explain why this approach was chosen and how it enhances the overall research process. Problem Blindness It is almost a given that you will encounter problems when collecting or generating your data. Do not ignore these problems or pretend they did not occur. Often, documenting how you overcame obstacles can form an interesting part of the methodology. It demonstrates to the reader that you can provide a cogent rationale for the decisions you made to minimize the impact of any problems that arose. Literature Review Just as the literature review section of your paper provides an overview of sources you have examined while researching a particular topic, the methodology section should cite any sources that informed your choice and application of a particular method [i.e., the choice of a survey should include any citations to the works you used to help construct the survey].

It’s More than Sources of Information! A description of a research study's method should not be confused with a description of the sources of information. Such a list of sources is useful in itself, especially if it is accompanied by an explanation about the selection and use of the sources. The description of the project's methodology complements a list of sources in that it sets forth the organization and interpretation of information emanating from those sources.

Azevedo, L.F. et al. How to Write a Scientific Paper: Writing the Methods Section. Revista Portuguesa de Pneumologia 17 (2011): 232-238; Butin, Dan W. The Education Dissertation A Guide for Practitioner Scholars . Thousand Oaks, CA: Corwin, 2010; Carter, Susan. Structuring Your Research Thesis . New York: Palgrave Macmillan, 2012; Lunenburg, Frederick C. Writing a Successful Thesis or Dissertation: Tips and Strategies for Students in the Social and Behavioral Sciences . Thousand Oaks, CA: Corwin Press, 2008. Methods Section . The Writer’s Handbook. Writing Center. University of Wisconsin, Madison; Writing the Experimental Report: Methods, Results, and Discussion . The Writing Lab and The OWL. Purdue University; Methods and Materials . The Structure, Format, Content, and Style of a Journal-Style Scientific Paper. Department of Biology. Bates College.

Writing Tip

Statistical Designs and Tests? Do Not Fear Them!

Don't avoid using a quantitative approach to analyzing your research problem just because you fear the idea of applying statistical designs and tests. A qualitative approach, such as conducting interviews or content analysis of archival texts, can yield exciting new insights about a research problem, but it should not be undertaken simply because you have a disdain for running a simple regression. A well designed quantitative research study can often be accomplished in very clear and direct ways, whereas, a similar study of a qualitative nature usually requires considerable time to analyze large volumes of data and a tremendous burden to create new paths for analysis where previously no path associated with your research problem had existed.

Another Writing Tip

Knowing the Relationship Between Theories and Methods

There can be multiple meaning associated with the term "theories" and the term "methods" in social sciences research. A helpful way to delineate between them is to understand "theories" as representing different ways of characterizing the social world when you research it and "methods" as representing different ways of generating and analyzing data about that social world. Framed in this way, all empirical social sciences research involves theories and methods, whether they are stated explicitly or not. However, while theories and methods are often related, it is important that, as a researcher, you deliberately separate them in order to avoid your theories playing a disproportionate role in shaping what outcomes your chosen methods produce.

Introspectively engage in an ongoing dialectic between theories and methods to help enable you to use the outcomes from your methods to interrogate and develop new theories, or ways of framing conceptually the research problem. This is how scholarship grows and branches out into new intellectual territory.

Reynolds, R. Larry. Ways of Knowing. Alternative Microeconomics. Part 1, Chapter 3. Boise State University; The Theory-Method Relationship . S-Cool Revision. United Kingdom.

• << Previous: What Is Scholarly vs. Popular?
• Next: Qualitative Methods >>
• Last Updated: Jul 18, 2023 11:58 AM
• URL: https://library.sacredheart.edu/c.php?g=29803
• QuickSearch
• Library Catalog
• Databases A-Z
• Publication Finder
• Course Reserves
• Citation Linker
• Digital Commons
• Our Website

Research Support

• Ask a Librarian
• Appointments
• Interlibrary Loan (ILL)
• Research Guides
• Databases by Subject
• Citation Help

Using the Library

• Reserve a Group Study Room
• Renew Books
• Honors Study Rooms
• Off-Campus Access
• Library Policies
• Library Technology

User Information

• Grad Students
• Online Students
• COVID-19 Updates
• Staff Directory
• News & Announcements
• Library Newsletter

My Accounts

• Interlibrary Loan
• Staff Site Login

FIND US ON  

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Digitalization and digital applications in waste recycling: an integrative review.

1. Introduction

2. materials and methods, 2.1. data collection for bibliometric analysis, 2.2. data analysis, 3. bibliometric findings, 3.1. word cloud analysis, 3.2. co-word analyses of digitalization in the waste recycling literature in the period 2013–2024, 4. discussion and implications, 4.1. the following themes are most associated with the waste recycling and digitalization literature, 4.2. prominent themes related to digital tools in the waste recycling and digitalization literature, 4.3. the types of waste most relevant to the waste recycling and digitalization literature, 4.4. digital applications used in digital-based waste recycling.

5. Conclusions and Future Directions

Author contributions, institutional review board statement, data availability statement, conflicts of interest.

• Camón Luis, E.; Celma, D. Circular Economy. A Review and Bibliometric Analysis. Sustainability 2020 , 12 , 6381. [ Google Scholar ] [ CrossRef ]
• Ahmed, F.; Hasan, S.; Rana, M.S.; Sharmin, N. A conceptual framework for zero waste management in Bangladesh. Int. J. Environ. Sci. Technol. 2023 , 20 , 1887–1904. [ Google Scholar ] [ CrossRef ]
• Seyyedi, S.R.; Kowsari, E.; Gheibi, M.; Chinnappan, A.; Ramakrishna, S. A comprehensive review integration of digitalization and circular economy in waste management by adopting artificial intelligence approaches: Towards a simulation model. J. Clean. Prod. 2024 , 460 , 142584. [ Google Scholar ] [ CrossRef ]
• Jahani, N.; Sepehri, A.; Vandchali, H.R.; Tirkolaee, E.B. Application of industry 4.0 in the procurement processes of supply chains: A systematic literature review. Sustainability 2021 , 13 , 7520. [ Google Scholar ] [ CrossRef ]
• Mohamed, N.H.; Khan, S.; Jagtap, S. Modernizing Medical Waste Management: Unleashing the Power of the Internet of Things (IoT). Sustainability 2023 , 15 , 9909. [ Google Scholar ] [ CrossRef ]
• Borchard, R.; Zeiss, R.; Recker, J. Digitalization of waste management: Insights from German private and public waste management firms. Waste Manag. Res. 2022 , 40 , 775–792. [ Google Scholar ] [ CrossRef ]
• Czekała, W.; Drozdowski, J.; Łabiak, P. Modern Technologies for Waste Management: A Review. Appl. Sci. 2023 , 13 , 8847. [ Google Scholar ] [ CrossRef ]
• Torraco, R.J. Writing integrative literature reviews: Using the past and present to explore the future. Hum. Resour. Dev. Rev. 2016 , 15 , 404–428. [ Google Scholar ] [ CrossRef ]
• Gough, D.; Thomas, J.; Oliver, S. Clarifying differences between review designs and methods. Syst. Rev. 2012 , 1 , 28. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Soares, C.B.; Hoga, L.A.; Peduzzi, M.; Sangaleti, C.; Yonekura, T.; Silva, D.R. Revisão integrativa: Conceitos e métodos utilizados na enfermagem [Integrative review: Concepts and methods used in nursing]. Rev. Esc. Enferm. USP 2014 , 48 , 335–345. [ Google Scholar ] [ CrossRef ]
• Ariaa, M.; Cuccurullo, C. Bibliometrix: An r-tool for comprehensive science mapping analysis. J. Informetr. J. 2017 , 11 , 959–975. [ Google Scholar ] [ CrossRef ]
• Whittemore, R.; Knafl, K. The integrative review: Updated methodology. J. Adv. Nurs. 2005 , 5 , 546–553. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Moher, D.; Liberati, A.; Tetzlaff, J.; Altman, D.G.; Group, T.P. Preferred reporting items for systematic reviews and meta-analyses: The PRISMA statement. PLoS Med. 2009 , 6 , e1000097. [ Google Scholar ] [ CrossRef ]
• Zupic, I.; Cater, T. Bibliometric methods in management and organization. Organ. Res. Methods 2015 , 18 , 429–472. [ Google Scholar ] [ CrossRef ]
• Van Eck, N.J.; Waltman, L. Software survey: VOSviewer, a computer program for bibliometric mapping. Scientometrics 2010 , 84 , 523–538. [ Google Scholar ] [ CrossRef ]
• Birkle, C.; Pendlebury, D.A.; Schnell, J.; Adams, J. Web of Science as a data source for research on scientific and scholarly activity. Quant. Sci. Stud. 2020 , 1 , 363–376. [ Google Scholar ] [ CrossRef ]
• Atenstaedt, R. Word cloud analysis of the BJGP. Br. J. Gen. Pract. 2012 , 62 , 148. [ Google Scholar ] [ CrossRef ]
• Mulay, P.; Joshi, R.; Chaudhari, A. Distributed incremental clustering algorithms: A bibliometric and word-cloud review analysis. Sci. Technol. Lib. 2020 , 39 , 289–306. [ Google Scholar ] [ CrossRef ]
• Chen, X.; Chen, J.; Wu, D.; Xie, Y.; Li, J. Mapping the Research Trends by Co-word Analysis Based on Keywords from Funded Project. Procedia Comput. Sci. 2016 , 91 , 547–555. [ Google Scholar ] [ CrossRef ]
• De la Hoz-Correa, A.; Muñoz-Leiva, F.; Bakucz, M. Past Themes and Future Trends in Medical Tourism Research: A Co-Word Analysis. Tour. Manag. 2018 , 65 , 200–211. [ Google Scholar ] [ CrossRef ]
• Muñoz-Leiva, F.; Viedma-del-Jesús, M.I.; Sánchez-Fernández, J.; López-Herrera, A.G. An application of co-word analysis and bibliometric maps for detecting the most highlighting themes in the consumer behaviour research from a longitudinal perspective. Qual Quant. 2012 , 46 , 1077–1095. [ Google Scholar ] [ CrossRef ]
• Coulter, N.; Monarch, I.; Konda, S. Software engineering as seen through its research literature: A study in co-word analysis. J. Am. Soc. Inf. Sci. 1998 , 49 , 1206–1223. [ Google Scholar ] [ CrossRef ]
• Garfield, E. Scientography: Mapping the tracks of science. Curr. Contents Soc. Behav. Sci. 1994 , 7 , 5–10. [ Google Scholar ]
• Nizar, M.; Munir, E.; Irvan, I.; Amir, F. Examining the economic benefits of urban waste recycle based on zero waste concepts. In 1st Aceh Global Conference ; Atlantis Press: Amsterdam, The Netherlands, 2019; pp. 300–309. [ Google Scholar ]
• Blomsma, F.; Brennan, G. The Emergence of Circular Economy: A New Framing Around Prolonging Resource Productivity. J. Ind. Ecol. 2017 , 21 , 603–614. [ Google Scholar ] [ CrossRef ]
• Sarc, R.; Curtis, A.; Kandlbauer, L.; Khodier, K.; Lorber, K.E.; Pomberger, R. Digitalisation and intelligent robotics in value chain of circular economy-oriented waste management—A review. Waste Manag. 2019 , 95 , 476–492. [ Google Scholar ] [ CrossRef ]
• Czekała, W.; Pulka, J.; Jasiński, T.; Szewczyk, P.; Bojarski, W.; Jasiński, J. Waste as substrates for agricultural biogas plants: A case study from Poland. J. Water Land. Dev. 2023 , 56 , 45–50. [ Google Scholar ] [ CrossRef ]
• Kannan, D.; Khademolqorani, S.; Janatyan, N.; Alavi, S. Smart waste management 4.0: The transition from a systematic review to an integrated framework. Waste Manag. 2024 , 174 , 1–14. [ Google Scholar ] [ CrossRef ]
• Sharma, S.; Basu, N.P.; Shetti, M.; Kamali, P.; Walvekar, T.M. Aminabhavi Waste-to-energy nexus: A sustainable development. Environ. Pollut. 2020 , 267 , 115501. [ Google Scholar ] [ CrossRef ]
• Lin, K.; Zhao, Y.; Kuo, J.-H.; Deng, H.; Cui, F.; Zhang, Z.; Zhang, M.; Zhao, C.; Gao, X.; Zhou, T.; et al. Toward smarter management and recovery of municipal solid waste: A critical review on deep learning approaches. J. Clean. Prod. 2022 , 346 , 130943. [ Google Scholar ] [ CrossRef ]
• Goutam Mukherjee, A.; Ramesh Wanjari, U.; Chakraborty, R.; Renu, K.; Vellingiri, B.; George, A.; CR, S.R.; Valsala Gopalakrishnan, A. A Review on Modern and Smart Technologies for Efficient Waste Disposal and Management. J. Environ. Manag. 2021 , 297 , 113347. [ Google Scholar ] [ CrossRef ]
• Mingaleva, Z.; Vukovic, N.; Volkova, I.; Salimova, T. Waste Management in Green and Smart Cities: A Case Study of Russia. Sustain. Sci. Pract. Policy 2019 , 12 , 94. [ Google Scholar ] [ CrossRef ]
• Kumar, S.; Singh, D. Smart cities waste minimization, remanufacturing, reuse, and recycling solutions using IoT and ML. In Proceedings of the 2024 IEEE International Conference on Computing, Power and Communication Technologies (IC2PCT), Greater Noida, India, 9–10 February 2024; IEEE: Piscataway, NJ, USA, 2024; pp. 1546–1552. [ Google Scholar ]
• Shyam, G.K.; Manvi, S.S.; Bharti, P. SmartWaste Management Using Internet-of-Things (IoT). In Proceedings of the 2017 2nd International Conference on Computing and Communications Technologies (ICCCT), Chennai, India, 23–24 February 2017. [ Google Scholar ]
• Rangaswamy, A.; Moch, N.; Felten, C.; van Bruggen, G.; Wieringa, J.E.; Wirtz, J. The role of marketing in digital business platforms. J. Interact. Mark. 2020 , 51 , 72–90. [ Google Scholar ] [ CrossRef ]
• Frishammar, J.; Cenamor, J.; Cavalli-Björkman, H.; Hernell, E.; Carlsson, J. Digital strategies for two-sided markets: A case study of shopping malls. Decis. Support Syst. 2018 , 108 , 34–44. [ Google Scholar ] [ CrossRef ]
• The Digitalisation of Waste Management; Survey Reveals Uncertainty among Disposal Companies. Available online: https://www.netwaste.de/blog/waste-5-0/die-digitalisierung-der-abfallwirtschaft-umfrage-deckt-unsicherheit-bei-entsorgern-auf/#more-496 (accessed on 1 March 2024).
• Ghobakhloo, M.; Fathi, M.; Iranmanesh, M.; Maroufkhani, P.; Morales, M.E. Industry 4.0 ten years on: A bibliometric and systematic review of concepts, sustainability value drivers, and success determinants. J. Clean. Prod. 2021 , 302 , 127052. [ Google Scholar ] [ CrossRef ]
• Alidoosti, Z.; Sadegheih, A.; Govindan, K.; Pishvaee, M.S. Sustainable network design of bioenergies generation based on municipal solid waste (MSW) management under uncertainty. J. Renew. Sustain. Energy 2023 , 15 , 013103. [ Google Scholar ] [ CrossRef ]
• Usman, M.; Jahanger, A.; Makhdum, M.S.A.; Balsalobre-Lorente, D.; Bashir, A. How do financial development, energy consumption, natural resources, and globalization affect Arctic countries’ economic growth and environmental quality? An advanced panel data simulation. Energy 2022 , 241 , 122515. [ Google Scholar ] [ CrossRef ]
• Zota, R.D.; Cîmpeanu, I.A.; Dragomir, D.A.; Lungu, M.A. Practical Approach for Smart and Circular Cities: Chatbots Used in Waste Recycling. Appl. Sci. 2024 , 14 , 3060. [ Google Scholar ] [ CrossRef ]
• Ndou, V.; Rampedi, I.T. Bibliometric Analysis of Municipal Solid Waste Management Research: Global and South African Trends. Sustainability 2022 , 14 , 10229. [ Google Scholar ] [ CrossRef ]
• Luić, L.; Krešimir, L. Information Practices and Digital Perspectives of Municipal Waste Recovery Providers in Europe. Teh. Glas. 2021 , 15 , 392–400. [ Google Scholar ] [ CrossRef ]
• Matuszewska, A.; Owczuk, M.; Biernat, K. Current Trends in Waste Plastics’ Liquefaction into Fuel Fraction: A Review. Energies 2022 , 15 , 2719. [ Google Scholar ] [ CrossRef ]
• Cane, M.; Parra, C. Digital platforms: Mapping the territory of new technologies to fight food waste. Br. Food J. 2020 , 122 , 1647–1669. [ Google Scholar ] [ CrossRef ]
• Bonadonna, A.; Matozzo, A.; Giachino, C.; Peira, G. Farmer behavior and perception regarding food waste and unsold food. Br. Food J. 2019 , 121 , 89–103. [ Google Scholar ] [ CrossRef ]
• Michelini, L.; Principato, L.; Iasevoli, G. Understanding food sharing models to tackle sustainability challenges. Ecol. Econ. 2018 , 145 , 205–217. [ Google Scholar ] [ CrossRef ]
• Li, Q.; Sun, P. Research trend of construction debris reclamation home and abroad. China Build. Mater. Sci. Technol. 2009 , 4 , 119–122. [ Google Scholar ]
• Arya, S.; Kumar, S. E-waste in India at a glance: Current trends, regulations, challenges and management strategies. J. Clean. Prod. 2020 , 271 , 122707. [ Google Scholar ] [ CrossRef ]
• Farjana, M.; Fahad, A.B.; Alam, S.E.; Islam, M.M. An IoT- and Cloud-Based E-Waste Management System for Resource Reclamation with a Data-Driven Decision-Making Process. IoT 2023 , 4 , 202–220. [ Google Scholar ] [ CrossRef ]
• Mahipal, S.S.; Mayuri, K.; Manisha, N.; Shriyash, M.; Gaurav, S.; Bhaskar, C.; Rajeev, K. Effect of Electronic waste on Environmental & Human health-A Review. IOSR J. Environ. Sci. Toxicol. Food Technol. (IOSR-JESTFT) 2016 , 10 , 98–104. [ Google Scholar ]
• Ali, S.S.; Elsamahy, T.; Koutra, E.; Kornaros, M.; El-Sheekh, M.; Abdelkarim, E.A.; Zhu, D.; Sun, J. Degradation of conventional plastic wastes in the environment: A review on current status of knowledge and future perspectives of disposal. Sci. Total Environ. 2021 , 771 , 144719. [ Google Scholar ] [ CrossRef ]
• Dris, R.; Agarwal, S.; Laforsch, C. Plastics: From a success story to an environmental problem and a global challenge. Glob. Chall. 2020 , 4 , 2000026. [ Google Scholar ] [ CrossRef ]
• Wang, Z.; Huo, J.; Duan, Y. The impact of government incentives and penalties on willingness to recycle plastic waste: An evolutionary game theory perspective. Front. Environ. Sci. Eng. 2020 , 14 , 29. [ Google Scholar ] [ CrossRef ]
• Shin, S.K.; Um, N.; Kim, Y.J.; Cho, N.H.; Jeon, T.W. New policy framework with plastic waste control plan for effective plastic waste management. Sustainability 2020 , 12 , 6049. [ Google Scholar ] [ CrossRef ]
• Ding, Q.; Zhu, H. The Key to Solving Plastic Packaging Wastes: Design for Recycling and Recycling Technology. Polymers 2023 , 15 , 1485. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rajput, S.; Singh, S.P. Industry 4.0 Model for circular economy and cleaner production. J. Clean. Prod. 2020 , 277 , 123853. [ Google Scholar ] [ CrossRef ]
• Kurniawan, T.A.; Oliveira, J.P.; Gamaralalage, P.J.D.; Nagaishi, M. City-to-city level cooperation for generating urban co-benefits: The case of technological cooperation in the waste sector between Surabaya (Indonesia) and Kitakyushu (Japan). J. Clean. Prod. 2013 , 58 , 43–50. [ Google Scholar ] [ CrossRef ]
• Hanson, V.; Ahmadi, L. Mobile applications to reduce food waste within Canada: A review. Can. Geogr./Géographe Can. 2022 , 66 , 402–411. [ Google Scholar ] [ CrossRef ]
• Gu, F.; Zhang, W.; Guo, J.; Hall, P. Exploring “Internet+ Recycling”: Mass balance and life cycle assessment of a waste management system associated with a mobile application. Sci. Total Environ. 2019 , 649 , 172–185. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Statista. Number of Monthly Active WeChat Users from 2nd Quarter 2010 to 2nd Quarter 2017 (in Millions). 2018. Available online: https://www.statista.com/statistics/255778/number-of-active-wechat-messenger-accounts/ (accessed on 15 May 2024).
• Bonino, D.; Alizo, M.T.D.; Pastrone, C.; Spirito, M. WasteApp: Smarter waste recycling for smart citizens. In Proceedings of the 2016 International Multidisciplinary Conference on Computer and Energy Science (SpliTech), Split, Croatia, 13–15 July 2016; pp. 1–6. [ Google Scholar ] [ CrossRef ]
• Ambrosio, L.; Siqueira Paulino, P.L.; Antiquera, J.; Aquino, G.P.; Cesar Vilas Boas, E. EcoWaste: A Smart Waste Platform Enabling Circular Economy. In Proceedings of the 2021 IEEE 19th Student Conference on Research and Development (SCOReD), Kota Kinabalu, Malaysia, 23–25 November 2021; pp. 411–415. [ Google Scholar ] [ CrossRef ]
• Suruliraj, B.; Olagunju, T.; Nkwo, M.S.; Orji, R. Bota: A Personalized Persuasive Mobile App for Sustainable Waste Management. In Proceedings of the International Conference on Persuasive Technology, Aalborg, Denmark, 20–23 April 2020. [ Google Scholar ]
• Nadzir, M.M.; Seowfuddin, N.F.A.S. Reduce, Reuse, Recycle (3Rs) Awareness App: Mobile Learning Application for Supporting Environmental Awareness Initiatives. In Proceedings of the 2019 IEEE Conference on e-Learning, e-Management & e- Services (IC3e), Pulau Pinang, Malaysia, 19–21 November 2019; pp. 31–34. [ Google Scholar ] [ CrossRef ]
• Naskova, J. RecycHongs: Mobile App Co-design. In Proceedings of the 2017 ACM Conference Companion Publication on Designing Interactive Systems (DIS’17 Companion), Edinburgh, UK, 10–14 June 2017; Association for Computing Machinery: New York, NY, USA, 2017; pp. 337–340. [ Google Scholar ] [ CrossRef ]
• Varghese, C.; Pathak, D.; Varde, A.S. SeVa: A Food Donation App for Smart Living. In Proceedings of the 2021 IEEE 11th Annual Computing and Communication Workshop and Conference (CCWC), Virtual, 27–30 January 2021; pp. 0408–0413. [ Google Scholar ] [ CrossRef ]
• Ballaran, P.M.; Corpuz, C.B.A.; Paras, L.A.R.; Fabito, B.S.; Rivera, E.R. Perazuhan: A Mobile Application for Solid Waste Micro-Management Framework, 2019. In Proceedings of the IEEE Student Conference on Research and Development (SCOReD), Bandar Seri Iskandar, Malaysia, 15–17 October 2019; pp. 17–20. [ Google Scholar ] [ CrossRef ]
• Harvey, J.; Smith, A.; Goulding, J.; Branco, I.I. Food Sharing, Redistribution, and Waste Reduction via Mobile Applications: A Social Network Analysis. Ind. Mark. Manag. 2019 , 88 , 437–448. [ Google Scholar ] [ CrossRef ]
• Mastorakis, G.; Kopanakis, I.; Makridis, J.; Chroni, C.; Synani, K.; Lasaridi, K.; Abeliotis, K.; Louloudakis, I.; Daliakopoulos, I.N.; Manios, T. Managing Household Food Waste with the FoodSaveShare Mobile Application. Sustainability 2024 , 16 , 2800. [ Google Scholar ] [ CrossRef ]
• Haas, R.; Aşan, H.; Doğan, O.; Michalek, C.R.; Karaca Akkan, Ö.; Bulut, Z.A. Designing and Implementing the MySusCof App-A Mobile App to Support Food Waste Reduction. Foods 2022 , 11 , 2222. [ Google Scholar ] [ CrossRef ]
• Farr-Wharton, G.; Foth, M.; Choi, J.H. EatChaFood: Challenging technology design to slice food waste production. In Proceedings of the 2013 ACM Conference on Pervasive and Ubiquitous Computing Adjunct Publication (UbiComp’13 Adjunct), Zurich, Switzerland, 8–12 September 2013; Association for Computing Machinery: New York, NY, USA, 2013; pp. 559–562. [ Google Scholar ] [ CrossRef ]
• Frost, S.; Tor, B.; Agrawal, R.; Forbes, A.G. CompostNet: An Image Classifier for Meal Waste. In Proceedings of the 2019 IEEE Global Humanitarian Technology Conference (GHTC), Seattle, WA, USA, 17–20 October 2019; pp. 1–4. [ Google Scholar ] [ CrossRef ]
• Coelho, T.R.; Hino, M.R.M.C.; Vahldick, S.M.O. The use of ICT in the informal recycling sector: The Brazilian case of Relix. Electron. J. Inf. Syst. Dev. Ctries. 2019 , 85 , e12078. [ Google Scholar ] [ CrossRef ]
• More, K.S.; Wolkersdorfer, C. Intelligent Mine Water Management Tools—eMetsi and Machine Learning GUI. Mine Water Environ. 2023 , 42 , 111–120. [ Google Scholar ] [ CrossRef ]
• Hajjdiab, H.; Anzer, A.; Tabaza, H.A.; Ahmed, W. A Food Wastage Reduction Mobile Application. In Proceedings of the 2018 6th International Conference on Future Internet of Things and Cloud Workshops (FiCloudW), Barcelona, Spain, 6–8 August 2018; pp. 152–157. [ Google Scholar ] [ CrossRef ]
• Amadi, E.C.; Chukwudebe, G.; Ayogu, I.; Ikerionwu, C.; Okafor, K.C. Implementation of a Web Application for Stakeholder Inclusion for Sustainable Waste Management. In Proceedings of the 2022 IEEE Nigeria 4th International Conference on Disruptive Technologies for Sustainable Development (NIGERCON), Lagos, Nigeria, 5–7 April 2022; pp. 1–5. [ Google Scholar ] [ CrossRef ]
• Wong, W.T.; Fernando, O.N.N.; Panchapakesan, C.; Jia, J.K.S. Foodscover: Eliminating food waste in the retail sector through technology. In Proceedings of the 2021 International Conference on Cyberworlds (CW), Caen, France, 28–30 September 2021; pp. 85–92. [ Google Scholar ] [ CrossRef ]
• Akmal, M.; Niwanputri, G.S. Spoonful: Mobile Application for Reducing Household Food Waste using Fogg Behavior Model (FBM). In Proceedings of the 2021 International Conference on Data and Software Engineering (ICoDSE), Bandung, Indonesia, 3–4 November 2021; pp. 1–6. [ Google Scholar ] [ CrossRef ]
• Morilla, J.A.R.; Bagsic, F.C.; Dela Cruz, M.K.; Patio, C.D.A.; Yabut, E.R. Foodernity: A Mobile and Web Application for Food Sharing. In Proceedings of the 2021 1st International Conference in Information and Computing Research (iCORE), Manila, Philippines, 11–12 December 2021; pp. 90–95. [ Google Scholar ] [ CrossRef ]
• Yu, Y.; Yi, S.; Nan, X.; Lo, L.Y.; Shigyo, K.; Xie, L.; Wicaksana, J.; Cheng, K.T.; Qu, H. FoodWise: Food Waste Reduction and Behavior Change on Campus with Data Visualization and Gamification. In Proceedings of the 6th ACM SIGCAS/SIGCHI Conference on Computing and Sustainable Societies (COMPASS’23), Cape Town, South Africa, 16–19 August 2023; Association for Computing Machinery: New York, NY, USA, 2023; pp. 76–83. [ Google Scholar ] [ CrossRef ]
• Kanmani, A.; Karthicka Priyadharshni, J.K.; Praharsha, S.; Mano Dharshan, M.P.; Deeraj Kumar, K.K.; Abirami, A.M. Dumpster: Predictive Model to trade Bio-waste from Agricultural Lands. In Proceedings of the 2020 International Conference on Innovative Trends in Information Technology (ICITIIT), Kottayam, India, 13–14 February 2020; pp. 1–6. [ Google Scholar ] [ CrossRef ]
• Manrique, S.; Eulogio, L.; Armas, J. Recycling: A User-Friendly Oriented Mobile and Web Solution for Generators and Recyclers in the City of Lima. In BTSym 2020, Proceedings of the 6th Brazilian Technology Symposium (BTSym’20), Campinas, Brazil, 26–28 October 2020 ; Iano, Y., Saotome, O., Kemper, G., Mendes de Seixas, A.C., Gomes de Oliveira, G., Eds.; Smart Innovation, Systems and Technologies; Springer: Cham, Switzerland, 2021; Volume 233. [ Google Scholar ] [ CrossRef ]

Click here to enlarge figure

Share and Cite

Onur, N.; Alan, H.; Demirel, H.; Köker, A.R. Digitalization and Digital Applications in Waste Recycling: An Integrative Review. Sustainability 2024 , 16 , 7379. https://doi.org/10.3390/su16177379

Onur N, Alan H, Demirel H, Köker AR. Digitalization and Digital Applications in Waste Recycling: An Integrative Review. Sustainability . 2024; 16(17):7379. https://doi.org/10.3390/su16177379

Onur, Neslihan, Hale Alan, Hüsne Demirel, and Ali Rıza Köker. 2024. "Digitalization and Digital Applications in Waste Recycling: An Integrative Review" Sustainability 16, no. 17: 7379. https://doi.org/10.3390/su16177379

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

• Search Menu
• Sign in through your institution
• Chemical Biology and Nucleic Acid Chemistry
• Computational Biology
• Critical Reviews and Perspectives
• Data Resources and Analyses
• Gene Regulation, Chromatin and Epigenetics
• Genome Integrity, Repair and Replication
• Nucleic Acid Enzymes
• RNA and RNA-protein complexes
• Synthetic Biology and Bioengineering
• Molecular and Structural Biology
• Advance Articles
• Breakthrough Articles
• Molecular Biology Database Collection
• Special Collections
• Scope and Criteria for Consideration
• Author Guidelines
• Data Deposition Policy
• Database Issue Guidelines
• Web Server Issue Guidelines
• Submission Site
• About Nucleic Acids Research
• Editors & Editorial Board
• Information of Referees
• Self-Archiving Policy
• Dispatch Dates
• Advertising and Corporate Services
• Journals Career Network
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

Introduction, materials and methods, data availability, supplementary data, acknowledgements.

• < Previous

End resection and telomere healing of DNA double-strand breaks during nematode programmed DNA elimination

• Article contents
• Figures & tables
• Supplementary Data

Brandon Estrem, Richard E Davis, Jianbin Wang, End resection and telomere healing of DNA double-strand breaks during nematode programmed DNA elimination, Nucleic Acids Research , Volume 52, Issue 15, 27 August 2024, Pages 8913–8929, https://doi.org/10.1093/nar/gkae579

• Permissions Icon Permissions

Most DNA double-strand breaks (DSBs) are harmful to genome integrity. However, some forms of DSBs are essential to biological processes, such as meiotic recombination and V(D)J recombination. DSBs are also required for programmed DNA elimination (PDE) in ciliates and nematodes. In nematodes, the DSBs are healed with telomere addition. While telomere addition sites have been well characterized, little is known regarding the DSBs that fragment nematode chromosomes. Here, we used embryos from the human and pig parasitic nematode Ascaris to characterize the DSBs. Using END-seq, we demonstrate that DSBs are introduced before mitosis, followed by extensive end resection. The resection profile is unique for each break site, and the resection generates 3′-overhangs before the addition of neotelomeres. Interestingly, telomere healing occurs much more frequently on retained DSB ends than on eliminated ends. This biased repair of the DSB ends may be due to the sequestration of the eliminated DNA into micronuclei, preventing neotelomere formation at their ends. Additional DNA breaks occur within the eliminated DNA in both Ascaris and Parascaris , ensuring chromosomal breakage and providing a fail-safe mechanism for PDE. Overall, our data indicate that telomere healing of DSBs is specific to the break sites responsible for nematode PDE.

Programmed DNA elimination (PDE) is an exception to the paradigm of genome integrity ( 1–4 ). It removes DNA from the germline genome to generate a reduced somatic genome within the life cycle of an organism. PDE occurs in single-cell ciliates ( 5–7 ) and a growing list of metazoans ( 8–11 ), suggesting that the PDE process likely evolved independently in distinct phylogenetic groups and confers biological function(s). There are significant variations in how PDE occurs among diverse organisms, including the developmental stages where it occurs, the amount and types of eliminated DNA, and the genomic consequences of PDE ( 1–4 ). However, the overall functions of PDE in metazoans remain speculative as an experimental model where PDE is fully blocked has yet to be established.

Two distinct mechanisms are used to eliminate DNA during PDE. In the first, the entire chromosome(s) is lost, typically through heterochromatinization, asymmetric division or lagging chromosomes ( 8 , 9 , 12 ). Loss of entire chromosome(s) occurs in some arthropods, lampreys, hagfish, frogs, birds and mammals. In the second mechanism, chromosomes are broken, and specific fragments are reproducibly retained or lost ( 10 , 13 ). Chromosome fragmentation requires the generation of DNA double-strand breaks (DSBs) and their subsequent healing. PDE-associated DSBs have been identified in ciliates and some nematodes; they are likely also present in some copepods ( 14 , 15 ) and hagfish ( 16 , 17 ).

The generation and healing of DSBs differ between ciliates and nematodes. In most ciliates, two types of genome changes occur that require DSBs. The majority of the DSBs are generated during the excision of thousands of internal eliminated sequences by domesticated transposases, followed by the fusion of broken ends through nonhomologous end joining (NHEJ)-mediated repair ( 5–7 ). The second form of DSBs occurs during chromosome fragmentation at chromosome breakage sequences ( 13 ). This process is coupled with de novo telomere addition using telomerase ( 18 , 19 ). In comparison, much less is known about the molecular mechanism of DSBs in nematodes. The DSBs occur at the ends of all nematode chromosomes ( 20 , 21 ) as well as in the middle of some chromosomes ( 22 ). The DSBs are healed by de novo telomere addition and become the ends of new somatic chromosomes ( 23–26 ). The DSBs in the middle of a chromosome split the chromosome, thus changing their karyotypes ( 22 ). Overall, PDE in nematodes removes and remodels the ends of all germline chromosomes and generates new, additional somatic chromosomes.

In nematodes, telomere addition sites have been characterized using genome sequencing ( 21 , 25 ). In the human and pig parasitic nematode Ascaris ( 27 ), we previously identified 72 chromosomal breakage regions (CBRs) where telomeres are added. These CBRs occupy a 3–6-kb window ( 25 , 28 , 29 ) and are not associated with specific sequence motifs, common histone marks or small RNAs, suggesting that the sites for the telomere addition are sequence independent. However, all CBRs are associated with more accessible chromatin during DNA elimination, indicating that specific mechanisms are involved in identifying the sites for chromosomal breakage and their subsequent telomere addition ( 25 ). In contrast, de novo telomere addition sites in the free-living nematode Oscheius tipulae reside primarily at a discrete site in the center of a 30-nt palindromic motif called SFE (sequence for elimination) ( 21 ). Our initial END-seq analysis indicated the DSBs in O. tipulae were resected to generate long 3′-overhangs, and telomeres were unbiasedly added to both the retained and eliminated ends of the DSBs ( 21 ). However, due to the fast cell cycle (20–30 min/cycle) in O. tipulae , we could not determine the timing of DSBs or the dynamics of DNA end resection and telomere addition. Furthermore, the potential molecular differences of the DSBs, end processing and telomere addition between a motif-based (SFEs in O. tipulae ) and a sequence-independent (CBRs in Ascaris ) process remain largely unknown.

Here, we determine the timing, nature and sequence features associated with the DSBs for Ascaris PDE. Using synchronized embryos, we carried out END-seq to characterize DSBs and end resection at specific stages of the cell cycle during PDE (four- to eight-cell embryos). These stages cover discrete time points of Ascaris PDE, including the onset of DSBs, end resection, new telomere addition and degradation of the eliminated DNA. Our data demonstrate that the DSBs are introduced at the G2 phase before mitosis and are followed by extensive end resection. The DSBs occur heterogeneously within the CBRs. Moreover, telomeres are mainly added to the retained ends of DSBs in Ascaris , while the eliminated ends undergo further resection—in contrast to the unbiased telomere healing observed in O. tipulae ( 21 ). We also identified additional DSBs within the eliminated DNA in Ascaris and the related horse parasitic nematode Parascaris . In combination with the alternative breaks in O. tipulae ( 21 ), these extra DSBs suggest a common fail-safe mechanism, where additional DNA breaks occur to ensure PDE in these nematodes. Furthermore, telomere healing of DSBs appears to be a specific process associated with PDE, as exogenously introduced DSBs are not healed by telomere addition. Overall, our results provide insights into the DSBs and telomere healing and reveal variations in the molecular processes of PDE in diverse nematodes.

Sample collection and embryo development

Ascaris females were collected, and the fertilized embryos (0 h, one-cell before prenuclear fusion) were harvested and processed as previously described ( 30 , 31 ). Ascaris 0-h samples were incubated at 30°C with constant shaking for the desired time (from 50 to 98 h; see Figure 1 for the population average of cell stage and phase of cell cycle). For all molecular experiments, the chitinous eggshells were first digested with base-bleach treatment [0.4 M KOH, 2% sodium hypochlorite (Fisher Scientific, catalog #SS290-1)] for 1.5 h at 30°C. Parascaris samples were collected as described ( 22 , 25 ). Parascaris eggs were prepared similarly to Ascaris , except the incubation was carried out at 37°C, and the embryonation time was shorter (10–14 h). The Parascaris embryos used for the END-seq library were from mixed stages of one to two cells (before PDE) and two to eight cells (during PDE).

Ascaris DSBs for PDE are generated before mitosis. ( A ) END-seq identifies DSBs in Ascaris embryos. A genome browser view of END-seq reads from 70-h (four- to six-cell) embryos. Shown is a 500-kb region containing an FseI restriction site and a CBR. Reads were split by strand and colored red (+) and blue (−). ( B ) Inset of the FseI site boxed in panel (A). FseI generates a 4-nt 3′-overhang that is blunted during END-seq, as indicated by the high number of END-seq reads matching the blunted ends, leaving a 4-nt gap in END-seq signal between the two strands. ( C ) Ascaris cell lineage during early development. Germ cells are purple, cells that undergo PDE are red and somatic cells are blue. ( D ) Timing of DSBs detected by END-seq. Ridgeline plot of normalized END-seq reads across 11 developmental stages ( y -axis) at the same CBR as in panel (A) and its flanking regions ( x -axis; total 14 kb with 100-bp bins and 10-bp sliding window). Dashed lines mark the boundary of END-seq signal enrichment (defined with MACS3). Reads are colored by strand (red and blue), and telomeric reads are gray. Estimates of cell number and phase of the cell cycle from the population of embryos are indicated on the left. ( E ) Average END-seq profile across all CBRs. The 72 CBRs were aligned by the median telomere addition site at each CBR and the END-seq coverage was merged to create an average profile. Legend same as in panel (D). ( F ) A bias of resection in the retained versus eliminated DSB ends. The average END-seq read counts at each CBR were plotted for each developmental stage. The number of END-seq libraries (biological replicates) for each stage is indicated at the top of the graph. Many time points (from 54 to 80 h) have more END-seq reads in the eliminated sides than the retained ends. All time points have significantly more END-seq reads than 50 h (significance only shown between 50 and 54 h). Wilcoxon statistic tests were used with * P  < 0.05, ** P  < 0.01, *** P  < 0.001 and **** P  < 1e−4.

END-seq library preparation

The decoated embryos were treated with 90% isopropanol for 1 min to remove the outer membrane, followed by 3× washes in phosphate-buffered saline (PBS) before proceeding with END-seq procedures ( 32 , 33 ). Briefly, embryos were embedded in agarose plugs to protect the DNA from exogenous breaks. For each plug, we used ∼50 µl of packed embryos as the starting material. Some plugs were treated with the restriction enzymes AsiSI, FseI, AscI and/or PmeI (NEB, catalog #R0630, #R0588, #R0558 and #R0560) to generate DSBs as internal controls. DSBs were blunted with exonuclease VII (NEB, catalog #R0630) and exonuclease T (NEB, catalog #M0625). Blunt ends were A-tailed and capped with END-seq adapter 1, a biotinylated hairpin adapter ( 33 ). Plugs were melted at 70°C and treated with β-Agarase I (NEB, catalog #M0392) to liberate the DNA. The DNA was then sheared to 200–300 bp with a Covaris M220 focused ultrasonicator [130 µl tube (Covaris part number 520045), 4°C, peak power 50, duty 16, cycles/burst 200 for 420 s]. DNA fragments containing END-seq adapter 1 were isolated with Dynabeads MyOne Streptavidin C1 (Invitrogen, catalog #65001). END-seq adapter 2 was ligated to the sheared ends of the A-tailed DNA fragments. The hairpins within the adapters were digested with USER (NEB, catalog #M5505), and the DNA was amplified with Illumina TruSeq primers and barcodes. The libraries were sequenced with Illumina HiSeq 2500 or NovaSeq 6000 at the University of Colorado Anschutz Medical Campus Genomics Core.

The following modifications were made to the END-seq protocol to capture DNA with blunt ends and/or 5′- and 3′-overhangs. For the direct capture method, we excluded the exonuclease VII and exonuclease T treatments to only capture blunt ends. For the all-END protocol, the plugs were treated with T4 polymerase (with dNTPs) to allow the filling of overhangs before exonuclease treatment, thus capturing DNA with blunt ends, 5′-overhangs and 3′-overhangs. These experiments were done on 68-h embryos when endogenous DSBs from PDE are abundant. The samples were also treated with restriction enzymes AsiSI (3′-overhang, 3385 sites in the genome), AscI (5′-overhang, 416 sites) and PmeI (blunt, 5588 sites) to generate control DSBs.

Southern blotting

High-molecular-weight DNA was extracted from the germline (ovary), four stages of early embryos (50–74 h) and somatic cells (7-day embryos) using an agarose embedding method ( 28 ). About 3 μg of DNA from each sample was digested with two restriction enzymes (PstI, NEB catalog #R0140; XhoI, NEB catalog #R0146). The digested genomic DNA was resolved on a 1% 0.5× TBE buffer agarose gel with a 1-kb Plus DNA Ladder (Invitrogen, catalog #12308-011). The DNA was transferred to a Hybond-XL membrane using 0.5 N NaOH/1.5 M NaCl. The membrane was treated with 1200 μJ in a UVP CL-1000 Crosslinker. We selected a 700-bp region within the retained side of a CBR (CBR_m6b; see Figure 3E ) as the probe for hybridization. The polymerase chain reaction (PCR) amplicon (primers: forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α- 32 P] using Random Primer DNA Labeling Kit Ver. 2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer [1% bovine serum albumin, 500 mM sodium phosphate, 15% formamide, 1 mM ethylenediaminetetraacetic acid and 7% sodium dodecyl sulfate (SDS)] and washed in 0.2× SSC and 0.1% SDS at 55 ° C using a GENE Mate HO6000V hybridization oven. The blot was imaged using an Amersham Typhoon Biomolecular Imager. The size and intensity of DNA smears were quantified with WALTER ( 34 ). Regions below the 4.3-kb band were manually selected for quantification.

X-ray irradiation

Ascaris embryos [65 h (four-cell) or 70 h (four- to six-cell) with eggshell removed) were placed in 60-mm Petri dishes and irradiated with 100 or 200 Gy of X-rays in an RS 2000 small animal irradiator (∼4 Gy/min at shelf level 5). Control samples were placed in 60-mm Petri dishes and left on the counter for the same period while the X-ray sample was irradiated. To determine the impact of X-ray irradiation on Ascaris embryo development, we allowed treated embryos to recover for 24 or 48 h at 30°C post-irradiation (corresponding to one to three cell cycles). After recovery, the number of cells in the embryos was counted using light microscopy and Hoechst staining. For the staining, ∼120 µl of packed embryos were treated with 90% isopropanol for 1 min, washed in PBS (pH 7) and subjected to the stain using Hoechst 33342 (1 mg/ml) (Invitrogen, Fisher catalog #H3570) following the procedures as described previously ( 21 ).

For END-seq, the irradiated embryos were embedded in agarose plugs and processed as described above. For genomic DNA isolation, ∼80 µl packed irradiated embryos and control embryos were resuspended in 2 ml buffer G2 (Qiagen, catalog #1014636) with proteinase K (1 mg/ml) (Invitrogen, catalog #AM2544). The embryos were lysed with five strokes in a 7-ml metal dounce followed by a 2 h incubation at 37°C for proteinase K digestion. The lysate was centrifuged at 5000 ×  g for 10 min to pellet debris. The supernatant was processed with Genomic-tip 20/G columns (Qiagen catalog #10223) to prepare genomic DNA. Genomic libraries were made using Illumina DNA Preparation Kit (catalog #20018704) and sequenced with Illumina NovaSeq 6000.

END-seq data mapping and visualization

For all END-seq analyses, only the read 1 file with the captured DSB ends was processed. END-seq reads containing two consecutive telomeric repeat units (TTAGGCTTAGGC or the reverse complement GCCTAAGCCTAA) were first identified from sequencing files using an in-house Perl script; they were filtered and used for the analysis of de novo telomere addition (see below). The rest of the END-seq reads were mapped to the appropriate reference genome [ Ascaris v3 (accession number: JACCHR010000000) or Parascaris v2 (accession number: JBBHLZ010000000)] with bowtie2 (local alignment) ( 35 ) and processed with SAMtools ( 36 ) to generate bam files. For samples treated with restriction digestion, BEDTools ( 37 ) intersect was used to remove reads mapped to restriction sites. The 5′-end position of each read was mapped, separated by strand and normalized to 10 million genome-mapped reads using BEDTools genomecov ( 37 ). The mapping results were converted to bigWig format using bedGraphToBigWig and loaded into UCSC Genome Browser track data hubs ( 38 ).

Identification of de novo telomere addition

To analyze new telomere addition during PDE developmental stages, END-seq reads containing two consecutive telomere repeats were converted to the G-rich strand (TTAGGC). To identify reads that capture de novo telomere addition, we first mapped the full length of these reads (without trimming or clipping) to the germline genome using bowtie2 end-to-end alignment ( 35 ). The reads that fully mapped to the germline genome are false-positive telomeric reads and were removed from the downstream analysis. The rest of the reads were trimmed with fastx_clipper ( http://hannonlab.cshl.edu/fastx_toolkit/index.html ) using ‘-v -n -l 25 -a TTAGGCTTAGGC’ parameters. The trimmed reads were mapped to the genome with bowtie2 (local alignment), and the mapping results (bam files) were processed as described above, except the 3′-positions (the sites where new telomeres are added) rather than 5′-positions were obtained with BEDTools genomecov . To filter ambiguous mapping results, reads with <50 bp of genomic sequence were excluded from the analysis since few of them have >25 bp of unique sequence after removing the telomeric portion of the reads.

Identification of break sites and resection boundaries

To identify genomic regions with enriched END-seq signal, representative libraries from each stage of PDE and a control library (before PDE) were first split by forward (+) and reverse (−) strands. Each strand was independently analyzed with MACS3 ( 39 ) callpeak ( Ascaris : -g 2.43e8 -s 120 --nomodel --broad --min-length 1000; Parascaris: -g 2.40e8 --nomodel --broad --broad-cutoff 0.13). The MACS3 output was filtered to remove peaks only found on one strand (BEDTools window: Ascaris -w 1000 and Parascaris -w 2000). In Parascaris , due to the limited END-seq signal, some CBRs and their resection boundaries were defined manually by further assessing genome read coverage and telomere addition sites using the genome browser.

To identify alternative break sites, MACS3 peaks in the eliminated regions were assessed. Peaks overlapping with highly repetitive regions were removed from downstream analysis. END-seq reads were first mapped to the CBRs to ensure that the reads in the eliminated regions were not derived from the existing 72 CBRs due to their potential of being repetitive sequences to the CBRs; then, the remaining reads were mapped to the rest of the genome using bowtie2. After the sequential mapping, non-CBR regions with a significant number of reads were considered as alternative CBRs. To identify whether alternative CBRs could have repetitive sequences similar to the 72 CBRs after the sequential mapping, the overall coverage of the END-seq was used to determine whether multiple CBRs with expected multiple-fold read coverage exist, as demonstrated by the PDE breaks in the nematode O. tipulae ( 21 ).

The END-seq signal region (defined by MACS3) for each CBR was extended to 20 kb to include a flanking region for comparative analyses of all CBRs across developmental stages. The 20-kb region was binned into 100-bp windows with a sliding window of 10 bp using BEDTools makewindows (-w 100 -s 10). Normalized END-seq data for each stage of development were merged with BEDTools unionbedg and mapped to the binned 20-kb break regions using BEDTools map (-c 4 -o mean -null 0). END-seq de novo telomere data were independently normalized, merged and processed using the same approach. The data were plotted using R using packages tidyverse , reader , scales , ggpubr , ggridges  and extrafont .

For meta-analysis of all CBRs (such as in Figure 1E ), the CBRs were aligned by the median END-seq telomere read. A 20-kb region centered on the telomere median was binned with BEDTools makewindows (-w 100 -s 10). The coordinates were converted to a relative scale from −10 000 to 10 000 bp, and CBRs with eliminated DNA on the left were inverted, so all CBRs were in the same orientation (eliminated DNA on the right). The same process was used to generate the merged Parascaris plot, except the median break site was determined using telomere addition sites from the somatic tissue ( 25 ).

Simulation of END-seq profiles using the O. tipulae resection profile

The overall END-seq resection profile from 12 canonical break sites was obtained from O. tipulae ( 21 ). The 5′ read coordinates were converted to the relative distances from the telomere addition site, normalized to the number of telomeres and oriented so that eliminated reads were on the right-hand side. This pattern was used to simulate an END-seq profile at each Ascaris CBR, assuming that a DSB gives rise to a similar resection profile. The O. tipulae END-seq pattern was applied to the positions and frequencies of the observed telomere addition sites from the wild population of Ascaris embryos. The simulated profiles were compared with observed END-seq profiles in ridgeline plots (see Figure 2F and Supplementary Figure S3 ).

Ascaris DSBs undergo extensive end resection. ( A ) A schematic showing the two modified methods to the standard END-seq procedure. On the left various DNA ends are shown and the right indicates whether the end can be captured (ligated with an orange hairpin adapter). The direct capture (top) excludes exonuclease treatment and only captures blunt ends. The all-END (bottom) includes addition of T4 polymerase to fill in 5′-overhangs as well as exonuclease VII and exonuclease T to blunt 3′-overhangs. This method can capture blunt ends, 3′-overhangs and 5′-overhangs. ( B ) Modifications of the END-seq procedure capture DSBs with different end features. Shown is a genome browser view of END-seq reads from 68-h embryos treated with AsiSI (3′-overhang), AscI (5′-overhang) and PmeI (blunt) restriction enzymes. ( C ) Most of the Ascaris DSB ends have an overhang structure at their ends. Shown is an exemplary CBR region from direct capture and all-END experiments. Libraries were normalized to the same number of mapped reads. ( D ) Quantification of normalized reads in each CBR from direct capture and all-END experiments. ( E ) Each CBR has a distinct resection profile that may be influenced by the local sequence, nucleosome organization and chromatin structure. Three exemplary CBRs (17 kb) with END-seq and ATAC-seq data from early embryogenesis are shown. Same legend as in Figure 1D , except the ATAC-seq from 60-h embryos is shown in green. ( F ) Simulation of END-seq pattern using telomere addition sites. Shown are observed Ascaris END-seq data (top) compared to simulated END-seq profiles (middle) using the END-seq profiles from O. tipulae , a nematode with homogeneous genetic background and homogeneous DSBs. The simulation used the position and frequency of Ascaris telomere addition sites (bottom) (see the ‘Materials and methods’ section). Note the similarity between the observed and simulated END-seq profiles on the retained ends. (G, H) Longer resection occurs in Ascaris compared to O. tipulae . ( G ) Distance between the median resected end from the retained and eliminated sides. The median values for all Ascaris CBRs are plotted. All development times (54–98 h) are statistically significant compared to 50 h (significance is only shown between 50 and 54 h). ( H ) Distance between the median resected end from the retained and eliminated sides of the SFE in O. tipulae . Wilcoxon statistic tests were used with ** P  < 0.01 and **** P  < 1e−4.

Comparative analysis of CBRs between Ascaris and Parascaris

To examine sequence conservation among CBRs within Ascaris or Parascaris , the CBR sequences were compared against each other using blastn (-evalue 0.01) ( 40 ). Two CBRs were considered to have high sequence similarity if >50% of the query CBR in length had a BLASTn hit to the subject CBR. The sequence conservation was also assessed between the CBRs from Ascaris and Parascaris . However, due to diverged sequence between the two species, the comparison was carried out at the level of translated amino acids using tblastx (-evalue 0.01) ( 40 ). Two CBRs were considered to have high sequence similarity if >50% of the query CBR had a tBLASTx hit to the subject CBR in the other organism. Random genomic regions (1000, 8-kb regions generated by BEDTools random -n 1000 -l 8000 -seed 123) were used to assess the overall sequence conservation between Ascaris and Parascaris , using tBLASTx of random region against the other species’ genome.

Genome sequencing and analysis on X-ray irradiated embryos

The same method described for END-seq de novo telomere analysis was used to analyze the telomere addition events in the control versus the irradiated embryos. END-seq reads with two consecutive telomeric repeat units were mapped to the genome. BEDTools map (-c 4 -o sum -null 0) was used to assess the number of reads in the CBRs, eliminated DNA region and retained DNA region. The number of reads was normalized to the size of these genomic regions in kilobases (telomere reads/kb).

PDE-induced DSBs occur before mitosis in Ascaris

Previous genomic analyses in Ascaris somatic cells [comma-stage embryos (7-day), post-PDE] identified sites where new telomeres are added. These sites reside within a 3–6-kb genomic region known as a CBR ( 25 ). However, the telomere addition sites do not necessarily correspond to the sites where the DSBs occurred during PDE, since following DSB induction, the DNA ends could be trimmed (removal of nucleotides at both strands) prior to the addition of telomeres. To identify the sites of the DSBs and their timing during the cell cycle of PDE, we used END-seq ( 32 , 33 ), a method based on the direct ligation of a sequencing adapter to the ends of DSBs after removing single-strand nucleotides, to capture DSBs and their end processing (resection). We first demonstrated that END-seq can identify exogenously introduced DSBs at single-nucleotide resolution using a restriction enzyme (FseI) on Ascaris embryos (Figure 1A and  B ). We observed that the END-seq reads are highly enriched at the junction of retained and eliminated DNA, indicating that END-seq can capture the endogenous DSBs associated with PDE (Figure 1A ).

In Ascaris , five independent PDE events occur in pre-somatic cells during the 4–16-cell stages, with four of them at the 4- or 8-cell stage (Figure 1C ). In the four-cell embryo, two cells (ABa and ABp) simultaneously undergo PDE, followed by PDE in the EMS cell ( 41 ). Notably, Ascaris early embryos have a long cell cycle of ∼15 h ( 42 ), compared to ∼20–30 min in the free-living nematodes Caenorhabditis elegans and O. tipulae . The long cell cycle allowed us to identify and examine DSBs and their resection at 11 time points between 50 and 98 h of embryo development ( Supplementary Table S1 ). This time frame covers discrete phases of the cell cycle during the four- to eight-cell stages ( 42 ) (Figure 1C ). The consistency between the biological replicates of our END-seq suggests that the data are highly reproducible ( Supplementary Figure S1 ). The END-seq data indicated that DSBs for PDE were not detected during the S phase (50 h) of the four-cell embryos. However, a small but significant amount of END-seq reads appear in the CBRs at 54 h (G2 phase), and the END-seq signal increases through 80 h (Figure 1D – F ). The initial detection of END-seq signals suggests that the DSBs occur during the G2 phase of the cell cycle, prior to chromosome condensation and mitosis. DSBs occurring during G2 differ from previous proposed timing of the DSBs during mitosis ( 43 ). Additional DSBs were detected as the four-cell embryos underwent PDE (54–70 h). Since division of the ABa/ABp and EMS cells is not synchronous and the population of embryos is not perfectly synchronized ( 42 ), the END-seq signal was observed throughout the time points after the onset of the initial DSBs (Figure 1D – F ). Overall, the timing of initial DSBs has important implications for the molecular mechanisms of DSBs (see the ‘Discussion’ section).

Ascaris DSBs are heterogeneous and undergo resection

Our END-seq data were derived from a heterogeneous population of millions of Ascaris embryos obtained from wild isolates. We reasoned that if the DSBs were homogeneous and occurred at a single location within a CBR in this population, the END-seq would result in no overlapping reads from the two strands (see Figure 1B ). However, we observed all 72 CBRs have overlapping reads from the two strands (Figure 1D and E and Supplementary Figure S2 ), suggesting that DSBs occur heterogeneously within these overlapping regions in the sampled population. The overlapping regions of the END-seq signal coincide with the telomere addition sites within the CBRs, indicating that telomere healing may occur at the site of the DSB without DNA trimming (see below for additional evidence). Thus, our END-seq data from a wild population of Ascaris embryos indicate that DSBs are heterogeneous, confined within the CBRs and are likely the sites of telomere addition.

Although the DSB sites are heterogeneous in the population, the END-seq reads accumulate across extended regions of the CBRs on both strands and there is a large offset between the majority of retained and eliminated END-seq reads, as indicated in the distance between peaks of retained and eliminated ends (Figure 1D and E), suggesting extensive bidirectional end resection from 5′ to 3′, leaving an extended 3′-overhang. Quantification of the END-seq reads revealed that there is greater resection at the eliminated ends of DSBs, compared to the retained ends, in both the amount of reads and the resection distance (Figure 1D – F and Supplementary Figure S2 ). The resection bias is observed from 54 to 80 h of embryo development. After 80 h, we observe an overall decrease of END-seq signal (Figure 1F ), likely due to the completion of the first three PDE events, in conjunction with the one new PDE event at the eight-cell stage (see Figure 1C ). After 80 h, more but not significant amounts of reads were observed on the eliminated side (Figure 1F ). This more balanced number of reads between the eliminated and retained ends could be due to (i) the overall diminishing of END-seq signal in the eliminated regions from the previous three PDE events and (ii) the early time point of the new PDE event where bias in resection has not accumulated. In sum, our END-seq experiments show that the DSBs occur during the G2 phase of the cell cycle, they occur heterogeneously within the CBRs and the DSBs undergo bidirectional resection.

Ascaris DSB end resection generates 3′-overhangs with site-specific patterns

To further characterize the ends of DSBs associated with PDE, we sought to determine the percentage of Ascaris END-seq reads that are blunt versus those that have an overhang. Given that the standard END-seq procedure can capture DSBs with both blunt ends and 3′-overhangs ( 32 , 33 ), we modified END-seq to capture (i) only blunt ends (direct capture) or (ii) blunt ends, 3′-overhangs and 5′-overhangs (all-END) (Figure 2A – B ). Our direct capture method identified fewer reads in the CBRs compared to the all-END method (Figure 2C – D ); these reads are largely confined within the CBR and they also demonstrate an offset between the retained and eliminated ends (Figure 2C ). Since our standard END-seq (blunt and 3′-overhang) and all-END (blunt, 5′-overhang and 3′-overhang) methods captured an identical profile, and there are much fewer reads from the direct capture (blunt), we conclude that the majority of DSBs have a 3′-overhang. Quantification of the END-seq reads from direct capture and all-END suggests that 79% correspond to resected DSBs with an overhang (Figure 2D ). We note that END-seq may be more efficient at capturing blunt ends than overhangs (Figure 2B ). In addition, the direct capture method also appears to capture a small amount of 3′-overhangs (Figure 2B ). Therefore, the overall percentage of DNA ends at the break sites with a 3′-overhang could be underestimated.

Furthermore, analysis of the resection profiles between individual CBRs reveals notable differences in the frequency of END-seq reads and resection endpoints (Figure 2E and Supplementary Figure S2 ). However, within a specific CBR, the resection profile was highly consistent across all developmental stages (Figure 2E and Supplementary Figure S2 ). The variations in resection profiles among CBRs could be due to the local sequence, nucleosome organization and chromatin structure (see ATAC-seq data in Figure 2E and Supplementary Figure S2 ) that may influence the resection process and endpoints, as illustrated in recent studies ( 44 , 45 ). Notably, the overall resection profile from all CBRs showed two peaks for the retained end (Figure 1E and Supplementary Figure S2 ), suggesting a potential multistep controlled process for the resection at the retained end where telomere addition occurs (see below and the ‘Discussion’ section). Overall, our analysis revealed that most DSBs are resected to generate long 3′-overhangs, and the resection profiles are site-specific.

De novo telomere addition occurs at the DSB site

Our previous END-seq analyses on O. tipulae PDE revealed that DSBs occur at the center of a 30-bp, degenerated palindromic sequence (SFE) and that telomeres are added at the sites of DSBs ( 21 ). We wondered whether telomere addition sites are similarly close to the DSBs in Ascaris . However, the heterogeneity of telomere addition sites from the wild population of Ascaris embryos makes it difficult to directly assess a single breakage event. We thus used a computer simulation to indirectly evaluate the likelihood of telomere addition sites corresponding with DSB sites. In this simulation, we applied the average O. tipulae END-seq resection profile to each observed telomere addition site in Ascaris (considering both the position of the telomere site and its frequency; see the ‘Materials and methods’ section). Interestingly, the simulated END-seq profiles of the retained ends match consistently with the observed Ascaris END-seq data, suggesting that telomere addition sites likely correspond with the DSB sites (Figure 2F and Supplementary Figure S3 ). Our previous data showed that overlapping regions of END-seq signal (where DSBs presumably occur) coincide with the telomere addition sites (Figure 1D and E). In addition, our simulation shows a consistent END-seq profile between O. tipulae and Ascaris on the retained side of DSBs (Figure 2F ). Together, these results suggest that de novo telomere addition occurs at the DSB site in Ascaris .

However, for the eliminated ends of the DSBs, the simulation does not match the observed END-seq profiles (Figure 2F and Supplementary Figure S3 ). Instead, the broken ends underwent much longer resection compared to the simulated profiles. This reflects differences in the resection of eliminated ends between Ascaris and O. tipulae . Due to the heterogeneous nature of the break site, it is difficult to assess the resection length within the Ascaris population. Instead, to compare resection between the two nematode species, we analyzed the distance between the median retained and eliminated ends, as a measure of total bidirectional resection across the population. We found Ascaris has a much longer median distance (majority 1–3 kb) compared to O. tipulae (majority <0.5 kb; see Figure 2G and H). Since the resection profiles on the retained sides appear consistent between Ascaris and O. tipulae (Figure 2F and Supplementary Figure S3 ), this indicates that the length of resection on the retained sides is largely the same between these nematodes. Thus, the observed difference in distance may be caused by the extended resection at Ascaris eliminated ends (Figure 1D – F ). In addition, the heterogeneous nature of DSBs within the Ascaris population contributes to the longer resection distance. Overall, the consistency of resection profiles on the retained ends suggests that the mechanism of end resection is likely conserved between Ascaris and O. tipulae , while longer resection at the eliminated ends indicates an extended processing of DSB ends of the eliminated DNA in Ascaris (see below).

Telomeres are preferentially added to retained DNA ends

In a previous study, the telomere addition sites were defined using genome sequencing on comma-stage (7-day) embryos long after the PDE events ( 25 ). While their positions in the genome were determined for the retained ends, little is known about telomere addition at the eliminated sides since the sequences are absent in the comma-stage embryos. In addition, the timing and speed of telomere addition were also not known during PDE. Using PCR amplification, Jentsch et al. showed that telomeres can be added to both retained and eliminated ends in Ascaris , suggesting that telomere addition may be a nonspecific process ( 46 ). More recently, in O. tipulae , we showed that telomeres are added to both broken ends in an unbiased manner ( 21 ), consistent with a nonspecific telomere healing model. Here, we assessed Ascaris de novo telomere addition at both the retained and eliminated ends by extracting and analyzing telomere-containing reads from our END-seq data (Figure 3A ). Surprisingly, our data showed that telomeres are primarily (overall 89% of their reads) added to the retained ends of DSBs (Figure 3B and Supplementary Table S2 ). Our data are consistent with the previous work in Ascaris ( 46 ) since 11% of telomere addition on the eliminated ends would still allow its detection by PCR. However, this result contrasts with the unbiased telomere addition observed in O. tipulae ( 21 ), suggesting a molecular difference between these nematodes (see the ‘Discussion’ section).

Telomere addition in Ascaris favors the retained ends of DSBs. ( A ) A schematic showing the sequence ends with and without de novo telomeres captured by END-seq. Blunt and resected DSB ends were trimmed and captured with END-seq (circle with X, blue/red for ends without telomeres and purple/orange for ends with new telomeres, not drawn to scale). The horizontal black arrows indicate END-seq reads pointing from 5′ to 3′. For ends without telomeres, the 5′-ends of the reads (first nucleotide captured, asterisk) were used for data analysis. New telomeric sequences (TTAGGC/GCCTAA) n with their length shorter than the length of sequencing read (150 bp) are indicated. The unique (nontelomeric) region of the reads was mapped to the genome, with the first nontelomeric base (5′) designated as the telomere addition site (asterisk). ( B ) Majority of the telomere addition occurs at the retained ends. A genome browser view of the two types of END-seq reads [split by strand into four tracks; see panel (A)] captured by END-seq at a CBR. ( C ) Biased telomere addition is consistent across all CBRs and developmental stages. Average END-seq telomere signal in each CBR across development. At each time point, there are significantly more telomere reads from the retained side of the DSB. All time points also have significantly more retained and eliminated reads than 50 h (significance only shown between 50 and 54 h). Wilcoxon test: *P < 0.05 and ****P < 1e−4. ( D ) The number of telomere-only END-seq reads plotted across development. For panels (C) and (D), the number of biological replicates is indicated at the top of the graphs. ( E ) A schematic of the Southern blotting. On the left is a CBR from chromosome 6 (CBR_m6b), with the restriction sites and region for the probe. Blue = retained DNA; gray = CBR; red = eliminated DNA; green = new telomere; vertical lines = PstI sites; and orange horizontal bar = 700-bp probe region. On the right is the predicted size of the DNA in the sampled tissues or developmental stages. ( F ) Southern blot showing the intact germline DNA (4.3 kb) and the various sizes of DNA in different embryonic stages. The * symbol indicates the average size of somatic DNA hybridized to the probe as calculated with WALTER (see the ‘Materials and methods’ section). Note the gradual increase of the somatic DNA size with development.

We further assessed de novo telomere addition across development to determine its timing and extension through PDE. Overall, the ratio of telomeric to nontelomeric END-seq within the CBRs suggests that most (97%) of the DSBs are not readily healed with telomeres, likely an indication of active processing (resection). For the other 3% that are telomeric reads, we found a striking similarity of the profile of change through development (Figure 3C ) compared to the nontelomeric reads (see Figure 1F ), suggesting that a small portion of telomere addition may happen with little or no lag time after formation of DSBs. Importantly, END-seq can only map added telomeres to a unique site when the telomere length is shorter than the sequencing reads (150 bp in our Illumina sequencing). To account for all telomeres, we quantified the number of END-seq reads that contained two or more consecutive telomeric repeat units (Figure 3D and see the ‘Materials and methods’ section). These telomeric reads rise steadily from 50 to 75 h, likely due to the growth of new telomere ends that are >150 bp. Interestingly, we found a dramatic rise in these telomeric reads during the 75–98 h time points. The number of telomeric reads is much higher than expected if we only consider that the increase is caused by karyotype changes that occur during PDE (increase from 24 germline chromosomes to 36 somatic chromosomes). We interpret this increase in telomeric reads as the result of the fragmentation of old germline telomeric sequences during their degradation, leaving numerous small telomere fragments captured by END-seq. In agreement with this, analysis of these telomeric reads in 75–98 h indicates that the majority (59%) of them are telomere-only reads. Overall, these data show the timing of germline telomere breakdown and somatic telomere synthesis during PDE.

To further corroborate the timing of telomere addition, we performed Southern blotting using a probe targeted to a single CBR (Figure 3E ). This allows us to determine changes to the DNA at the CBR in the germline, during early embryos through PDE stages and in somatic cells. The result confirms that the CBR is intact (4.3-kb DNA band) in the germline (ovary), while almost all DNA at this CBR was broken in the somatic cells (7-day embryos, ∼500 somatic cells with two primordial germ cells) (Figure 3F ). The smear observed in the somatic cells (7-day) indicates a heterogeneous length, likely caused by the different DSB sites and variations in the length of newly added telomeres (Figure 3E ). During PDE (66 h), we observed in addition to the 4.3-kb germline DNA, a smear of DNA with peak density at 1–4 kb, suggesting a broken CBR with heterogeneous break sites (and telomere lengths) in the population of embryos (Figure 3F ). We quantified the amount and the average length of the DNA smear (excluding the 4.3-kb band; see the ‘Materials and methods’ section). Our data indicate a shift of the smear toward larger DNA in 74 h, reflecting an increase in telomere length (Figure 3F ). In sum, our de novo telomere addition analysis provides insights into the timing, selection and dynamics of telomere addition during Ascaris PDE.

Alternative break sites provide a fail-safe mechanism for PDE in Ascaris

Previous genomic studies revealed 72 Ascaris CBRs (canonical CBRs)—defined by their genomic positions at the junction of retained and eliminated DNA, where new telomeric sequences are detected in somatic cells ( 20 , 25 ). However, these studies did not determine whether DSBs and telomere addition also occur within the eliminated regions or how the eliminated DNA is degraded. Here, we identified 28 additional break regions in the eliminated DNA, hereafter called alternative CBRs (see Figure 4A and  B , Supplementary Figure S2  and Supplementary Table S2 ). These alternative CBRs appear to occur simultaneously with the 72 canonical CBRs (based on a similar number of END-seq reads), undergo bidirectional resection and are healed with de novo telomere addition at a low level, similar to eliminated ends of the CBRs (Figure 3B and Supplementary Figure S2 ). These alternative CBRs could serve as a fail-safe mechanism to ensure that PDE occurs, as seen in O. tipulae ( 21 ). Since the assembled Ascaris genome is not telomere to telomere, sequences in the eliminated regions are incomplete and some regions contain highly repetitive elements ( 20 ). Therefore, we reason that additional alternative CBRs may exist but were missed in our analysis. Interestingly, many of the alternative CBRs were found in internally eliminated sequences (19 of 28, 68%), which consist of only 42% of all eliminated DNA. These DNA sequences are between evolutionarily fused chromosomes (Figure 4B ) and may suggest a critical role of PDE in breaking the chromosomes to restore their pre-fused karyotypes ( 22 ). We further compared the conservation of sequence between all CBRs to determine their relationships and evolution. One large and two small groups of CBRs showed high sequence similarity (Figure 4B and Supplementary Table S3 ), suggesting that these Ascaris CBRs have been recently duplicated, similar to the alternative break sites observed in O. tipulae ( 21 ). Interestingly, we observed a high number of canonical-to-canonical and alternative-to-alternative pairs but a low number of canonical-to-alternative pairs (Figure 4C and Supplementary Table S3 ), suggesting some constraints on the interchangeability of the canonical and alternative sites. Nevertheless, the presence of alternative CBRs as a potential fail-safe mechanism for PDE further suggests the biological importance of PDE in Ascaris .

Alternative CBRs in Ascaris suggest a fail-safe mechanism for PDE. ( A ) END-seq reveals alternative CBRs in the eliminated regions. A genome browser view of a canonical CBR and two alternative CBRs within the eliminated DNA. ( B ) Distribution of canonical CBRs and alternative CBRs in the Ascaris genome. A schematic showing the position of all Ascaris CBRs. The region shown in panel (A) is indicated with a black box. To emphasize the eliminated DNA, most sequences of a chromosome are represented by a thin, pale blue line not plotted to scale. Eliminated DNA (red) and 60-kb flanking retained DNA (blue) are plotted as thick lines and drawn to scale. Asterisks mark clusters of CBRs (three or more CBRs) that have >50% nucleotide sequence identity. ( C ) A summary table of nucleotide sequence identity among CBRs.

Telomere addition is specifically linked to PDE-induced DSBs

Our data indicate that all retained PDE-induced DSB ends are healed with telomere addition ( 25 ). We wondered whether this healing is specifically linked to PDE or occurs universally in all DSBs generated during the PDE stages. We irradiated Ascaris early embryos undergoing PDE with 100–200 Gy of X-ray irradiation to introduce exogenous DSBs, followed by END-seq and genome sequencing to evaluate telomere addition across the genome. Irradiated embryos showed a significant developmental delay after 24 and 48 h post-irradiation (Figure 5A and Supplementary Table S4 ). While direct detection of exogenous DSBs in these Ascaris embryos was difficult, the observed developmental delays (Figure 5 ) suggest an impact from the X-ray treatment ( 47 ). However, the embryos were able to recover, continue to develop and progress through cell cycles as we observed an increased number of cells between irradiation and 48 h of recovery. If X-ray-introduced DSBs are also healed with telomere addition, we would expect to see an increase in telomere-containing reads across the genome. Our END-seq data on control embryos showed that telomere addition occurs mostly within the CBR regions, and very few telomere reads were found in the eliminated regions and almost none in retained regions (Figure 5B ). This END-seq result is consistent with the genome sequencing data and suggests that our method can capture telomere addition across the genome. However, our END-seq on irradiated embryos revealed no significant increase in telomere addition within the retained or eliminated genome regions (Figure 5B ). Future experiments on the impact of the X-ray, including the sites and amounts of DSB and how they may be repaired, are needed. Nevertheless, these data suggest that PDE-induced DSBs are specifically marked for telomere addition. Together with the biased telomere addition predominantly on the retained end of the DSB, our data suggest a mechanism that actively recruits telomerase only at the future new chromosome ends but not at other DSB breaks.

Telomere addition is specific to PDE-induced DSBs. ( A ) X-ray-treated embryos (four-cell, 65 h) show delays in their development. Number of cells in each embryo compared between irradiated (100 Gy X-ray) and control cells. Embryos were allowed to recover for 24 or 48 h before cells were counted. Note that the y -axis is scaled differently between the 24- and 48-h panels. ( B ) Telomere addition was not detected in non-CBR genomic regions in X-ray-treated embryos (four- to six-cell, 70 h). Number of END-seq telomeres/kb found in each genome region from control and irradiated cells. T -test: ** P  < 0.01 and **** P  < 1e−4.

End resection and telomere addition are conserved in the horse parasite Parascaris

A closely related parasitic nematode from the horse, Parascaris univalens , also undergoes PDE ( 41 ). We performed END-seq in Parascaris early embryos and compared it to Ascaris . Overall, our Parascaris data showed a close resemblance to observations in Ascaris . Parascaris DSBs undergo extensive bidirectional resection, with the eliminated ends undergoing longer resection than retained ends, as well as a biased telomere addition toward retained ends (Figure 6A ). Furthermore, 27 alternative CBRs (6 in unplaced contigs) were identified. To investigate the divergence of the CBR sequences and their potential rearrangements within the chromosomes, we compared the CBR sequences and their positions in Ascaris and Parascaris genomes. Interestingly, only about half (34/72, 47%) of the canonical CBRs have sequence similarity among CBRs between the two species, and ∼68% of the CBRs have a match across the entire genome of the other species (Figure 6B and C and Supplementary Table S3 ), while in comparison, ∼93% of the randomly selected genomic regions can be matched between Ascaris and Parascaris across the genome (see the ‘Materials and methods’ section and Supplementary Table S3 ). This suggests that the CBR sequences are fast-evolving regions of the genome. Interestingly, one CBR in Parascaris appears to have diverged into seven CBRs in Ascaris since the split of these species. Notably, the alternative CBRs appear to be the least conserved CBRs between the species, supporting a model that the eliminated DNA is more flexible and may be undergoing rapid evolution ( 1 , 48 , 49 ). In sum, while the closely related Ascaris and Parascaris share many PDE features, there are notable variations in the sequences of the CBRs and their positions in the chromosomes, suggesting flexibility in the genomic location and the amount of sequence eliminated in nematode PDE.

End resection and telomere addition in Parascaris . ( A ) End resection profiles and telomere addition are similar in Ascaris and Parascaris . The average END-seq profile (100-bp bins, 10-bp sliding window, 20 kb). All 72 Parascaris CBRs were aligned by the median somatic telomere addition site. Asterisks mark background END-seq signal from repetitive sequences. ( B ) Conservation of CBRs between Ascaris and Parascaris . A circos plot showing sequence similarity between Ascaris and Parascaris break sites. The outer circle is colored by eliminated (red) and retained (blue) DNA. Inside, for the next two tracks, purple lines indicate canonical CBRs and orange lines indicate alternative sites. Links connect CBRs with >50% sequence identity (defined by tBLASTx), with purple links connecting canonical CBRs, orange links connecting alternative sites and green links connecting canonical CBRs and alternative CBRs. ( C ) A summary table of sequence identity among CBRs with tBLASTx.

Most unscheduled DSBs are harmful because failure to repair these DSBs compromises the integrity of the genome. However, controlled formation of DSBs is integral in some biological processes, such as the V(D)J recombination in immune cells ( 50 , 51 ) and homologous recombination (HR) during meiosis ( 52 ). Controlled DSB formation is also necessary in some organisms undergoing PDE, where chromosomes are fragmented and DNA sequences are lost ( 1–4 ). In nematode PDE, little is known about how the break sites are recognized, what processes or proteins are involved in making the DSBs and how the broken ends are processed ( 10 ). Here, we used END-seq on staged embryos and carried out in-depth analyses of DSBs during Ascaris PDE. We propose a model (Figure 7 ) to describe the Ascaris DSBs for PDE, their end processing and telomere addition, and how these processes may differ from PDE in the free-living nematode O. tipulae .

DSB, end resection and telomere healing during nematode PDE. Left (overview): A model of PDE at the chromosomal level, not drawn to scale. Blue, red and green rectangles represent retained, eliminated and telomeric DNA, respectively. Ovals with a blue outline are nuclei and ovals with a red outline are micronuclei. For Ascaris and Parascaris (upper left), DSBs occur within a 3–6-kb CBR (gray box) and remove a total of 55 Mb ( Ascaris , 18%) and 2.2 Gb ( Parascaris , 90%) of DNA from the genome. Some eliminated regions also contain alternative CBRs. Retained DNA is healed with de novo telomere addition, while eliminated DNA is not. The retained DNA is selectively segregated to the nuclei. In contrast, eliminated DNA is encapsulated in micronuclei where they are further resected and eventually degraded. For O. tipulae (bottom left), DSBs form at the center of a 30-bp SFE motif (boxed consensus sequence; vertical black line marks SFE position) and remove a total of 350 kb (0.6%) of the genome. Some eliminated regions contain alternative SFEs that act as a fail-safe mechanism. After DNA break formation, both retained and eliminated sequences are healed with de novo telomere addition. Right (a single break): A model of PDE at one break site, not drawn to scale. The scissors represent a presumptive nuclease that generates a DSB, and the Pac-man represents exonucleases involved in end resection. Micronuclei are shown as red ovals. New telomeres are represented in green. For Ascaris and Parascaris (upper right), a DSB is generated at a single spot within the CBR and undergoes bidirectional resection, generating a long 3′-overhang. The retained end of the break (left, blue region) is healed with de novo telomere addition, while the eliminated end of the break (right, red region) is encapsulated in a micronucleus and continues to undergo resection. Telomeres are added directly to the site of the retained DNA break. Ascaris uses 1-nt priming where any nucleotide can prime telomere addition. For O. tipulae (bottom right), a DSB is generated within the SFE and undergoes bidirectional end resection, generating a long 3′-overhang. Both retained and eliminated ends are healed with de novo telomere addition. Telomeres are added directly to both sides of the DNA break, likely using the conserved GGC for telomerase priming. Figure created with BioRender.com.

Timing of DSBs

Our data suggest that the initial DSBs occur during the G2 phase of the cell cycle (Figure 1 ). This indicates that the chromosomes are broken before the onset of mitosis. Since the population of Ascaris embryos is not perfectly synchronized ( 42 ), we cannot rule out the possibility that some of the earliest detected END-seq signals could be derived from cells undergoing mitosis. However, this would require a significant portion of embryos to develop much faster (10–15 h) than the normal developmental program—an unlikely scenario based on the previous cell cycle analysis ( 42 ) and our staging and DNA staining analyses of early embryos ( 27 ). Furthermore, we previously showed that Ascaris chromosomes are holocentric, and before and during the mitosis for PDE division, the to-be-eliminated DNA is devoid of centromeres ( 53 ). Electron microscopy (EM) showed that during an Ascaris PDE mitosis, fragments of chromosomes that will be eliminated do not align at the metaphase plate and they lack kinetochores and microtubules ( 20 ), supporting our END-seq data that the chromosomes were already broken before metaphase. The DSBs likely occur while the chromosomes are decondensed, and the CBRs are accessible to machinery that may generate, process and/or repair the DSBs. This is consistent with our ATAC-seq data that the chromatin at the CBRs is more open during and after PDE ( 25 ). Potential mechanisms that lead to the DNA breaks may include the formation of R-loops ( 54–56 ) and interactions of CBRs at the 3D genome level ( 57–59 ). These mechanisms are not dependent on the presence of a sequence motif, in agreement with the heterogeneous and sequence-independent DSBs and telomere addition sites observed in Ascaris ( 20 , 25 ).

DSBs, end resection and telomere addition

The heterogeneous telomere addition sites observed within a CBR in the Ascaris embryo population could each be derived from a single DSB site that is trimmed to variable lengths before the addition of new telomeres. However, several lines of evidence indicate that trimming is unlikely. First, trimming from a single break site would leave a gap between the two broken ends, resulting in a lack of END-seq signal surrounding the break site. We did not identify any gap in the END-seq signal within the CBR. Second, we reason that the sites identified by END-seq direct capture (blunt ends) have not undergone resection and could be the sites where the DSBs originated. These sites coincide with the telomere addition sites (CBR regions) (Figure 2C ), suggesting that no trimming is needed before telomere healing. In addition, we observed consistency between the retained side of our END-seq data and the simulation profile (Figure 2F ) from O. tipulae in which the sites of de novo telomere addition are the sites of DSBs ( 21 ). Together, these data suggest that the DSB is not trimmed but undergoes 5′ to 3′ resection, leaving an extended 3′-overhang with its terminus ending at the initial DSB where the new telomere is primed and added (Figure 7 ). We suggest that the 3′-overhang structure provides a readily accessible substrate that facilitates de novo telomere healing via telomerase ( 60 , 61 ), and the resected nucleotides will be filled with lagging-strand synthesis and telomere C-strand fill-in likely through CST–polymerase α-primase ( 62 , 63 ). In yeast and human, extensive 5′ to 3′ resection activates Mec1/ATR-dependent signaling, which blocks telomerase from converting DSBs into neotelomeres ( 64 , 65 ). It is plausible that in nematodes, the end resection of PDE DSBs may be repressed when the telomere maintenance machinery (telomerase and CST–Polα/Primase) acts on the DNA substrate.

A small number of reads were identified through our direct capture method that captures blunt ends (Figure 2C ). These reads could be derived from the initial DSBs that have not undergone end resection. If so, we would expect the reads from both strands to match at every position. However, we observed an offset of the END-seq signals between the retained and eliminated ends (Figure 2C ). This offset profile could arise from secondary, coincident, DSBs that create short DNA fragments that might be lost during the END-seq preparation, thus generating the observed offset. This model is consistent with the action of the programmed DSBs induced by Spo11 during meiosis, where concerted cuts generate gaps at the sites of topological stress ( 66–68 ). This model also has a similarity to the V(D)J recombination where closely spaced coincident DSBs have been detected ( 69 ). An alternative explanation for these nonoverlapping signals is that the reads captured may not be blunt ends but are nevertheless captured by this method, as seen in the control AsiSI restriction site (3′-overhang) where a small number of reads are detected (Figure 2B ). It is also possible that these captured ends are not from the initial DSB ends, but rather DSB ends that have undergone various processing that resulted in an end structure that was captured. Regardless, these captured ends are largely confined to the CBR where telomere addition occurs. Future experiments are needed to further characterize the subpopulations of the break ends, their origins and processing, and how they may contribute to de novo telomere healing.

Our data suggest that there is more resection to the eliminated end than the retained end of the DSBs. One possible explanation for this resection bias could be that the eliminated DNA ends are accessible longer than the retained ends for resection (and thus END-seq detection). In that case, however, we would expect that resection increases over time, with earlier time points showing smaller END-seq tails and later time points showing longer ones. Our END-seq data show a slight sign of increases in resection distance over time (Figure 1D and E), but the overall pattern of resection remains stable, suggesting that resection occurs rapidly after the DSB. An alternative explanation for the observed asymmetric resection could be the existence of a mechanism that specifically limits resection on the retained end. Intriguingly, the resection pattern for the retained end appears to have two main peaks (Figure 1E ), suggesting a potential mechanism of resection control, reminiscent of the multistep process during the formation of the 3′-overhang at natural telomeres ( 70 ). In addition, the resection profiles appear to reflect the positions and frequencies of telomere addition (Figure 2F ), and each profile is likely further sculpted by the local sequence and chromatin features ( 44 , 45 ). Notably, while the resection on the retained end seems contained to open chromatin (Figure 2E and Supplementary Figure S2 ), the resection is more pervasive at the eliminated end, further suggesting a difference in the resection control at the retained and eliminated ends.

The broken chromosome fragments would need to be protected until the telomere healing occurs. Our END-seq data suggested that only a small percentage (3%) of the captured ends within CBRs have telomeres, suggesting that most of the DSBs are undergoing end resection during the initial stage of PDE. We speculate that the resection machinery may be tightly linked to the DSB break generation. This association could be achieved through specific foci or condensates organized within the nuclei where enzymes for the breaks, end processing and repair could be concentrated. This is consistent with our preliminary observation that CBRs are interacting with each other at the 3D genome level during the time of PDE (Simmons and Wang, personal communication). We reason that the resected ends would prevent the NHEJ DNA repair pathway from acting on the ends since resection of DSBs is thought to inhibit NHEJ ( 71 ). In contrast, the long resected end would be suitable for HR-mediated repair ( 72 ). However, all our data show no sign of recombination or genome rearrangement during PDE, illustrating that the broken DNA ends are consistently healed by telomere addition ( 20 , 25 , 26 ). This suggests that the HR pathway is not active, unavailable or outcompeted by the telomere maintenance pathway (Figure 7 ). Future studies are warranted to elucidate mechanisms of the choice of DNA repair pathways for the DSBs during PDE.

Biased telomere addition and micronuclei

To our surprise, even though end resection happens bidirectionally to both the retained and eliminated ends, 89% of the telomere addition events occur only to the retained ends of the DSBs (Figure 3 ). This may indicate that the eliminated ends are not available or accessible to the telomerase. Our previous EM data showed that the DNA fragments to be eliminated were engulfed into micronuclei ( 20 ). The rapid sequestration of eliminated fragments into micronuclei and the time required for telomere addition to occur may restrict the addition of telomeres to the eliminated DNA, leading to biased telomere addition only at retained ends. The micronuclei may not contain telomerase and thus telomeres are not added. A few telomere addition events to the eliminated sides likely happened before the DNA fragments were engulfed into the micronuclei, allowing them to be detected by PCR in a previous study ( 46 ) and END-seq in this work.

In contrast, we observed in O. tipulae that both the retained and eliminated sides have the same amount of telomere addition ( 21 ). The differences in the telomere addition to the eliminated ends may be due to the sequestration of the DNA into micronuclei in Ascaris and the loss of only small amounts of DNA in O. tipulae (Figure 7 ).  O. tipulae has a 60-Mb genome and eliminates only ∼0.6% (350 kb) of the DNA ( 21 , 73 ), while Ascaris has a genome of 308 Mb, and it removes 18% (55 Mb) of its genomic sequences ( 20 ). The eliminated DNA will be in the cytoplasm after the completion of mitosis. Cytoplasmic DNA can trigger a variety of cellular responses that can be deleterious to the cells ( 74–76 ). Thus, it may be critical to sequester, mask or rapidly degrade the cytoplasmic DNA. The eliminated sequences in Ascaris persist for two to three cell cycles (∼50–60 h) after PDE mitosis and are readily visible using DAPI staining ( 2 , 20 , 77 ). In contrast, the DNA in O. tipulae is not detectable using DAPI or Hoechst staining ( 21 ) and only takes 1–2 h to degrade. Given the small amount of eliminated DNA and its short existence, O. tipulae may not need to sequester the eliminated DNA into micronuclei to prevent adverse effects (Figure 7 ). Consistent with this model, Parascaris eliminates a large amount of DNA (2.2 Gb, 90% of the germline genome) and our END-seq data showed a biased telomere addition (Figure 6 ), suggesting that the eliminated DNA may also go into micronuclei. Further studies in additional nematodes with PDE may reveal the relationship between cell cycle length, the amount of eliminated DNA, the time of its degradation and their association with the formation of micronuclei and their impact on selective telomere addition to the retained versus eliminated DNA.

Comparison of DSBs and telomere addition among PDE species

Ascaris and O. tipulae appear to use the same DNA 3′-overhang, telomeric sequence (TTAGGC) and mechanism of telomere addition (Figure 7 ). Both nematodes use extensive end resection to generate 3′-overhangs, and new telomeres are added to the DSB sites without trimming. The major difference in PDE between these nematodes, however, lies in the identification of DSB sites. In O. tipulae , a conserved motif (SFE) is required for the break ( 21 ), while in Ascaris , the DSBs are not associated with a specific sequence and can occur at any position within the CBR. This difference suggests divergent mechanisms for the recognition of the DSB sites and/or the generation of the breaks. In O. tipulae , it is plausible that a DNA binding protein(s) may recognize the palindromic SFE motif, while in Ascaris , mechanisms independent of the sequences would be required to identify the CBRs.

This difference between the motif-based and the sequence-independent mechanisms may also be associated with the variations in the sequence requirement in these nematodes for telomere addition (Figure 7 ). In O. tipulae , the GGC sequences flanking the break are conserved across all SFE sites ( 21 ). This GGC matches the telomeric sequence TTA GGC and appears necessary for priming during telomere synthesis (Srinivasan and Wang personal communication). It is plausible that since O. tipulae requires this critical GGC for telomere healing, it could put evolutionary constraints on maintaining this sequence across all break sites. The constraint of this specific sequence may have co-evolved additional sequences surrounding the breaks, thus enhancing and eventually fixing the use of the SFE motif. In contrast, sequence analysis showed that a single nucleotide of homology is sufficient for telomere addition in vivo in Ascaris ( 25 ). Since the Ascaris telomeric repeat, TTAGGC, contains all four bases, this allows the telomere to be added at any site within the CBRs; thus, there may be little or no evolutionary pressure to maintain any specific sequence for Ascaris telomere addition (Figure 7 ). It would be interesting to carry out comparative analyses of PDE in more nematodes to further determine whether the requirement for sequencing priming during telomere addition is connected to the usage of motif sequences for PDE breaks.

The motif-based ( Oscheius ) and the sequence-independent ( Ascaris / Parascaris ) DSBs in nematodes are reminiscent of PDE in ciliates, where in some species ( Tetrahymena and Euplotes ), specific motifs are used to generate the DSBs ( 78–80 ), while in others ( Paramecium ) the break sites appear to be sequence-independent ( 13 , 81 ). Interestingly, in Tetrahymena , the initial DSB ends are trimmed by a variable distance of 4–30 bp, leading to heterogeneity in the telomere addition sites despite using a motif-based mechanism ( 82 ). This differs from the telomere addition in O. tipulae , where telomeres are added directly to the break site ( 21 ). In contrast, in Paramecium , microheterogeneity (500–800 bp) and macroheterogeneity (several kb) are observed for telomere addition ( 13 ), similar to the canonical CBRs and alternative CBRs observed in Ascaris and Parascaris . In ciliates, telomerase is responsible for telomere addition ( 13 ). We identified a single telomerase gene in Ascaris and O. tipulae , and its expression is elevated in both species during PDE ( 21 , 25 , 26 , 31 ), suggesting that the telomerase is likely responsible for telomere addition during PDE. Overall, PDE in nematodes requires identification of the sites for DNA breaks, generation of the DSBs, and processing and repair of the broken DNA ends. However, the molecular features and the machinery involved in these processes appear to differ among diverse species, suggesting independent origins and evolution of these mechanisms.

DSBs are harmful to the genome. They are mainly repaired by NHEJ and HR ( 83–85 ). An alternative repair pathway is neotelomere addition, a mechanism not often used under physiological conditions, but observed in cancer and other diseases ( 64 , 86 , 87 ). However, in ciliates and some nematodes that undergo PDE, telomere healing of DSBs is developmentally programmed, highly reproducible and carefully regulated. Despite being known for over 130 years, little was known previously about the molecular details of PDE in these parasitic nematodes, including the DSBs and neotelomere formation processes. Our study provides insights into the timing of the DSBs, the dynamics of end resection and the biases of telomere healing. The differential healing of retained versus eliminated ends highlights a potential role of the micronuclei in confining the eliminated DNA. Our comparison also provides insights into the telomere priming and the sequence requirement for PDE. Future studies on nematode PDE may provide new insights into DSB generation, end processing and telomere healing that could shed light on how most eukaryotic cells normally prevent telomere healing of DSBs.

The END-seq data are available at NCBI GEO with accession number GSE260958. The genome sequencing data for X-ray irradiated Ascaris embryos are available at NCBI SRA with accession number PRJNA1084733. The data are also available in UCSC Genome Browser track data hubs that can be accessed with the following link: https://genome.ucsc.edu/s/jianbinwang/ascaris_end_seq .

Supplementary Data are available at NAR Online.

We thank Bruce Bamber, Jeff Myers and Routh Packing Co. for their support and hospitality in collecting Ascaris material; Martin Nielsen for the Parascaris material; Ryan Simmons for characterizing the X-ray irradiated embryos; and the University of Colorado Anschutz Medical Campus Genomics Core for sequencing services. We also thank Tom Dockendorff, Rachel Patton McCord and Albrecht von Arnim for their comments and critical reading of the manuscript. We acknowledge the reviewers for their helpful comments and suggestions.

Author contributions : B.E. and J.W. conceived the study. B.E., R.E.D. and J.W. carried out the investigation. B.E. and J.W. performed formal analysis. B.E. wrote the initial draft. B.E. and J.W. wrote the manuscript. R.E.D. and J.W. reviewed and edited the manuscript. J.W. provided supervision, project administration and funding.

National Institutes of Health [AI155588 and GM151551 to J.W., AI114054 to R.E.D.]; University of Tennessee, Knoxville [start-up funds to J.W.]. Funding for open access charge: grant funding and university support.

Conflict of interest statement . None declared.

Zagoskin M.V. , Wang J. Programmed DNA elimination: silencing genes and repetitive sequences in somatic cells . Biochem. Soc. Trans. 2021 ; 49 : 1891 – 1903 .

Google Scholar

Wang J. , Davis R.E. Programmed DNA elimination in multicellular organisms . Curr. Opin. Genet. Dev. 2014 ; 27 : 26 – 34 .

Dedukh D. , Krasikova A. Delete and survive: strategies of programmed genetic material elimination in eukaryotes . Biol. Rev. Camb. Philos. Soc. 2022 ; 97 : 195 – 216 .

Drotos K.H.I. , Zagoskin M.V. , Kess T. , Gregory T.R. , Wyngaard G.A. Throwing away DNA: programmed downsizing in somatic nuclei . Trends Genet. 2022 ; 38 : 483 – 500 .

Rzeszutek I. , Maurer-Alcala X.X. , Nowacki M. Programmed genome rearrangements in ciliates . Cell. Mol. Life Sci. 2020 ; 77 : 4615 – 4629 .

Bracht J.R. , Fang W. , Goldman A.D. , Dolzhenko E. , Stein E.M. , Landweber L.F. Genomes on the edge: programmed genome instability in ciliates . Cell . 2013 ; 152 : 406 – 416 .

Chalker D.L. , Yao M.C. DNA elimination in ciliates: transposon domestication and genome surveillance . Annu. Rev. Genet. 2011 ; 45 : 227 – 246 .

Herbette M. , Ross L. Paternal genome elimination: patterns and mechanisms of drive and silencing . Curr. Opin. Genet. Dev. 2023 ; 81 : 102065 .

Vontzou N. , Pei Y. , Mueller J.C. , Reifova R. , Ruiz-Ruano F.J. , Schlebusch S.A. , Suh A. Songbird germline-restricted chromosome as a potential arena of genetic conflicts . Curr. Opin. Genet. Dev. 2023 ; 83 : 102113 .

Estrem B. , Wang J. Programmed DNA elimination in the parasitic nematode Ascaris . PLoS Pathog. 2023 ; 19 : e1011087 .

Smith J.J. , Timoshevskiy V.A. , Saraceno C. Programmed DNA elimination in vertebrates . Annu. Rev. Anim. Biosci. 2021 ; 9 : 173 – 201 .

Chen J. , Birchler J.A. , Houben A. The non-Mendelian behavior of plant B chromosomes . Chromosome Res. 2022 ; 30 : 229 – 239 .

Betermier M. , Klobutcher L.A. , Orias E. Programmed chromosome fragmentation in ciliated protozoa: multiple means to chromosome ends . Microbiol. Mol. Biol. Rev. 2023 ; 87 : e0018422 .

Grishanin A. Chromatin diminution in Copepoda (Crustacea): pattern, biological role and evolutionary aspects . Comp. Cytogenet. 2014 ; 8 : 1 – 10 .

Beermann S. The diminution of heterochromatic chromosomal segments in Cyclops (Crustacea, Copepoda) . Chromosoma . 1977 ; 60 : 297 – 344 .

Nagao K. , Kubota S. , Goto Y. Internal deletion of highly repetitive DNA families from the non-eliminated chromosome in a Japanese hagfish, Eptatretus burgeri : first finding in this species . Chromosome Sci. 2021 ; 24 : 67 – 70 .

Goto Y. , Kubota S. , Kohno S. Highly repetitive DNA sequences that are restricted to the germ line in the hagfish Eptatretus cirrhatus : a mosaic of eliminated elements . Chromosoma . 1998 ; 107 : 17 – 32 .

Blackburn E.H. , Greider C.W. , Szostak J.W. Telomeres and telomerase: the path from maize, Tetrahymena and yeast to human cancer and aging . Nat. Med. 2006 ; 12 : 1133 – 1138 .

Yu G.L. , Blackburn E.H. Developmentally programmed healing of chromosomes by telomerase in Tetrahymena . Cell . 1991 ; 67 : 823 – 832 .

Wang J. , Veronezi G.M.B. , Kang Y. , Zagoskin M. , O’Toole E.T. , Davis R.E. Comprehensive chromosome end remodeling during programmed DNA elimination . Curr. Biol. 2020 ; 30 : 3397 – 3413 .

Dockendorff T.C. , Estrem B. , Reed J. , Simmons J.R. , Zadegan S.B. , Zagoskin M.V. , Terta V. , Villalobos E. , Seaberry E.M. , Wang J. The nematode Oscheius tipulae as a genetic model for programmed DNA elimination . Curr. Biol. 2022 ; 32 : 5083 – 5098 .

Simmons J.R. , Estrem B. , Zagoskin M.V. , Oldridge R. , Zadegan S.B. , Wang J. Chromosome fusion and programmed DNA elimination shape karyotypes of nematodes . Curr. Biol. 2024 ; 34 : 2147 – 2161 .

Muller F. , Wicky C. , Spicher A. , Tobler H. New telomere formation after developmentally regulated chromosomal breakage during the process of chromatin diminution in Ascaris lumbricoides . Cell . 1991 ; 67 : 815 – 822 .

Wang J. , Mitreva M. , Berriman M. , Thorne A. , Magrini V. , Koutsovoulos G. , Kumar S. , Blaxter M.L. , Davis R.E. Silencing of germline-expressed genes by DNA elimination in somatic cells . Dev. Cell . 2012 ; 23 : 1072 – 1080 .

Wang J. , Gao S. , Mostovoy Y. , Kang Y. , Zagoskin M. , Sun Y. , Zhang B. , White L.K. , Easton A. , Nutman T.B. et al. . Comparative genome analysis of programmed DNA elimination in nematodes . Genome Res. 2017 ; 27 : 2001 – 2014 .

Magnenat L. , Tobler H. , Muller F. Developmentally regulated telomerase activity is correlated with chromosomal healing during chromatin diminution in Ascaris suum . Mol. Cell. Biol. 1999 ; 19 : 3457 – 3465 .

Wang J. , Davis R.E. Ascaris . Curr. Biol. 2020 ; 30 : R423 – R425 .

Wang J. Genome analysis of programmed DNA elimination in parasitic nematodes . Methods Mol. Biol. 2021 ; 2369 : 251 – 261 .

Wang J. Genomics of the parasitic nematode Ascaris and its relatives . Genes (Basel) . 2021 ; 12 : 493 .

Wang J. , Czech B. , Crunk A. , Wallace A. , Mitreva M. , Hannon G.J. , Davis R.E. Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles . Genome Res. 2011 ; 21 : 1462 – 1477 .

Wang J. , Garrey J. , Davis R.E. Transcription in pronuclei and one- to four-cell embryos drives early development in a nematode . Curr. Biol. 2014 ; 24 : 124 – 133 .

Canela A. , Sridharan S. , Sciascia N. , Tubbs A. , Meltzer P. , Sleckman B.P. , Nussenzweig A. DNA breaks and end resection measured genome-wide by end sequencing . Mol. Cell . 2016 ; 63 : 898 – 911 .

Wong N. , John S. , Nussenzweig A. , Canela A. END-seq: an unbiased, high-resolution, and genome-wide approach to map DNA double-strand breaks and resection in human cells . Methods Mol. Biol. 2021 ; 2153 : 9 – 31 .

Lycka M. , Peska V. , Demko M. , Spyroglou I. , Kilar A. , Fajkus J. , Fojtova M. WALTER: an easy way to online evaluate telomere lengths from terminal restriction fragment analysis . BMC Bioinformatics . 2021 ; 22 : 145 .

Langmead B. , Salzberg S.L. Fast gapped-read alignment with Bowtie 2 . Nat. Methods . 2012 ; 9 : 357 – 359 .

Li H. , Handsaker B. , Wysoker A. , Fennell T. , Ruan J. , Homer N. , Marth G. , Abecasis G. , Durbin R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map format and SAMtools . Bioinformatics . 2009 ; 25 : 2078 – 2079 .

Quinlan A.R. , Hall I.M. BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics . 2010 ; 26 : 841 – 842 .

Raney B.J. , Dreszer T.R. , Barber G.P. , Clawson H. , Fujita P.A. , Wang T. , Nguyen N. , Paten B. , Zweig A.S. , Karolchik D. et al. . Track data hubs enable visualization of user-defined genome-wide annotations on the UCSC Genome Browser . Bioinformatics . 2014 ; 30 : 1003 – 1005 .

Zhang Y. , Liu T. , Meyer C.A. , Eeckhoute J. , Johnson D.S. , Bernstein B.E. , Nusbaum C. , Myers R.M. , Brown M. , Li W. et al. . Model-based analysis of ChIP-Seq (MACS) . Genome Biol. 2008 ; 9 : R137 .

Altschul S.F. , Madden T.L. , Schaffer A.A. , Zhang J. , Zhang Z. , Miller W. , Lipman D.J. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs . Nucleic Acids Res. 1997 ; 25 : 3389 – 3402 .

Muller F. , Tobler H. Chromatin diminution in the parasitic nematodes Ascaris suum and Parascaris univalens . Int. J. Parasitol. 2000 ; 30 : 391 – 399 .

Azzaria M. , McGhee J.D. DNA synthesis in the early embryo of the nematode Ascaris suum . Dev. Biol. 1992 ; 152 : 89 – 93 .

Niedermaier J. , Moritz K.B. Organization and dynamics of satellite and telomere DNAs in Ascaris : implications for formation and programmed breakdown of compound chromosomes . Chromosoma . 2000 ; 109 : 439 – 452 .

Gnugge R. , Reginato G. , Cejka P. , Symington L.S. Sequence and chromatin features guide DNA double-strand break resection initiation . Mol. Cell . 2023 ; 83 : 1237 – 1250 .

Mimitou E.P. , Yamada S. , Keeney S. A global view of meiotic double-strand break end resection . Science . 2017 ; 355 : 40 – 45 .

Jentsch S. , Tobler H. , Muller F. New telomere formation during the process of chromatin diminution in Ascaris suum . Int. J. Dev. Biol. 2002 ; 46 : 143 – 148 .

Sage E. , Shikazono N. Radiation-induced clustered DNA lesions: repair and mutagenesis . Free Radic. Biol. Med. 2017 ; 107 : 125 – 135 .

Borodin P. , Chen A. , Forstmeier W. , Fouche S. , Malinovskaya L. , Pei Y. , Reifova R. , Ruiz-Ruano F.J. , Schlebusch S.A. , Sotelo-Munoz M. et al. . Mendelian nightmares: the germline-restricted chromosome of songbirds . Chromosome Res. 2022 ; 30 : 255 – 272 .

Schlebusch S.A. , Ridl J. , Poignet M. , Ruiz-Ruano F.J. , Reif J. , Pajer P. , Paces J. , Albrecht T. , Suh A. , Reifova R. Rapid gene content turnover on the germline-restricted chromosome in songbirds . Nat. Commun. 2023 ; 14 : 4579 .

Schatz D.G. , Ji Y. Recombination centres and the orchestration of V(D)J recombination . Nat. Rev. Immunol. 2011 ; 11 : 251 – 263 .

Jung D. , Giallourakis C. , Mostoslavsky R. , Alt F.W. Mechanism and control of V(D)J recombination at the immunoglobulin heavy chain locus . Annu. Rev. Immunol. 2006 ; 24 : 541 – 570 .

Lam I. , Keeney S. Mechanism and regulation of meiotic recombination initiation . Cold Spring Harb. Perspect. Biol. 2014 ; 7 : a016634 .

Kang Y. , Wang J. , Neff A. , Kratzer S. , Kimura H. , Davis R.E. Differential chromosomal localization of centromeric histone CENP-A contributes to nematode programmed DNA elimination . Cell Rep. 2016 ; 16 : 2308 – 2316 .

Brickner J.R. , Garzon J.L. , Cimprich K.A. Walking a tightrope: the complex balancing act of R-loops in genome stability . Mol. Cell . 2022 ; 82 : 2267 – 2297 .

Petermann E. , Lan L. , Zou L. Sources, resolution and physiological relevance of R-loops and RNA–DNA hybrids . Nat. Rev. Mol. Cell Biol. 2022 ; 23 : 521 – 540 .

Aguilera A. , Garcia-Muse T. R loops: from transcription byproducts to threats to genome stability . Mol. Cell . 2012 ; 46 : 115 – 124 .

Jerkovic I. , Szabo Q. , Bantignies F. , Cavalli G. Higher-order chromosomal structures mediate genome function . J. Mol. Biol. 2020 ; 432 : 676 – 681 .

Zheng H. , Xie W. The role of 3D genome organization in development and cell differentiation . Nat. Rev. Mol. Cell Biol. 2019 ; 20 : 535 – 550 .

Dekker J. , Misteli T. Long-range chromatin interactions . Cold Spring Harb. Perspect. Biol. 2015 ; 7 : a019356 .

Lingner J. , Cech T.R. Purification of telomerase from Euplotes aediculatus : requirement of a primer 3′ overhang . Proc. Natl Acad. Sci. U.S.A. 1996 ; 93 : 10712 – 10717 .

Henderson E.R. , Blackburn E.H. An overhanging 3′ terminus is a conserved feature of telomeres . Mol. Cell. Biol. 1989 ; 9 : 345 – 348 .

Cai S.W. , de Lange T. CST–Polα/Primase: the second telomere maintenance machine . Genes Dev. 2023 ; 37 : 555 – 569 .

Takai H. , Aria V. , Borges P. , Yeeles J.T.P. , de Lange T. CST–polymerase alpha-primase solves a second telomere end-replication problem . Nature . 2024 ; 627 : 664 – 670 .

Kinzig C.G. , Zakusilo G. , Takai K.K. , Myler L.R. , de Lange T. ATR blocks telomerase from converting DNA breaks into telomeres . Science . 2024 ; 383 : 763 – 770 .

Lydeard J.R. , Lipkin-Moore Z. , Jain S. , Eapen V.V. , Haber J.E. Sgs1 and Exo1 redundantly inhibit break-induced replication and de novo telomere addition at broken chromosome ends . PLoS Genet. 2010 ; 6 : e1000973 .

Prieler S. , Chen D. , Huang L. , Mayrhofer E. , Zsoter S. , Vesely M. , Mbogning J. , Klein F. Spo11 generates gaps through concerted cuts at sites of topological stress . Nature . 2021 ; 594 : 577 – 582 .

Johnson D. , Crawford M. , Cooper T. , Claeys Bouuaert C. , Keeney S. , Llorente B. , Garcia V. , Neale M.J. Concerted cutting by Spo11 illuminates meiotic DNA break mechanics . Nature . 2021 ; 594 : 572 – 576 .

Garcia V. , Gray S. , Allison R.M. , Cooper T.J. , Neale M.J. Tel1(ATM)-mediated interference suppresses clustered meiotic double-strand-break formation . Nature . 2015 ; 520 : 114 – 118 .

Steinel N.C. , Lee B.S. , Tubbs A.T. , Bednarski J.J. , Schulte E. , Yang-Iott K.S. , Schatz D.G. , Sleckman B.P. , Bassing C.H. The ataxia telangiectasia mutated kinase controls Igκ allelic exclusion by inhibiting secondary Vκ-to-Jκ rearrangements . J. Exp. Med. 2013 ; 210 : 233 – 239 .

Wu P. , Takai H. , de Lange T. Telomeric 3′ overhangs derive from resection by Exo1 and Apollo and fill-in by POT1b-associated CST . Cell . 2012 ; 150 : 39 – 52 .

Symington L.S. , Gautier J. Double-strand break end resection and repair pathway choice . Annu. Rev. Genet. 2011 ; 45 : 247 – 271 .

Gnugge R. , Symington L.S. DNA end resection during homologous recombination . Curr. Opin. Genet. Dev. 2021 ; 71 : 99 – 105 .

Gonzalez de la Rosa P.M. , Thomson M. , Trivedi U. , Tracey A. , Tandonnet S. , Blaxter M. A telomere-to-telomere assembly of Oscheius tipulae and the evolution of rhabditid nematode chromosomes . G3 . 2021 ; 11 : jkaa020 .

Miller K.N. , Victorelli S.G. , Salmonowicz H. , Dasgupta N. , Liu T. , Passos J.F. , Adams P.D. Cytoplasmic DNA: sources, sensing, and role in aging and disease . Cell . 2021 ; 184 : 5506 – 5526 .

Krupina K. , Goginashvili A. , Cleveland D.W. Causes and consequences of micronuclei . Curr. Opin. Cell Biol. 2021 ; 70 : 91 – 99 .

Mazzagatti A. , Engel J.L. , Ly P. Boveri and beyond: chromothripsis and genomic instability from mitotic errors . Mol. Cell . 2024 ; 84 : 55 – 69 .

Streit A. , Wang J. , Kang Y. , Davis R.E. Gene silencing and sex determination by programmed DNA elimination in parasitic nematodes . Curr. Opin. Microbiol. 2016 ; 32 : 120 – 127 .

Yao M.C. , Zheng K. , Yao C.H. A conserved nucleotide sequence at the sites of developmentally regulated chromosomal breakage in Tetrahymena . Cell . 1987 ; 48 : 779 – 788 .

Yao M.C. , Yao C.H. , Monks B. The controlling sequence for site-specific chromosome breakage in Tetrahymena . Cell . 1990 ; 63 : 763 – 772 .

Klobutcher L.A. , Gygax S.E. , Podoloff J.D. , Vermeesch J.R. , Price C.M. , Tebeau C.M. , Jahn C.L. Conserved DNA sequences adjacent to chromosome fragmentation and telomere addition sites in Euplotes crassus . Nucleic Acids Res. 1998 ; 26 : 4230 – 4240 .

Betermier M. , Duharcourt S. Programmed rearrangement in ciliates: Paramecium . Microbiol. Spectr. 2014 ; 2 : 369 – 388 .

Fan Q. , Yao M. New telomere formation coupled with site-specific chromosome breakage in Tetrahymena thermophila . Mol. Cell. Biol. 1996 ; 16 : 1267 – 1274 .

Her J. , Bunting S.F. How cells ensure correct repair of DNA double-strand breaks . J. Biol. Chem. 2018 ; 293 : 10502 – 10511 .

Scully R. , Panday A. , Elango R. , Willis N.A. DNA double-strand break repair-pathway choice in somatic mammalian cells . Nat. Rev. Mol. Cell Biol. 2019 ; 20 : 698 – 714 .

Tan K.T. , Slevin M.K. , Leibowitz M.L. , Garrity-Janger M. , Li H. , Meyerson M. Neotelomeres and telomere-spanning chromosomal arm fusions in cancer genomes revealed by long-read sequencing . 2023 ; bioRxiv doi: 01 December 2023, preprint: not peer reviewed https://doi.org/10.1101/2023.11.30.569101 .

Wilkie A.O. , Lamb J. , Harris P.C. , Finney R.D. , Higgs D.R. A truncated human chromosome 16 associated with alpha thalassaemia is stabilized by addition of telomeric repeat (TTAGGG) n . Nature . 1990 ; 346 : 868 – 871 .

Email alerts

Citing articles via.

• Editorial Board

Affiliations

• Online ISSN 1362-4962
• Print ISSN 0305-1048
• Copyright © 2024 Oxford University Press
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Advertising
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Have a language expert improve your writing

Run a free plagiarism check in 10 minutes, generate accurate citations for free.

• Knowledge Base

Methodology

• Mixed Methods Research | Definition, Guide & Examples

Mixed Methods Research | Definition, Guide & Examples

Published on August 13, 2021 by Tegan George . Revised on June 22, 2023.

Mixed methods research combines elements of quantitative research and qualitative research in order to answer your research question . Mixed methods can help you gain a more complete picture than a standalone quantitative or qualitative study, as it integrates benefits of both methods.

Mixed methods research is often used in the behavioral, health, and social sciences, especially in multidisciplinary settings and complex situational or societal research.

• To what extent does the frequency of traffic accidents ( quantitative ) reflect cyclist perceptions of road safety ( qualitative ) in Amsterdam?
• How do student perceptions of their school environment ( qualitative ) relate to differences in test scores ( quantitative ) ?
• How do interviews about job satisfaction at Company X ( qualitative ) help explain year-over-year sales performance and other KPIs ( quantitative ) ?
• How can voter and non-voter beliefs about democracy ( qualitative ) help explain election turnout patterns ( quantitative ) in Town X?
• How do average hospital salary measurements over time (quantitative) help to explain nurse testimonials about job satisfaction (qualitative) ?

Table of contents

When to use mixed methods research, mixed methods research designs, advantages of mixed methods research, disadvantages of mixed methods research, other interesting articles, frequently asked questions.

Mixed methods research may be the right choice if your research process suggests that quantitative or qualitative data alone will not sufficiently answer your research question. There are several common reasons for using mixed methods research:

• Generalizability : Qualitative research usually has a smaller sample size , and thus is not generalizable. In mixed methods research, this comparative weakness is mitigated by the comparative strength of “large N,” externally valid quantitative research.
• Contextualization: Mixing methods allows you to put findings in context and add richer detail to your conclusions. Using qualitative data to illustrate quantitative findings can help “put meat on the bones” of your analysis.
• Credibility: Using different methods to collect data on the same subject can make your results more credible. If the qualitative and quantitative data converge, this strengthens the validity of your conclusions. This process is called triangulation .

As you formulate your research question , try to directly address how qualitative and quantitative methods will be combined in your study. If your research question can be sufficiently answered via standalone quantitative or qualitative analysis, a mixed methods approach may not be the right fit.

But mixed methods might be a good choice if you want to meaningfully integrate both of these questions in one research study.

Keep in mind that mixed methods research doesn’t just mean collecting both types of data; you need to carefully consider the relationship between the two and how you’ll integrate them into coherent conclusions.

Mixed methods can be very challenging to put into practice, and comes with the same risk of research biases as standalone studies, so it’s a less common choice than standalone qualitative or qualitative research.

Receive feedback on language, structure, and formatting

Professional editors proofread and edit your paper by focusing on:

• Academic style
• Vague sentences
• Style consistency

See an example

There are different types of mixed methods research designs . The differences between them relate to the aim of the research, the timing of the data collection , and the importance given to each data type.

As you design your mixed methods study, also keep in mind:

• Your research approach ( inductive vs deductive )
• Your research questions
• What kind of data is already available for you to use
• What kind of data you’re able to collect yourself.

Here are a few of the most common mixed methods designs.

Convergent parallel

In a convergent parallel design, you collect quantitative and qualitative data at the same time and analyze them separately. After both analyses are complete, compare your results to draw overall conclusions.

• On the qualitative side, you analyze cyclist complaints via the city’s database and on social media to find out which areas are perceived as dangerous and why.
• On the quantitative side, you analyze accident reports in the city’s database to find out how frequently accidents occur in different areas of the city.

In an embedded design, you collect and analyze both types of data at the same time, but within a larger quantitative or qualitative design. One type of data is secondary to the other.

This is a good approach to take if you have limited time or resources. You can use an embedded design to strengthen or supplement your conclusions from the primary type of research design.

Explanatory sequential

In an explanatory sequential design, your quantitative data collection and analysis occurs first, followed by qualitative data collection and analysis.

You should use this design if you think your qualitative data will explain and contextualize your quantitative findings.

Exploratory sequential

In an exploratory sequential design, qualitative data collection and analysis occurs first, followed by quantitative data collection and analysis.

You can use this design to first explore initial questions and develop hypotheses . Then you can use the quantitative data to test or confirm your qualitative findings.

“Best of both worlds” analysis

Combining the two types of data means you benefit from both the detailed, contextualized insights of qualitative data and the generalizable , externally valid insights of quantitative data. The strengths of one type of data often mitigate the weaknesses of the other.

For example, solely quantitative studies often struggle to incorporate the lived experiences of your participants, so adding qualitative data deepens and enriches your quantitative results.

Solely qualitative studies are often not very generalizable, only reflecting the experiences of your participants, so adding quantitative data can validate your qualitative findings.

Method flexibility

Mixed methods are less tied to disciplines and established research paradigms. They offer more flexibility in designing your research, allowing you to combine aspects of different types of studies to distill the most informative results.

Mixed methods research can also combine theory generation and hypothesis testing within a single study, which is unusual for standalone qualitative or quantitative studies.

Mixed methods research is very labor-intensive. Collecting, analyzing, and synthesizing two types of data into one research product takes a lot of time and effort, and often involves interdisciplinary teams of researchers rather than individuals. For this reason, mixed methods research has the potential to cost much more than standalone studies.

Differing or conflicting results

If your analysis yields conflicting results, it can be very challenging to know how to interpret them in a mixed methods study. If the quantitative and qualitative results do not agree or you are concerned you may have confounding variables , it can be unclear how to proceed.

Due to the fact that quantitative and qualitative data take two vastly different forms, it can also be difficult to find ways to systematically compare the results, putting your data at risk for bias in the interpretation stage.

Prevent plagiarism. Run a free check.

If you want to know more about statistics , methodology , or research bias , make sure to check out some of our other articles with explanations and examples.

• Degrees of freedom
• Null hypothesis
• Discourse analysis
• Control groups
• Non-probability sampling
• Quantitative research
• Inclusion and exclusion criteria

Research bias

• Rosenthal effect
• Implicit bias
• Cognitive bias
• Selection bias
• Negativity bias
• Status quo bias

Quantitative research deals with numbers and statistics, while qualitative research deals with words and meanings.

Quantitative methods allow you to systematically measure variables and test hypotheses . Qualitative methods allow you to explore concepts and experiences in more detail.

In mixed methods research , you use both qualitative and quantitative data collection and analysis methods to answer your research question .

Data collection is the systematic process by which observations or measurements are gathered in research. It is used in many different contexts by academics, governments, businesses, and other organizations.

Triangulation in research means using multiple datasets, methods, theories and/or investigators to address a research question. It’s a research strategy that can help you enhance the validity and credibility of your findings.

Triangulation is mainly used in qualitative research , but it’s also commonly applied in quantitative research . Mixed methods research always uses triangulation.

These are four of the most common mixed methods designs :

• Convergent parallel: Quantitative and qualitative data are collected at the same time and analyzed separately. After both analyses are complete, compare your results to draw overall conclusions. 
• Embedded: Quantitative and qualitative data are collected at the same time, but within a larger quantitative or qualitative design. One type of data is secondary to the other.
• Explanatory sequential: Quantitative data is collected and analyzed first, followed by qualitative data. You can use this design if you think your qualitative data will explain and contextualize your quantitative findings.
• Exploratory sequential: Qualitative data is collected and analyzed first, followed by quantitative data. You can use this design if you think the quantitative data will confirm or validate your qualitative findings.

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the “Cite this Scribbr article” button to automatically add the citation to our free Citation Generator.

George, T. (2023, June 22). Mixed Methods Research | Definition, Guide & Examples. Scribbr. Retrieved August 28, 2024, from https://www.scribbr.com/methodology/mixed-methods-research/

Is this article helpful?

Tegan George

Other students also liked, writing strong research questions | criteria & examples, what is quantitative research | definition, uses & methods, what is qualitative research | methods & examples, get unlimited documents corrected.

✔ Free APA citation check included ✔ Unlimited document corrections ✔ Specialized in correcting academic texts

• India Today
• Business Today
• Harper's Bazaar
• Brides Today
• Cosmopolitan
• India Today Hindi
• Reader’s Digest
• Aaj Tak Campus

Download App

BITS Pilani invites applications for Professor of Practice positions: Direct link

Bits pilani has started inviting experienced professionals to apply for the professor of practice positions, aiming to blend academic learning with industry expertise. this unique opportunity allows experts to contribute to cutting-edge research and innovative teaching methods..

Listen to Story

The exam conducting body, Birla Institute of Technology & Science (BITS) Pilani is seeking experienced industry professionals for the role of Professor of Practice (PoP). This position is designed to integrate real-world experience with academic learning, enhancing students' practical skills and understanding. Interested and eligible applicants are advised to apply on or before the last date, which is September 10, 2024 on the official website,i.e., bits-pilani.ac.in/

According to BITS Pilani, Professors of Practice will play a crucial role in advancing the institution's research and educational initiatives. Their responsibilities will include developing new facilities and labs, designing innovative courses, collaborating with students and faculty, and driving industry-linked applied research that could lead to publications and patents.

ELIGIBILITY CRITERIA

Candidates must have substantial industry experience and should have held significant positions such as CEO, CTO, Vice President, Principal Scientist, or Senior Research Scientist.

STEPS TO APPLY

Your response will get submit automatically.

Direct link to apply for the above positions